Write and argument claim based on the following prompt:Write an essay in which you state your position on whether or not the driving age should be raised to twenty-one.

Answers

Answer 1

The topic of raising the driving age to 21 has been debated for many years. Those in favor of raising the driving age argue that younger drivers are more likely to be involved in accidents due to their lack of experience and maturity. On the other hand, those against raising the driving age argue that 18-year-olds are legally adults and should have the right to drive. After considering both sides, I firmly believe that the driving age should not be raised to 21.

Firstly, 18-year-olds are legally adults and should have the right to make their own decisions, including the decision to drive. It is not fair to restrict their freedom to drive simply because of their age. Moreover, many young people need to drive to attend school or work, and raising the driving age could negatively impact their ability to do so.

Secondly, studies have shown that raising the driving age would not necessarily lead to a decrease in accidents. While it is true that younger drivers are more likely to be involved in accidents, this is due to their lack of experience rather than their age. Instead of raising the driving age, we should focus on improving driver education programs and providing more opportunities for young drivers to gain experience.

Finally, raising the driving age would not address the root causes of accidents, such as distracted driving or driving under the influence of drugs or alcohol. We need to focus on educating all drivers, regardless of age, about the dangers of these behaviors and enforcing strict penalties for those who engage in them.

In conclusion, while it is important to ensure the safety of all drivers on the road, raising the driving age to 21 is not the solution. Instead, we should focus on improving driver education programs and promoting safe driving behaviors. It is important to remember that 18-year-olds are legal adults and should have the right to make their own decisions, including the decision to drive.


Related Questions

How can I analyze this poem

VALTUNE

This Valentine you come in proportional measure Pearl of the night flaunting your season's ornament
In your flimsy night-gown stand your charming frame
I could see your charming frame
Bubbling, bear my bulbs straining your garment
These are ritual steps, o damsel!
It is the damsel's ritual steps

Look up yourself in the ray of the season And feel your gifts, the alluring frame of the season's guest
Catwalk and sway your gait to the season's rhythm
And arrest all with your tempting ornaments
Let us explore the endless passion of the day
Yours is the soothing tune of the season
My Val of all seasons​

Answers

1. Read the poem aloud

2. Unpack what the poem is about

3. Pay attention to the rhythm

4. Look for enjambment

5. Look for the techniques

6. Consider the poetic form

Nick describes Gatsby in this way:



A. He was a blonde, spiritless man, anemic, and faintly handsome.



B. His speaking voice, a gruff husky tenor, added to the impression of fractiousness he conveyed. There was a touch of paternal contempt in it, even toward people he liked— and there were men at New Haven who had hated his guts.



C. If personality is an unbroken series of successful gestures, then there was something gorgeous about him, some heightened sensitivity to the promises of life, as if he were related to one of those intricate machines that register earthquakes ten thousand miles away.




D. He had on a dress suit and patent leather shoes and I couldn’t keep my eyes off him but every time he looked at me I had to pretend to be looking at the advertisement over his head.

Answers

Explain Gatsby to Nick when they first meet. He appears to see the best in people and is a pleasant, upbeat individual.

How would Nick characterize Gatsby's?

Nick sees Gatsby as a man with many flaws who is dishonest and rude, but who is nevertheless considered "great" because to his enormous optimism and capacity to make his ambitions come true. Check out this detailed examination of Jay Gatsby.

What is Nick's complement to Gatsby?

"You're worth the whole bunch combined," was said. I've always felt good about saying that. Because I always found fault with him, it was the only complement I ever gave him. The final time Nick sees Gatsby alive is in Chapter 8, where he confronts Gatsby with these words.

To know more about Nick Gatsby visit:

https://brainly.com/question/13364480

#SPJ1

In "Attack the Water," Mirikitanl uses.
O metaphorical
O rhetorical
O figurative
O concrete
language to create vivid Images of the human effects of war.

Answers

Answer:

The correct answer is "figurative".

Explanation:

"Figurative" language is used to create imagery and comparisons that go beyond the literal meaning of words. This type of language is often used to make writing more engaging, interesting, and vivid. In "Attack the Water," Mirikitani uses figurative language to describe the effects of war on the human body and spirit, such as comparing skin to "parched paper" and describing the body as a "withered plant."

Write: What's the purpose of the section "Culture is Alive"?

Answers

The section "Culture is Alive" is designed to be an exploration of the cultural practices of a particular society.

What is exploration?

Exploration is the act of investigating an environment to discover its hidden potential, secrets, and resources. It is a process of experimentation and discovery that can involve physical exploration, such as traversing a landscape or uncovering a hidden artifact, as well as abstract exploration, such as researching a topic or seeking out new experiences. Exploration can be undertaken as a means to gain knowledge, to create new experiences, or to better understand our place in the world.

It looks at how the culture is represented in everyday life, from food, music, and art, to language, customs, and beliefs. The purpose is to show how culture is a living and dynamic thing that is constantly changing, adapting, and evolving over time. This section seeks to highlight the importance of culture and how it shapes the lives of individuals and communities.

To learn more about exploration

https://brainly.com/question/27325845

#SPJ9

what lesson could be learned from the tragedy of Rustam and Suhrab? Explain

Answers

The tragedy of Rustam and Suhrab, an episode in the Shahnameh (Book of Kings) by Persian poet Ferdowsi, teaches the lesson that misunderstanding and miscommunication can lead to tragic consequences. Rustam, a warrior and father, accidentally kills his son Suhrab in a battle due to a lack of communication and knowledge of each other's identities. The story highlights the importance of communication and understanding in preventing conflicts and tragedy. It also emphasizes the human cost of war and the pain that can result from actions taken in the heat of battle. Overall, the lesson that can be learned from the tragedy of Rustam and Suhrab is that understanding and empathy are essential in preventing conflict and tragedy, and that the cost of war is often too high to justify.

write an informal letter telling your uncle about your school excursion to cameroon

Answers

Answer:

                                                                                 [Your Address]

Dear Uncle,

I hope this letter finds you in good health and high spirits. I am writing to share my exciting experience on our school excursion to Cameroon. It was a truly unforgettable trip that I will always cherish.

We spent a total of 10 days exploring the country, visiting different cities, and experiencing the diverse cultures of Cameroon. We started our journey in Douala, where we visited the Wouri River and the bustling markets. We also had a chance to visit the Limbe Wildlife Centre, which was one of my favorite parts of the trip. I got to see so many different animals up close, including chimpanzees, gorillas, and mandrills.

We then traveled to Yaounde, the capital city of Cameroon, where we visited the National Museum of Cameroon and learned about the history and traditions of the country. We also had the opportunity to meet with local students and learn about their daily lives and customs.

One of the most memorable experiences of the trip was when we visited the Baka Pygmies, a tribal community that has lived in the forests of Cameroon for centuries. We got to learn about their unique culture and way of life, and even joined in some of their traditional dances and songs.

Overall, the trip was a great opportunity for me to broaden my horizons and learn about a new country and culture. I feel so lucky to have had this experience, and I can't wait to share more stories and photos with you when I see you next.

Take care, and I hope to hear from you soon.

Warmly,

[Your Name]

Explanation:

Your letter thank you

Tybalt calls Romeo a Villain. How does Romeo try to convince Tybalt that he is not?

Answers

Answer:

He provokes Mercutio into a duel, while Benvolio tries to stop the fighting. Romeo enters, and Tybalt calls him a villain. Romeo, having just married Juliet (who is Tybalt's cousin), swears he's not, but Tybalt challenges him to draw. Mercutio draws first, then Tybalt, and they eventually fall to fighting.

Activty IV
A. GIVING INFORMATION. Look for one (1) example of research problem or research study wherein the different kinds of qualitative research below were used.

Case Study
Ethnography
Phenomenology
Content and Discourse Analysis
Grounded Theory

Answers

Phenomenology, anthropology, grounded theory, & history make up the right answer, which is D.

What does the term "phenomenology" mean?

A philosophy of sensation is called phenomenology. The lived reality of people is considered to be the ultimate source among all significance and worth in phenomenology. All philosophic principles, scientific theories, and aesthetic judgments are abstractions from of the natural laws of the universe.

What is a phenomenology example?

Exploring the actual experiences of women having breast biopsy or even the lived experiences for family members preparing for just a loved one to undergo major surgery are two examples of phenomenology research. Phenomenology is a phrase that is frequently used without being fully understood.

To know more about phenomenology visit:

https://brainly.com/question/15874681

#SPJ1

Sydney, curious, followed the melodic sound down the stairs and found a Tanner at the piano. What are the two adjectives in the sentence?

Answers

The two adjectives in the sentence are "curious" and "melodic".

Highlight the word(s) modified by the word, clause, or phrase in bold.
Whitney Houston overheard her yoga instructor yelling at the
TV screen.

Answers

Answer:

Whitney Houston overheard her yoga instructor yelling at the TV screen.

The phrase "yelling at the TV screen" modifies the noun "instructor".

Given the teen driving statistics reported in Passage B, are the requirements for obtaining an unrestricted driver’s license in Georgia reasonable?

Answers

Georgia's requirements for obtaining a full driver's license are determined by whether you held a provisional or learner's permit prior to turning 18.

What are Georgia's Unrestricted Driver's Licenses?

As part of your application, you must also pass a road test and show that you have practiced driving for 40 hours, including six hours at night. Provisional License: Your provisional license can be exchanged for a full license if you already have one.

If you don't already have a license or permit, you'll need to meet the requirements for both to get a provisional license and a license. When you apply for your full license, you will also need to pass a knowledge test, a behind-the-wheel test, and a vision test.

Learn more about driving license:

brainly.com/question/18611420

#SPJ1

Why would Fitzgerald write about daisy's child?

Answers

Fitzgerald may write about Daisy's child to demonstrate the idea that wealth and privilege cannot ultimately bring true happiness.

What is Fitzgerald?

Fitzgerald is a small city located in Ben Hill County, Georgia. It is the county seat of Ben Hill County and is known as the "Camellia City of South Georgia". The city was founded in 1896 and named after the founder, Philemon Fitzgerald. It is home to the Blue and Gold Museum, which features artifacts from the early days of the city. It is also a key city in the agricultural industry, being the largest producer of peanuts in the state of Georgia. Fitzgerald has many parks and trails, providing a great place to relax and explore the outdoors. It is also home to a few unique businesses, such as a fun center and a drive-in movie theater.

To learn more about Fitzgerald

https://brainly.com/question/15115283

#SPJ1

According to Greek mythology, what happens to a person's soul after death? Summarize the basic pattern of events as described in the excerpt from Hades: Lord of the Dead

Answers

The ancient Greeks believed that after death, the soul departs from the body and is taken to the afterlife.

What does Greek mythology mean by the afterlife?

Nonetheless, they did not place great stress on the idea that righteousness would be rewarded and evil punished in the afterlife. The majority of ancient Greeks believed that the soul left the body after death and continued in some manner.

What was done with a person's body after death by the ancient Greeks?

Greeks started burying their deceased in individual graves rather than communal tombs from 1100 BC. The Athenians typically cremated their dead and buried their ashes in urns, making them a notable exception. Greek cemetery grew in size throughout the early Archaic period, but grave items fell.

To know more about Greek mythology visit:-

https://brainly.com/question/28017628

#SPJ1

TRUE OR FALSE - There are 86400 seconds in a day. ​

Answers

Answer:

There are 86400 seconds in a day. [tex]\large{\pmb{\underline{\underline{\bf{\purple{TRUE}}}}}}[/tex]

Answer:

True

Explanation:

To solve for the number of second in a day, we can use this equation:

(Seconds in a minute × minutes in a hour) × hours in a day = seconds per day

(60 × 60) × 24 =?

Solving what is in the parenthesis:

3,600 × 24 = 86400

Therefore, the statement is true.

Write an essay entitled ‘What does Prospero’s language reveal about his character in Act 1 Scene 2,
lines 189–321?’.
You could include the following content:
• How Prospero’s language shows he can be merciful as well as ruthless and controlling.
• The techniques he uses to control those around him.
• His relationships with Ariel, Miranda and Caliban.
• What all this tells you about his character.
(max 1000 words)

I just need 900 words ASAP I NEED THIS BY TODAY.
Write the text in doc and post it.

Answers

In Act 1 Scene 2 of William Shakespeare's play "The Tempest," Prospero's language reveals a complex and multifaceted character. Through his interactions with the other characters in this scene, Prospero's ability to be both merciful and ruthless, controlling and manipulative, becomes clear. Additionally, his relationships with Ariel, Miranda, and Caliban provide insight into his motivations and the inner workings of his mind.

Prospero's language in Act 1 Scene 2 demonstrates his ability to be both merciful and ruthless. In his soliloquy at the beginning of the scene, Prospero expresses his desire for revenge against his brother Antonio, who has wronged him and usurped his position as Duke of Milan. His language is full of bitterness and resentment, as he refers to Antonio as a "false brother" and describes his own "losses" and "sorrows." However, even as he expresses his desire for vengeance, Prospero also shows a willingness to forgive those who have wronged him. He states that he "doth forgive / The rankest treason" if those who have committed it are truly penitent, revealing a more merciful side to his character.

Prospero's language also reveals his desire for control and his willingness to use any means necessary to achieve his goals. When he first encounters Miranda on the island, he uses his language to manipulate and control her, painting himself as a victim of his brother's treachery and emphasizing his own suffering in order to gain her sympathy and loyalty. He also tells her that he has caused the storm that brought them to the island, using his language to convince her that he did so for her own good. This demonstrates Prospero's desire for control and his willingness to use any means necessary to achieve his goals.

Prospero's language towards Ariel reveals his power and control over the spirit, as well as his appreciation for Ariel's loyalty and obedience. He speaks to Ariel in a commanding tone, acknowledging his debt to the spirit and promising to "pay thy graces / Home both in word and deed." This language shows that while Prospero may be a powerful and controlling figure, he is also capable of gratitude and kindness.

Prospero's relationship with Miranda is similarly complex. He alternates between treating her as a beloved daughter and a pawn in his schemes. His language towards her is often paternalistic, speaking of her in affectionate terms such as "dear daughter" and "my sweet child." However, he also uses her as a tool to achieve his goals, manipulating her emotions and beliefs in order to control her. For example, he tells her that the island is inhabited by "a few ungracious natures" who are "worse than devils," using this language to make her fearful and dependent on him.

Finally, Prospero's language towards Caliban reveals his contempt for the island's original inhabitant. He refers to Caliban as a "slave" and a "monster," speaking of his "filthy" nature and "barbarous" customs. This language demonstrates Prospero's belief in his own superiority and his desire to control even those whom he views as beneath him. However, it also reveals his fear and insecurity, as he is threatened by Caliban's connection to the island and his potential to disrupt Prospero's plans.

Overall, Prospero's language in Act 1 Scene 2 reveals a character who is both complex and multifaceted. He is capable of both mercy and ruthlessness, and his desire for control is evident in his interactions with the other characters. However, his relationships with Ariel, Miranda, and Caliban also demonstrate his appreciation for loyalty and obedience, as well as his fear and insecurity. Ultimately, Prospero's language

50 points!
Read the paragraph from “Make Your Own Microscope.”

Another excellent thing about this project was how much it taught me. As I read articles, followed directions, and watched online videos about what to do, I learned quite a bit. For example, I learned that lasers were first created as “an outgrowth of a suggestion made by Albert Einstein” more than 100 years ago (Hecht). I also learned that all laser pointers generate light with laser diodes. That light then passes through small lenses to focus it (“Laser Pointers Information”). I never knew any of that stuff before. Once I got to work, I also learned how easy it was to remove those lenses. And, of course, I learned how to attach one of those lenses to a smartphone so it can act like a magnifying glass.

Question 1
Part A

What is the author’s purpose in the paragraph?

Responses

to provide instruction on how to build a smartphone microscope


to describe the knowledge she gained by making a smartphone microscope

to prove that anyone can put together a smartphone microscope


to explain how the parts of a smartphone microscope work

Question 2
Part B

Which evidence from the paragraph best supports the answer to Part A?

Responses

“Another excellent thing about this project was how much it taught me.”


“That light then passes through small lenses to focus it…”


“Once I got to work, I also learned how easy it was to remove those lenses.”


“As I read articles, followed directions, and watched online videos about what to do…”

Answers

Answer:

Question 1: To describe the knowledge she gained by making a smartphone microscope.

Question 2: “Another excellent thing about this project was how much it taught me.”

Explanation:

L + Ratio

Answer: Question 1: To describe the knowledge she gained by making a smartphone microscope.

Question 2: “Another excellent thing about this project was how much it taught me.”

What is the meaning of "only one or two commitments were possible"?

Answers

The meaning of "only one or two commitments were possible" is that the resources available to the American troops were limited. So, they could only deploy their troops to one or two divisions.

What is the meaning of the phrase?

The meaning of the phrase, "only one or two commitments were possible" is that the Americans did not have a lot of forces to fight during the ongoing war. Some of the mentioned islands required that some forces be deployed to them. But since the American capabilities in terms of the number of troops available were not so much, they had to make only one or two commitments.

So, the main point is that the Americans were short on the number of military personnel available, so they could only commit what they had to few places.

Learn more about American troops here:

https://brainly.com/question/30609628

#SPJ1

To put the sentence in formal style, which is the best choice to replace the underlined phrase? a story that appeals to the audience a tearjerer that'll for sure grab the audience a yarn that's definitely gonna win awards a film that is guaranteed to rock​

Answers

A story that appeals to the audience is the best phrase, to put the sentence in formal style, hence option 1 is correct.

What is a formal style in writing?

Formal style in writing is characterized by the use of more complex sentence structures, standard English, occasional use of personal pronouns, and a deficiency of colloquial.

The passage suggests an 'a story that appeals to the audience' tells a formal style in writing, and a film that is guaranteed to rock is not formal style.

Therefore, option A story that appeals to the audience is correct.

Learn more about formal style, here:

https://brainly.com/question/30154980

#SPJ1

The given question is incomplete, so the most probable complete question is,

To put the sentence in formal style, which is the best choice to replace the underlined phrase?

1. a story that appeals to the audience

2. a yarn that's definitely going to win awards

3. a film that is guaranteed to rock

4.  grab the audience.

Answer: A- a story that appeals to the audience

Explanation: got it right on edge

The Hendricks family abided by the campaign and didn't buy new clothes or toys for months. In mother traveled up north to ask white people who supported civil rights to donate money to ACM them to send toys and clothes for poor black families in Birmingham for Christmas. By mid-Dec games, puzzles, train sets, dolls, and stuffed animals filled Audrey's living room. Which of Mrs. Hendricks's character traits is best highlighted in this excerpt? ​

Answers

Answer:

Explanation:

Based on the given excerpt, the character trait of Mrs. Hendricks that is best highlighted is her selflessness. She made an effort to reach out to white people who supported civil rights to donate money and send toys and clothes for poor black families in Birmingham for Christmas. This shows that she is not only concerned about her family but also about the welfare of others who are in need. She sacrificed her time and effort to help other people.

Which words or phrases from paragraph four of Federalist No. 10. help the reader infer the meaning of "cabals." Select
three answers.
Click here to read the excerpt.
D'of afew
© 'confusion of a multitude*
D 'raised to a certain number*
© 'to guard against*
D 'however large*
© 'must be limited*

Answers

The three phrases from paragraph four of Federalist No. 10 that help the reader infer the meaning of "cabals" are: 'confusion of a multitude,' 'to guard against,' and 'must be limited.'

characteristic that
In two to three sentences, explain a
Della and Jim have in common and what this
characteristic shows about their relationship.

Answers

James and Della are selfless. They both give up something significant in order to satisfy the other.

Who was Jam and Della?

Jim gives up his watch, while Della gives up her hair. Their generosity demonstrates that they are in a very devoted, contented relationship.

In Della's remark, it is made clear that she and Jim are straightforward members of the working class: "Cut it off and sold it," stated Della.

The biased third-person limited narrator reveals that they are young and in love: "Poor boy, he was only twenty-two—and to be burdened with a family!" The narrator makes it very evident that they are materially foolish.

Therefore, James and Della are selfless. They both give up something significant in order to satisfy the other.

To learn more about Della, refer to the link:

https://brainly.com/question/19903082

#SPJ9

The speaker often refers to promises throughout the poem. What are they?

Answers

The speaker often refers to promises throughout the poem. the correct answer would be "Vows of love".

Define the term poem.

A poem is a piece of writing that uses language and literary techniques to convey emotion, ideas, and images. Poems can be written in various forms and styles, such as sonnets, haikus, free verse, and ballads, and can cover a wide range of topics, from love and nature to politics and social issues. Poetry often employs figurative language, such as metaphors, similes, and personification, to create powerful imagery and convey deeper meanings. Poets use words to create a rhythm and sound that can enhance the emotional impact of the poem.

Based on the information given, it seems that the promises being referred to are "vows of love". This is because the other options - confirmation of employment offers, party invitation responses, and ballads - do not typically involve promises in the same way that vows of love do. Vows of love are promises made between two people in a romantic relationship to love, honor, and cherish each other, often for the rest of their lives. These promises are a common theme in love poetry and literature.

Therefore, the correct option would be "Vows of love".

To learn more about poems click here

https://brainly.com/question/9861

#SPJ1

What is the meaning of "briefly at this low point in British fortunes but authentically and intensely"?

Answers

The meaning of "briefly at this low point in British fortunes but authentically and intensely" is that the period of time was marked by low times in the welfare of Britain but the main focus of the government of the United States was protecting its territory.

What is the point?

The point in this text is that the period of the war being described was inimical to the existence of the British government but the main focus of the American president was the sustenance of the existence of the country.

This meant that any threat was not to be taken lightly and the president was resolved to put in his best to tackle any such issues.

Learn more about Roosevelt here:

https://brainly.com/question/25608255

#SPJ1

how information is used in society to influence behavior

Answers

Answer:

Social media has changed not only our powers of thinking making us taciturnative, but today governs our behavior and social conducts as well.

The Cons of Social Media

It can contribute to social isolationIt can be used as an effective tool for bullyingIt is often used to snoop on othersPeople who use it are more likely to social compare themselves to othersPresents a false idea of “friendship”Research has shown that it can increase feelings of depression and anxietyIt can present false narratives about others and facts that cannot be easily verifiedWe actually do not know who is on the other end of a social media accountNot everyone has equal accessCan spread misinformation to large amounts of peopleCan be used as a tool of hate (spreading racism, homophobia, classism, etc.)Can expose children to developmentally inappropriate materialCan lead to addictionCan be used to rule out job applicants based on personal things they have posted or others have posted about them

When you vote at the ballot box, you generally end up with something different than what you thought you voted for. When you vote daily in the supermarket, on the other hand, you get precisely what you voted for, and so does everyone else.

The text mainly serves to

a) suggest that conformity is more desirable than unanimity.

b) caution that unanimity and conformity are incompatible aims.

c) point out that two activities have similar flaws.

d) emphasize a sharp contrast between two familiar activities.

Answers

d) emphasize a sharp contrast between two familiar activities.

The text is highlighting the difference between voting at the ballot box (which can lead to unexpected outcomes) and voting at the supermarket (where you get exactly what you voted for). The contrast between these two activities is being emphasized.

Read the following sentence from paragraph one of Federalist No. 10 and answer the question.
Let us examine the points in which it varies from pure democracy, and we shall comprehend both the nature
of the cure and the efficacy which it must derive from the Union
Which of the following best characterizes Madison's approach in this excerpt?
O reasonable and conversational
authoritative and arbitrary
O unsophisticated and chatty
O excitable and provocative

Answers

What best characterizes Madison's approach in this excerpt is reasonable and conversational option A.

Why is Madison's approach reasonable and conversational?

Madison's approach in this excerpt is reasonable and conversational because he uses clear and concise language to explain his ideas, and presents his argument in a logical and structured manner. He is not using strong or aggressive language, but rather using a calm and reasoned tone to make his point. Additionally, he invites the reader to examine his argument and consider the points he presents, which is consistent with a conversational approach.

Find more useful information on approach here;

https://brainly.com/question/28260180

#SPJ1

The observation about Jordan Baker and "most affectations" (paragraph 448) mainly suggests that Nick.
A. senses that Jordan is falling in love with him
B. notices that Jordan is very good at hiding her feelings
C. takes a long time to trust people, especially women
D. realizes that Jordan is a cheat and a liar

Answers

Answer:

Explanation:

c.

Answer: D.

Explanation:

Hope it helps! may I have brainliest?

such diversity in its product line is a policy of what has
generally come to be called "intrapreneurship." The basic
idea is to allow employees of large corporations to behave
witkin the company as they would as individual
entrepreneurs in the outside world. A model intrapreneur
is Art Fry, a chemical engineer who in 1974 was working
in product development at 3M during the week and
singing in his church choir on Sundays.
-The Evolution of Useful Things,
Henry Petroski
Read the passage and use the information in the
passage and the rest of the reading to explain why the
company was able to produce so many new products.

Answers

Because it granted employees creative freedom and gave them responsibility for the success or failure of their inventions, the company was able to generate a lot of new goods.

Why was the corporation able to create so many new products?

This is evident in the "entrepreneurship" training provided by the business to its staff. Allowing staff to work simultaneously on several projects is one thing this method is capable of.

a. Give employees room to express their creativity in both these projects and the final products.

b. Give staff members more authority over the development and marketing of products.

c. Permit the simultaneous launching of numerous items.

d. Give workers more freedom to dedicate themselves to the success of the product.

To know more about Diversity in product line visit:

https://brainly.com/question/11427393

#SPJ9

be
Read the excerpt from Up from Slavery by Booker T.
Washington.
Our greatest danger is that in the great leap from
slavery to freedom we may overlook the fact that the
masses of us are to live by the productions of our
hands, and fail to keep in mind that we shall prosper
in proportion as we learn to dignify and glorify
common labour and put brains and skill into the
common occupations of life; shall prosper in
proportion as we learn to draw the line between the
superficial and the substantial, the ornamental
gewgaws of life and the useful. No race can prosper
till it learns that there is as much dignity in tilling a field
as in writing a poem. It is at the bottom of life we must
begin, and not at the top. Nor should we permit our
grievances to overshadow our opportunities.
Read the excerpt from The Souls of Black Folk by
W. E. B. Du Bois.
Which statement best compares the claims of the two
arguments?
O Washington thinks that agricultural work should be
championed as a way to advance, while Du Bois
looks down on industrial labor.
O Washington promotes manual labor as a path to
success, while Du Bois argues that higher
education supports other types of success.
O Washington declares that most people can be
successful at farming their own property, while
Du Bois says that owning property is impossible.
O Washington says that time spent arguing about
inequalities undermines opportunities, while
Du Bois advocates for civic activism.

Answers

Washington (1856–1915), an influential African American leader and educator, reads a portion of his well-known "Atlanta Compromise" speech, which he gave on September 18, 1895, during the Atlanta Exhibition.

What was Up From Slavery by Booker T. Washington about?

Washington describes his transition from slave to instructor in his book Up from Slavery. The early chapters describe his upbringing as a slave and his attempts to pursue an education; he directly attributes his success as a man of action in his community and country to his education.

What is the primary idea behind Up From Slavery?

The Worth of Work. Finding dignity in labor is arguably the most developed concept in Up From Slavery. Washington feels that black Folks now have a erroneous belief that labor is a degrading activity rather than a noble and uplifted activity.

To know more about Booker T. Washington visit:

https://brainly.com/question/30494033

#SPJ1

Answer: B ON EDGE2023

Explanation:

Refer to your Expeditions in Reading book for a complete version of this story.

Which sentence best states a theme of “Rikki-Tikki-Tavi”?

Responses

A. Making mistakes can be a way to learn lessons about life

B. Working with others is often better than working alone.

C. Too much pride can lead to conflict with other.

D. It takes courage to fight when there is the risk of failing.

Answers

The best sentence that states a theme of "Rikki-Tikki-Tavi" is:

C. Too much pride can lead to conflict with others.

In "Rikki-Tikki-Tavi," the character Nag and his wife Nagaina demonstrate excessive pride, which ultimately leads to their downfall. Their prideful nature causes them to underestimate the abilities of Rikki-Tikki-Tavi, the mongoose, leading to a deadly conflict. The theme of pride leading to conflict is reinforced throughout the story, and the resolution demonstrates the consequences of such prideful behavior.

Therefore, the best sentence that states a theme of "Rikki-Tikki-Tavi" is: Too much pride can lead to conflict with others.
Other Questions
Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty.