Abstract -
The rapid increase of human population is putting an incredible strain on our environment. While developed countries continue to pollute the environment and deplete its resources, developing countries are under increasing pressure to compete economically and their industrial advancements are damaging as well. The demands that this growth places on our global environment are threatening the future of sustainable life on earth. One of the largest environmental effects of human population growth is the problem of global warming. Some scientists fear that global warming will lead to rising sea levels and extreme weather conditions in the future. In order to support the growing population, forests are being destroyed at an alarming rate. Humans also continue to put a great demand on the natural resources of our planet. Many non-renewable resources are being depleted due to the unrestrained use of fuel and energy. Many parts of the world also suffer from a shortage of food and water. The growth of population puts larger demands on our already limited resources. The environment on earth is suffering from the growth of global population. The depletion of resources and biodiversity, the production of waste, and the destroying of natural habitat are serious problems that must be addressed in order to ensure that life on earth will be sustainable throughout the next century. Keywords: Industrial advancements, Land and soil degradation, global warming, Climate change, Air and water pollution, Deforestation, Physical environment.
Help me please! Do 1,2,3 by filling in the blank!!!!
and no website
Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations
Answer:
OA increased soil aeration due to an increase in earthworm populations.
Answer:
it is B. decreased rainfall due to a prolonged period of drought
Explanation:
trust me i got it right on my quiz
Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
Answer:
i dont know i need points
Explanation:
Nondisjunction that occurs during meiosis II produces what?
Answer:
Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.
WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)
Answer:
Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)
Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.
Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.
Why does a mountain create a rain shadow on the other side of a mountain?
Answer:
I hope this will help u
Explanation:
A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow
I don’t have a lot of time please help!
No websites or links.
Don’t answer it if you don’t now. Thanks
Someone’s help me please
Answer:
trailmix
Explanation:
In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine
Answer:
31%
Explanation:
Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If
G = 19% then C= 19%
19% + 19% = 38%
100% - 38% = 62%
62% for A and T
Divide by 2 and you get
31%
What were the old women doing?
In Percy jackosn
Answer:
If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.
Explanation:
in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.
In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.
Is this person male or female? Why? :l
Answer:
I think Female because hey aren't any Y chromosomes
hope this helps
have a good day :)
Explanation:
REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?
Answer:
carries the blood components throughout the body
Explanation:
plasma is the largest part of your blood.
During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?
a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance
Answer: Characteristics acquired during an organism's life are generally not passed on through genes.
Explanation:
The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.
What are acquired traits?Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.
For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.
Therefore, the correct option is A.
Learn more about Traits here:
https://brainly.com/question/24886772
#SPJ6
Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.
Answer:
Yes.
Explanation:
Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.
Can someone name and explain each lymph organ?
Answer:
The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.
Answer:
please follow me
Explanation:
yr60zpzyoy9yit*fiif7rrr
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or
Answer: ?
Explanation:
c) Explain why wheat is not able to grow well in
nitrate poor soil.
Answer:
When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?
Both of these
Genetic Drift
Founder Effect
None of these
Answer: Both of these
Explanation: trust me
Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.
Answer:
The phenotypic ratio is 9:3:3:1
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaExplanation:
We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.
Let us assume that round is the dominant trait, codified by a diallelic gene, so
R is the dominant alleler is the recessive alleleLet us also assume that axial is the dominant trait, so
A is the dominant allelea is the recessive alleleCross:
Parentals) RrAa x RrAa
Gametes) RA, Ra, rA, ra
RA, Ra, rA, ra
Punnett Square) RA Ra rA ra
RA RRAA RRAa RrAA RrAa
Ra RRAa RRaa RrAa Rraa
rA RrAA RrAa rrAA rrAa
ra RrAa Rraa rrAa rraa
F1) Among the progeny, we expect to observe the following phenotypic ratio:
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaAll of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat
Answer:
A) population
Explanation:
Answer:
A. population
Explanation:
for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"
for example, on a map, you may see population of a certain species for square mile.
Describe one method to reduce the air pollutants released from a coal burning power plant
Answer:
A method to reduce the air pollutants released from a coal burning power plant is carbon capture.
Explanation:
Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.
What processes can increase the amount of atmospheric CO2?
Answer:
Explanation:
Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.
Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.
Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO
Hope This Helped !! :)
List 4 characteristics of Animals.
Answer:
animals
Explanation:
The Animal Kingdom
Animals are multicellular.
Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.
Animals typically reproduce sexually.
Animals are made up of cells that do not have cell walls.
Animals are capable of motion in some stage of their lives.
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.
Answer:
To save itself.
Explanation:
The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.
И a whole
•
The cell of
an elephant will be not be larger than that of an ant give reasons?
Answer:
Explanation:
The cell of an elephant will be not be larger than that of an ant.
This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.
So the cell of the elephant will not be larger than that of an ant.
Hope it helps!
Please mark as brainliest!
PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert
Answer:
I cant see the question just use the snipping tool to tack a screenshot
Explanation:
Describe how the picture below represents the function of the immune system
Answer:
The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.
Explanation: