Why is 250 million years called a cosmic year?
That’s the amount of time it takes the Milky Way to revolve around the Universe core.
That’s the amount of time it takes the Milky Way to rotate on its axis.
That’s the amount of time it takes the solar system to rotate on its axis.
That’s the amount of time it takes the solar system to revolve around the Milky way core.

Answers

Answer 1

Answer:

250 million years is called a cosmic year  because - D) That’s the amount of time it takes the solar system to revolve around the Milky way core.

Explanation:

The planets in our solar system orbit around the sun. ... Even at this blazing speed, it takes the sun approximately 225-250 million years to complete one journey around the galaxy's center. This amount of time – the time it takes us to orbit the center of the galaxy – is sometimes called a cosmic year.

Answer 2

The cosmic year is of 250 million years because that is the amount of time it takes in the solar system to revolve around the milky way core. Hence, option D is correct.

What is the Milky way?

A large spiral galaxy known as the Milky Way contains the Sun and several hundred billion other stars. It gets its name from the Milky Way, an amorphous belt of stars and gas clouds that can be viewed in the sky from Earth. Astronomers do not fully comprehend the nature of the Milky Way Galaxy, which is commonly referred to simply as the Galaxy, despite the fact that Earth is located within it.

Much of the Galaxy is hidden by a thick layer of interstellar dust that prevents optical telescopes from seeing it, and astronomers can only determine its large-scale structure with the help of radio and infrared telescopes that can detect the types of radiation that can pass through the obscuring matter.

Our solar system's planets revolve around the sun. Even at this incredible speed, one orbit of the galaxy's center takes the sun about 225–250 million years to complete. A cosmic year is another name for the period of time it takes for us to orbit the galactic center.

To get more information about the milky way :

https://brainly.com/question/2806083

#SPJ5


Related Questions

Which is a form of precipitation?
A. Runoff
B. Rain
C. Gas
D. Evaporation

Answers

Answer:

D. Evaporation

Explanation:

Just did it made 100%

Same as what the other person said, D :)

Would a 2021 Ford Mustang GT be light weight or heavy weight?​

Answers

Answer:

Heavy weight

Explanation:

It's a muscle car, its weight its 3,825 lb, and it's classified as heavy for a car.

Answer:

Heavy Weight

Explanation:

A 2021 Mutsang GT could wrigh from 3,532 to 3,868 lbs. This would be considered a Heavy meadium to Heavy muscle car.

No where close to the boat of mopar  the challenger almost weighting up to 4,500lbs

An ideal horizontal spring-mass system is set into motion. At an instant when the mass passes through its equilibrium position: The potential energy in the spring is at its _____. The kinetic energy of the mass is at its ______. The magnitude of net force acting on the mass is at its ______.

Answers

Answer:

the potential energy is zero, and the kinetic energy must be maximum

    F = 0

Explanation:

In this exercise you are asked to complete the sentences of a simple harmonic movement of a mass-spring system.

In this system mechanical energy is conserved

at the most extreme point the carousel potential energy is

          K_e = ½ k x²

the kinetic energy is zero for that stopped.

At the equilibrium point

the spring elongation is x = 0 so the potential energy is zero

and the kinetic energy must be maximum since total energy of the system is conserved

the spring force is

             F =- k x

as in the equilibrium position x = 0 this implies that the force is also zero

             F = 0

In this exercise we have to use the knowledge of force to calculate the energy of a spring, in this way we find that:

The potential energy in the spring is at its [tex]K_e = 1/2 k x^2[/tex]. The kinetic energy of the mass is at its zero . The magnitude of net force acting on the mass is at its Zero.

In this system mechanical energy is conserved,  at the most extreme point the carousel potential energy is:

       [tex]K_e = 1/2 k x^2[/tex]

The kinetic energy is zero for that stopped or when at the equilibrium point, so:

the spring elongation is x = 0 so the potential energy is zero the kinetic energy must be maximum since total energy of the system is conserved

the spring force is:

          [tex]F =- k x\\F=0[/tex]

See more about force at brainly.com/question/26115859

A 30 kg child went down a 10 m tall slide. Assuming no energy was lost as friction, what was the child's velocity when he reached the
bottom?
I

Answers

14 m/s or 50km/h. See the details in the attached picture.

the speed of light in a certain medium is 0.6c. find critical angle , if the index of refraction is 1.67​

Answers

Answer:

[tex]\theta_c = 36.78^o[/tex]

Explanation:

The relationship between the refractive index and the critical angle is given as follows:

[tex]\eta = \frac{1}{Sin\ \theta_c} \\\\Sin\ \theta_c = \frac{1}{\eta}\\\\\theta_c = Sin^{-1}(\frac{1}{\eta} )[/tex]

where,

η = refractive index = 1.67

θc = critical angle =?

Therefore,

[tex]\theta_c = Sin^{-1}(\frac{1}{1.67} )[/tex]

[tex]\theta_c = 36.78^o[/tex]

How many joules of kinetic energy does a pendulum have when it has 100 joules of potential energy

Answers

Answer:

The maximum kinetic energy is 100 j.    

Explanation:

The kinetic energy = (potential energy) + (kinetic energy) and the potential energy of 0 J implying its kinetic energy is 100 J, which is its maximum.

Answer :100J of KE.

Explanation:

A ball is rolling down a hill. Wich action would slow the ball down?

Answers

friction.............................

A 1.50x103-kilogram car is traveling east at 30 meters per second.
The brakes are applied and the car is brought to rest in 9.00 seconds.
A. Calculate the magnitude of the total impulse applied to the car to
bring it to rest. [Show all work, including the equation and
substitution with units.]
B. State the direction of the impulse applied to the car. [East or
West?]


PLEASE HELP!!!!

Answers

Answer:

[tex]39000\ \text{kg m/s}[/tex]

West

Explanation:

m = Mass of car = [tex]1.3\times 10^{3}\ \text{kg}[/tex]

t = Time = 9 seconds

u = Initial velocity = 30 m/s

v = Final velocity = 0

Impulse is given by

[tex]J=m(v-u)\\\Rightarrow J=1.3\times 10^3(0-30)\\\Rightarrow J=-39000\ \text{kg m/s}[/tex]

The magnitude of the total impulse applied to the car to bring it to rest is [tex]39000\ \text{kg m/s}[/tex].

The direction is towards west as the sign is negative.

A molecule with a charge of 9 x 10-8 C is moving with a velocity of 7 x 107 m/s perpendicular to a magnetic field with a value of 0.57 Tesla. What is the magnitude force (in N) on the molecule?

Answers

Answer:

3.591 N

Explanation:

Applying,

F = Bvq................. Equation 1

Where F = magnitude of force on the molecule, B = Magnetic field, v = Velocity of the molecule, q = charge of the molecule.

From the question,

Given: B = 0.57 Tesla, q = 9×10⁻⁸ C, v = 7×10⁷ m/s

Substitute these values into equation 1

F = 0.57×9×10⁻⁸×7×10⁷

F = 35.91×10⁻¹

F = 3.591 N

Hence the force on the molecule is 3.591 N

Why do astronomers use frequencies other than the visible ones when they are
investigating the universe?

Answers

Because not all of the universe can be seen with a visible spectrum

A disk of a radius 50 cm rotates at a constant rate of 100 rpm. What distance in meters will a point on the outside rim travel during 30 seconds of rotation? ​ ​

Answers

Answer:

The point will travel a distance of 15708 centimeters in 30 seconds of rotation.

Explanation:

In this case, we see a disk rotating at constant rate, the travelled distance of a point on the outside rim ([tex]s[/tex]), in centimeters, is determined by using this expression:

[tex]s = \omega \cdot r\cdot t[/tex] (1)

Where:

[tex]\omega[/tex] - Angular speed, in radians per second.

[tex]r[/tex] - Radius of the disk, in centimeters.

[tex]t[/tex] - Time, in seconds.

If we know that [tex]\omega \approx 10.472\,\frac{rad}{s}[/tex], [tex]r = 50\,cm[/tex] and [tex]t = 30\,s[/tex], then the travelled distance of the point is:

[tex]s = \omega \cdot r\cdot t[/tex]

[tex]s = 15708\,cm[/tex]

The point will travel a distance of 15708 centimeters in 30 seconds of rotation.

When a mass is suspended from a spring the latter extends over a distance of 10cm. What will be the period of oscillations of the same system if it is placed horizontal on a frictionless surface​

Answers

Answer:

0.64 s

Explanation:

It's period of oscillation (T) can be determined by,

T = 2[tex]\pi[/tex][tex]\sqrt{\frac{l}{g} }[/tex]

Where l is the length (extension on the spring), and g the acceleration due to gravity.

But,

l = 10 cm = 0.1 m

g = 9.8 m/[tex]s^{2}[/tex]

Thus,

T = 2 x [tex]\frac{22}{7}[/tex] [tex]\sqrt{\frac{0.1}{9.8} }[/tex]

  = 0.6350

T = 0.64 s

The period of oscillation would be 0.64 s.

A diffraction grating is placed 1.00 m from a viewing screen. Light from a hydrogen lamp goes through the grating. A hydrogen spectral line with a wavelength of 656 nm is seen 60.0 cm to one side of the center. Then, the hydrogen lamp is replaced with an unknown lamp. A spectral line is seen on the screen 36.4 cm away from the center. What is the wavelength of this spectral line

Answers

Answer:

λ = 396.7 nm

Explanation:

For this exercise we use the diffraction ratio of a grating

           d sin θ = m λ

in general the networks works in the first order m = 1

we can use trigonometry, remembering that in diffraction experiments the angles are small

           tan θ = y / L

           tan θ = [tex]\frac{sin \theta}{cos \theta}[/tex] = sin θ

           sin θ = y / L

we substitute

          [tex]d \ \frac{y}{L}[/tex] = m λ

with the initial data we look for the distance between the lines

           d = [tex]\frac{m \lambda \ L}{y}[/tex]

           d = 1 656 10⁻⁹ 1.00 / 0.600

            d = 1.09 10⁻⁶ m

for the unknown lamp we look for the wavelength

           λ = d y / L m

           λ = 1.09 10⁻⁶ 0.364 / 1.00 1

           λ = 3.9676 10⁻⁷ m

           λ = 3.967 10⁻⁷ m

         

we reduce nm

           λ = 396.7 nm

An example of conservation of angular momentum is jumping on a Merry-Go-Round. Watch this video (it starts part way through but the only thing you miss is the people pushing the Merry-Go-Round) to see someone jumping on a Merry-Gr-Round in motion like this problem. You can model the Merry-Go-Round as a solid disk with a radius of 2.70 m and a mass of 77.0 kg. Initially the Merry-Go-Round has an angular velocity 7.40 radians / second. Then the person jumps on and change the Moment of Inertia of the system. The person lands on the outer edge of the Merry-Go-Round and has a mass of 58.0 kg. What is the final angular velocity of the system after the person jumps on

Answers

Answer:

ωf = 2.95 rad/sec

Explanation:

Assuming no external torques acting while the person jumps on, total angular momentum must be conserved.Angular momentum for a rotating rigid body can be expressed as follows:

       [tex]L = I * \omega (1)[/tex]

where I = moment of inertia regarding the rotating axis, and ω= angular velocity.Since total angular momentum must be conserved, this means that the following equality must be satisfied:

       [tex]L_{o} = L_{f} (2)[/tex]

The initial angular momentum, taking into account that the Merry-Go-Round can be modeled as solid disk, can be expressed as follows:

        [tex]L_{o} = I_{o} * \omega_{o} = \frac{1}{2}* M* R^{2}* \omega_{o} =\\ \frac{1}{2} * 77.0 kg* (2.70m)^{2}* 7.40 rad/sec = 2076.92 kg*m2*rad/sec (3)[/tex]

The final angular momentum, is just the product of the new moment of inertia times the final angular velocity.The new moment of inertia, is just the sum of the original moment of inertia I₀ and the moment of inertia due to the person that jumps on.Assuming that we can treat him as a point mass, his moment of inertia is just the product of his mass times to the distance to the axis of rotation (the radius of the Merry-Go-Round) squared.So, we can write the new moment of inertia If as follows:

       [tex]I_{f} = I_{o} +( m_{p} * R^{2}) = (\frac{1}{2} * M* R^{2}) + ( m_{p} * R^{2}) =\\ (\frac{1}{2} * 77.0 kg* (2.70m)^{2}) +( 58.0 kg * (2.70m)^{2}) = \\ 280.67 kg*m2 + 422.82 kg*m2 = \\ 703.49 kg*m2 (4)[/tex]

The final angular momentum can be written as follows:

        [tex]L_{f} = I_{f} * \omega_{f} (5)[/tex]

Since (3) and (5) must be equal each other, replacing If by its value from (4) in (5), we can solve for ωf, as follows:

       [tex]\omega_{f} = \frac{L_{o} }{I_{f}} = \frac{2076.92kg*m2*rad/sec}{703.49kg*m2} = 2.95 rad/sec (6)[/tex]

Moira is experiencing noticeable memory loss, muscle loss, and bone loss. What age group is Moira most likely in?
adolescence
early adulthood
middle adulthood
late adulthood

Answers

Late adulthood is the answer

Answer:

Late adulthood

Explanation:

Just did it :)

Which property of light is a constant in a vacuum?

Answers

Answer:

La velocidad de la luz en el vacío es una constante universal con el valor de 299 792 458 m/s (186 282,397 mi/s),​​aunque suele aproximarse a 3·108 m/s. Se simboliza con la letra c, proveniente del latín celéritās (en español, celeridad o rapidez).

¿Cuál es la consecuencia que a velocidad de la luz sea constante?

Respuesta. En modificaciones del vacío más sutiles, como espacios curvos, efecto Casimir, poblaciones térmicas o presencia de campos externos, la velocidad de la luz depende de la densidad de energía de ese vacío.

List the two factors that create orbital motion and describe how each factor affects the motion.​

Answers

Sir Isaac Newton concluded that two factors—inertia and gravity–combine to keep Earth in orbit around the sun, and the moon in orbit around Earth. Hope this helps!

what happens to a neutron that is not attached to a proton?

Answers

It becomes a isotope if an atom were to lose or gain a neutron.

6.) What is
the voltage
across a 50
ohm circuit
element that
draws a current of 2 A?

Answers

Answer:

100 V

Explanation:

Hi there!

Ohm's law states that [tex]V=IR[/tex] where V is the voltage, I is the current and R is the resistance.

Plug the given information into Ohm's law (R=50, I=A)

[tex]V=IR\\V=(2)(50)\\V=100[/tex]

Therefore, the voltage across this current is 100 V.

I hope this helps!

What is the mass of a jet that accelerates at 4 m/s2 after a 4,000 N force from the engines?

Answers

Answer:

1000kg

Explanation:

F=MA

Rearrange the formula: M=F/A

plug in values for F (force), and A (acceleration).

M=4000/4

M=1000kg

i think.

not sure tho.

The mass of the jet that accelerates at 4 m/s^2 after a 4000 N force from the engines is 1000 kg.

What is Newton's second law of motion?

Newton's second law of motion states that the acceleration of an object is directly proportional to the net force acting on it and inversely proportional to its mass. Mathematically, the law can be expressed as F = ma, where F is the net force acting on the object, m is its mass, and a is its acceleration. This law is fundamental to the understanding of the motion of objects under the influence of external forces.

Rearranging the formula to solve for mass, we get:

m = F / a

Substituting the given values, we get:

[tex]m = 4000 N / 4 m/s^2[/tex]

m = 1000 kg

Therefore, the mass of the jet that accelerates at 4 m/s^2 after a 4000 N force from the engines is 1000 kg.

Learn more about Newton's second law of motion, here:

https://brainly.com/question/13447525?referrer=searchRes

#SPJ3

If velocity decreases what happens to acceleration

Answers

Answer: Velocity is a vector; the word decreasing only applies to its magnitude (not its direction) which is called speed. If speed is increasing and direction is not changing, then acceleration is positive. If speed is constant then acceleration is zero. If speed is decreasing then acceleration is negative.

Explanation:


The result of the evolutionary process that preserves traits that enhance the adaptation of an organism and suppresses traits that do not is called

Answers

Answer:

Natural selection.

Explanation:

Natural selection can be defined as a biological process in which species of living organisms having certain traits that enable them to adapt to environmental factors such as predators, competition for food, climate change, sex mates, etc., tend to survive and reproduce, as well as passing on their genes to subsequent generations.

Simply stated, natural selection entails the survival of the fittest. Therefore, the species that are able to adapt to the environment will increase in number while the ones who can't adapt will die and go into extinction.

On the other hand, artificial selection is also known as selective breeding and it is a process that involves humans (breeders) selecting the animal or plant with desirable traits in order to reproduce favorable offspring having phenotypic traits.

Select the correct answer.
Which graph shows the correct relationship between kinetic energy and speed?

Answers

Answer:

D

Explanation:

Kinetic energy = 1/2mV^2

From the formula above, we can deduce that kinetic energy is proportional to the square of speed. That is,

K.E = V^2

Graphically, the relationship isn't linear but a positive exponential. Therefore, option D is the correct answer.

Answer:

Its D

Explanation:

Question 9 of 10
What happens to light as it moves at an angle into a medium that has a higher index of refraction?
A. It slows down, and the angle decreases.
B. It speeds up, and the angle increases.
C. It slows down, and the angle increases.
D. It speeds up, and the angle decreases.

Answers

Answer:

v = C / n     light slows entering a medium of higher index of refraction

ni sin theta i = nr sin theta r    Snell's Law where i refers to incidence and r refers to refraction

sin theta r = (ni / nr) sin theta i

So if the index of refraction is greater than the angle of incidence then the light ray would be refracted towards the normal

Answer:

A. It slows down, and the angle decreases.

Explanation:

got it right, trust

Choose a tool or a device you can investigate. It must not have any source of power other than the person using it. It must use one or more of the six simple machines. Explain how the tool or device is used. What work does a person do while using it? What kind of motion do we see when it’s used?

Answers

Answer:

Wheelbarrows, fishing rods, shovels, brooms, arms, legs, boat oars, crow bars, and bottle openers are all examples of levers. Levers may be one of the most used simple machine. As with all simple machines like the lever, they are designed to help make work easier to do.

Explanation:

Answer:

Wheelbarrows- This tool/device is used for a variety of things, such as moving rock, mulch or compost to the garden, moving trees or large shrubs from one spot to another, hauling bricks, disposing of garden debris, for mixing concrete or fertilizers, and even used on farms for mucking horse stalls. The work you do is pushing it whcih also goes along with the montion you will see, forward motion.

Explanation:

Which machine do you think will last longer, the traditional battery and motor, or the free energy machine?

Answers

Answer:

it will most likely be the free energy

Determine the activity of the sample of cerium when the sample was 80 seconds old

Answers

A⁣⁣⁣⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣an o⁣⁣⁣nly u⁣⁣⁣pload i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting s⁣⁣⁣ervice. l⁣⁣⁣ink b⁣⁣⁣elow!

bit.[tex]^{}[/tex]ly/3a8Nt8n




HELP PLEASE
Two 24 ohm resistors are in parallel and placed across a 12 V battery. What is the current in each branch of the circuit?
20 A
0.0125 A
0.5 A
.

Answers

Answer:

.5 A

Explanation:

What are the issues that hinders efforts to achieve sustainability?

Answers

Answer:

who will solve environmental problems, who is responsible for environmental problems, and who pays the cost of implementing solutions

Explanation:

Brent’s doctor recommended that he avoid hot baths while he and his wife are trying to have a child. Why did the doctor most likely make this recommendation?
Exposing the testicles to high temperatures could lead to problems
with maintaining erections.
Exposing the testicles to high temperatures could lead to problems
with producing sperm.
Exposing the testicles to high temperatures could lead to problems
with ejaculating.
Exposing the testicles to high temperatures

Answers

Answer:

Exposing the testicles to high temperatures could lead to problems

    with producing sperm.

Explanation:

got it correct on the edge unit test review

Brent's doctor most likely recommended that he avoid hot baths because exposing the testicles to high temperatures could lead to problems with producing sperm.

What is sperm?

The sperm is the male reproductive cell that is produced in the testes and stored in the epididymis.

The testicles (testes) of the male is located outside the body as the temperature of the body is too high for the viability of the sperm.

Therefore, exposing the testicles to high temperatures could lead to problems with producing sperm.

Learn more about sperm here:

https://brainly.com/question/25282799

#SPJ2

Other Questions
Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio escride otra vez este texto pero con los verbos en pretrito perfectoMe levanto (1) a las ocho, preparo (2) un caf y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)cuarenta minutos en llegar a la universidad; en el autobs leo (6); el autobs va (7) lleno de gente y es (8)muy incmodo.Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy(11) cansada. Despus, como (12) con mi amiga Helena y ms tarde tomamos (13) un caf en la cafeterialde la facultad. Vamos (14)........ a la biblioteca y estudiamos (15)..un rato.Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.Hablo (19) por telfono con mi novio y me acuesto (21) a las 24.00. Question poIn an auditorium, a charity show is conducted in order to raise at least $3,000. The auditorium canaccommodate up to 180 spectators. Tickets cost $12 for students and $20 for adults. Identify the system ofinequalities and the corresponding graph that determine whether the charity will reach its goal. Is each ion stable? Explain. Pleaaaaaaseeee10 pointsIn the playing card deck below what is the chance of pulling 4 face cards without replacing the cards in between pulls? Answer in decimal form rounded to the 6th digit after thedecimal anybody help? reporting fake answers tysm!! The match was __________ live all over the world why weren't Spanish explorations successful in North America many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high proportion of adenines and thymines? someone help me please S + 6 HNO3 --> H2SO4 + 6 NO2 + 2 H2OIn the above equation how many moles of water can be made when 28 moles of HNO3 are consumed?AND 2 NH3 + 3 CuO g 3 Cu + N2 + 3 H2OIn the above equation how many moles of water can be made when 76 moles of NH3 are consumed? Why did the slave owners hire spies who lived in the slave communities?