Answer:
The thermoregulatory center in this gland regulates heat loss and production. This center is influenced by nerve impulses from receptors near the skin and the temperature of the blood flowing through it. When the environment is warm or hot, there are a variety of ways mammals stay cool..
Explanation:
Hope it helps you..
Y-your welcome in advance..
(;ŏ﹏ŏ)(ㆁωㆁ)
The brain of mammals keeps track of the temperature of the skin and the blood so that they can regulate the cells and maintain homeostasis in the body relative to the outer environment.
What is the importance of homeostasis in the body?The body's homeostasis should always be maintained in order to keep the cells and organs active and able to perform their functions. Because the brain has different control centers, it keeps track of the skin and blood temperature because the brain can release different hormones depending on the situation. The lipid composition and arrangements of the cells change in the summer and the winter, and all these are possible due to the brain sending signals to cells.
Hence, the brain of mammals keeps track of the temperature of the skin and the blood so that it can regulate the cells and maintain homeostasis in the body relative to the outer environment.
Learn more about homeostasis here.
https://brainly.com/question/3888340
#SPJ2
which type of specialized cells would be found in an animal’s neuvous system?
The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.
What is the nervous system?The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.
Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.
Therefore, the correct option is D. Cells that can transmit signals around the body.
To learn more about the nervous system, refer to the link:
https://brainly.com/question/29355295
#SPJ2
The question is incomplete. Your most probably complete question is given below:
Cells that transport oxygen are found in the blood.
Cells that secrete hormones to trigger cellular responses.
Cells secrete enzymes to break down food.
Cells that can transmit signals around the body.
Create a food chain with a producer and 3 consumers.
Answer: dandelion is consumed by bees, grasshoppers, and butterflies.
Answer:
primary consumers, secondary consumers, tertiary consumers.
Explanation:
Hope this helps
An eastern screech owl, a carnivore, might compete with which organism most intensely for resources?
A. hawk (secondary consumer)
B. mountain lion (secondary consumer)
C. wren (primary consumer)
D. mouse (primary consumer)
NO LINKS PLEASE
correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat
Please help!! Any word is greatly appreciated :) thanks <3
Stem anatomy
WORD DEFINITION
Monocot Plant where Xylem and Phloem are arranged in bundled scatters
Node Location on the stem where leaves and buds are attached
Corm A bulb-shaped specialized stem that is made of solid stem and had no leaves
Stolon Specialized stem that is usually horizontal and above the soil
Specialized Stems Bulbs, Corm, Rhizomes, and Tubers
Apical Meristem Actively growing tip found inside a terminal or lateral bud
Terminal Bud End of stem or branch
Xylem Cells in the stem where they carry UP water and minerals
Lenticel A mark on the outside of the stem that allows gas to be exchanged
Lateral Bud Bud that is found on the side of the branch
Sapwood Part of woody stem that actively conducts water and dissolved minerals
Bulb Specialized stem made of short, flat stems and contains many fleshy leaves
Dicot Plant where it's Xylem and Phloem are arranged in a circle
Inter Node Area on the stem that lies between 2 leaves/buds
Leaf Scar Scar left when a leaf falls off
Bud Scale Scar Area in the stem that shows the location of last years bud
Phloem Tube-shaped cells that carry DOWN water and minerals
Tuber Specialized stem that's tip is swollen with stored food
Rhizome A specialized stem that is thick and runs horizontally under the soil
Bud Scale Small protective structure that can be seen on the outside of a bud
Vascular Cambium Area inside stem where new Xylem and Phloem are made
Explanation:
hope this here helps you
I attached the words in order down below
6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.
Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?
Explanation:
is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands
Answer:
false
Explanation:
Question C. please... :) And NO FILES I WILL REPORT YOU!
What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.
Answer:
.
Explanation:
Explanation: Open Photo ;)
Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.
Definition: a macromolecule that contains carbon, hydrogen, oxygen, and nitrogen, which is used by the body for growth and repair.
Answer:
Proteins
Explanation:
Proteins are the main building block of the body. They are required for proper growth of the organism.
Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )
Answer:
Please where's the image of the question
Answer:
B
Explanation:
Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.
A moon has less mass than a star and more mass than a planet it orbits.
•True
•False
What is the process of the digestive system?
Answer:
In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.
In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.
Please Help I will mark bRAINLIEST
Answer:
d
Explanation:
In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.
The different forms of the beef cattle color gene are called_
The different forms of the beef cattle color gene are called "alleles"
What are alleles?Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.
In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.
The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.
Learn more about alleles, here:
https://brainly.com/question/14104138
#SPJ6
I need URGENT help with 16 through 18 pls!!!
Answer:
16. Directional Selection
17. Disruptive Selection
18. Stabilizing Selection
19. Natural Selection
20. Adaptation
Explanation:
In population genetics, directional selection/positive selection is a mode of natural selection in which an extreme phenotype is favored over other phenotypes.
Disruptive Selection would show phenotypes (individuals with groups of traits) of both extremes but have very few individuals in the middle.
Stabilizing Selection. Occurs when individuals at the extremes of the range of characteristic are selected against. This means that the "average" individuals are selected for.
Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?
It increases the probability that moving water will promote gene flow from one population to another.
It increases the chance of the recombination of alleles, leading to genetic drift in the population.
It increases opportunities for offspring to compete for limited resources.
It increases the probability that some offspring will survive long enough to reproduce.
Answer:
increases opportunities for offspring to compete for limited resources.
what is the term for the process of cell division that results in the formation of gametes ?
Answer:
meiosis
Explanation:
The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass
Answer:
A
Explanation:
The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^
Explanation:
A because im big brain
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity
Answer:
Gender Role
Explanation:
How people already see how people should act. Example- Be a man.
Answer:
b. sex
Explanation:
edge 2021
Somebody please help? Thanks
Answer:
None
Explanation:
because y is recessive and it needs to be yy to be green so Yy wouldn't wrok
please help asap
Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:
Answer:
humans- exposes them to the ultra-violet rays of the sun causing cancer
animals- causes the pollution of gases found within the atmosphere
plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants
Environment- causes global warming
Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-
Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-
The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-
A new strain of influenza breaks out in New York City-
The population of rabbits and a population of deer are both feeding off the same plants in the same area-
Hurricane Katrina forced thousands of people to leave New Orleans-
65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.
Answer choices: Density Dependent
Density Independent
Answer:
Density Dependent
Explanation:
i think hope it helps
Why is the success of a mutation dependent on environmental conditions?
PLEASE HELP QUICK!!!
what are the three age categories labels between childhood and adulthood
Answer: Early adolescence, middle adolescence, and late adolescence.
brainliest or a thank you please :)) <33
In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.
A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________
B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.
C. A short winged fly can be described -using words as what?
D. What type of inheritance is this called?
Answer:
A. Normal Wings= Ww, Small Wings=ww
B. All offspring will have short wings because short wings trait is recessive.
w. w
______
w| ww |ww|
————-
w|ww |ww |
______
Explanation:
Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose
Answer:
A
Explanation:
Help please :) thank u
Answer:
!! neither mechanical nor chemical digestion