Which two words best describe the Sun? Select one:
A)planet and gases
B)star and rocky
C) star and gases
D)planet and rocky

Answers

Answer 1

Answer:

I'm pretty sure it would be c

Explanation:

because it is a star so it definitely is not a or d and I don't think it is rocky soooo


Related Questions

please help with this biology question!

Answers

Answer:

mito

Explanation:

Answer: mitochondria

Explanation: don't have mitochondria for energy production, so they must rely on their immediate environment to obtain usable energy

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

Answers

Answer:

Well I need more information to answer that question.

Explanation:

Explanation:

can I have a picture of the question please

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

symptoms of trisomy 13 ​

Answers

Answer:

Individuals with trisomy 13 often have heart defects, brain or spinal cord abnormalities, very small or poorly developed eyes (microphthalmia), extra fingers or toes, an opening in the lip (a cleft lip ) with or without an opening in the roof of the mouth (a cleft palate ), and weak muscle tone (hypotonia)

Explanation:

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

a recipe calls for 1 cup of sugar and 1/2 cup of flour.Zoe uses 1 cup of salt and 1/2 cup of flour.
which kind of mutation is best modeled by zoes version of the recipe​

Answers

Answer:

Substitution

Explanation:

Given the information in the question substitution seems like the most appropriate answer. Zoe used 1 cup of slat rather than 1 cup of sugar, she substituted sugar for salt.

Insertion is wrong because Zoe did not add another ingredient, there is still only 2 ingredients.

Transition is wrong because, given the information, because the state(liquid or solid) of the ingredients has not changed. Zoe is still use dry ingredients per say.

And beneficial also seems to be wrong because we don't know if using salt instead was beneficial to the recipe or to Zoe.

Explanation:

Answer: Subsitution

Explanation: i took the quiz

Explain how a school bus uses all of these energy types.

-Mechanical
-Chemical
-Electrical
-Thermal

Answers

Answer:

Mechanical

94 percent of all school buses in America are powered by diesel engines because of their reliability, durability and safety. Almost half of these (46 percent) rely on the cleanest, near-zero emission diesel engine technology.

Chemical

school bus uses petroleum as chemical potential energy.

Electrical

An electric bus draws electricity from the power grid and stores it in a battery that can be recharged once the electricity has been used up. This basically mirrors the way our electronics work. We plug them in and let the battery charge and then use them wirelessly until it's time to charge again

Thermal

They heat the cold coolant from engine's block to 160° F in as little as one hour, then pump it back to the vehicle's engine and heat exchangers. The result: engine is preheated and the vehicle's heat exchangers distribute an abundance of heat to the vehicle's interior.

If you know that small sharks and large sharks are the top two consumers in a food chain, which of the
following pairs would start your food chain?
O dinoflagellates, ocean sunfish
O copepods, ocean sunfish
energy from sun, dinoflagellates
O energy from sun, copepods

Answers

Answer:

Dinoflagellates

Explanation:

Dinoflagellates are algae

energy is stored during photosynthesis. true or false

Answers

True because plant needs them

What does "reliability" mean in these sentences?

Answers

Answer:

The first one is correct

Answer: The first one, the quality of being able to be trusted.

Don't really know how to explain but being reliable is being trustworthy and responsible.

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Answers

Answer:

1. heat is collected from the earth

2. heat is used to change water into steam

3. steams turns a turbine

4. generators produce electricity

Explanation:

How can G and cloning be used in medical science

Answers

Answer:

for testing differnt cures on animals

Explanation:

The salamander is an amphibian, so it has a as it grows and develops. The adult form is different from the larva because the adult .

Answers

Answer: The options are not given, here are the options from another website.

A. metamorphis

B. pupae stage

C)simple life cycle

Question 2

A)breathes through lungs

B. forms a pupa

C. lives completely underwater

The correct answers are A A.

Explanation:

Salamander go through process of metamorphosis that reproductive changes. They have a larvae stage that breathe through gills because the larvae are inform of a fish and gave gills for respiration while the adults breaths through lungs. The larvae stage develops 30 days after hatching and can possibly change into an adult like 60 after hatching.

Answer:

metamorphosis

Breathes through its lungs

I hope this helps

Compare primary succession and climax community. Be sure to identify how long-term survival of species is dependent on resources that may be limited.

Answers

Answer:

Primary succession is the colonization of species of organisms on life-less barren lands after a volcanic eruption, newly formed land, or sand dunes. Lichens and mosses are the known primary succession community of organisms that helps in developing conditions for secondary succession by breaking rocks and providing soil.

After a fair amount of time, there are new species of organisms that grow and colonize in the land and these are, and ultimately the community becomes fairly stable. A climax community is a more stable, mature community that undergoes little or no change which can live for hundreds of years on the land.

The long-term survival of species is dependent on various kind of resources that may be limited, this can be explained by the lichens and mosses that have enough amount of nutrition and resources during primary succession but as new organism comes with complex structure and competes with these lichens and mosses their number decline due to limited amount of resources.

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

LOOK AT PIC!!!!!!!!!!!!!

Answers

Answer: black

Explanation:

Yes

Answer:

wow it is blank

Explanation:


Students are growing plants in pots on the windowsill of
their classroom. After spring break, a student notices
that one of the potted plants furthest from the
windowsill has changed shape, as shown below....Which
statement best explains why this plant grew at a
different angle? *

A) A plant growth hormone accumulates in the shaded side
of the stems, causing the lower leaves to fall off.

B) A plant growth hormone accumulates in the shaded side of the stems, stimulating those sides to grow faster and
bend toward the light.

C) A plant hormone accumulates in the unshaded side of
plant cells, causing the plants to grow. much faster

D)A plant hormone accumulates in the shaded side of plant
cells, stimulating the plants to produce more flowers.

Answers

Answer:

ANSWER : B I think i am not sure i hope it helps

Name one basic characteristic for classifying organisms.
If you are sure then only give the answer otherwise you can leave.​

Answers

Answer:

The more basic characteristic for classifying organisms is the kind of cells they are made of because different organisms may share same habitat but may have entirely different form and structure.

I hope it's helpful for you...

GVC – Understand how humans depend on and affect natural resources.
Learning Targets:
ESS4.1 – Construct an explanation for how the availability of natural resources, the occurrence of natural hazards, and changes in climate affect human activity.
ESS4.2 – Use computational thinking to explain the relationships between the sustainability of natural resources and biodiversity within a system.
ESS4.3 – Design solutions for developing, managing, and utilizing energy and mineral resources based on cost benefit rations on large and small scale
ESS4.4 – Design solutions for a major global or local environmental problem based on one of Earth’s systems.

Answers

Answer:

Hope It Help

Explanation:

That's all I know

HELP AGAIN

askjcnoianlkscnoxicn

Answers

Answer:

a hope it helps make brainlliest ty

Explanation:

make free póínts again please

Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in the mountains will change over the next 1,000 years (assuming conditions remain stable)?

Question 2 options:

I predict that the proportion of individuals with big blood vessels living in the mountains will decrease because there is a variation in blood vessel size and those with the smaller blood vessels can store more red blood cells than larger vessels, so more oxygen can be moved to the body cells. Therefore, they have a better chance of surviving and passing this trait on to their offspring.


I predict that the proportion of individuals with big blood vessels living in the mountains will stay the same because there is a variation in blood vessel size and that variation will remain in a population. The is what is so cool about humans, we are all so unique.


I predict that the proportion of individuals with big blood vessels living in the mountains will increase because there is a variation in blood vessel size and those with the bigger blood vessels can deliver more oxygen to the body cells and therefore have a better chance of surviving and passing this trait on to their offspring.


I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Answers

Answer:

Over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the number of red blood cells it makes, not its blood vessels.

Explanation:

Evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection

What is blood vessels?

The blood vessels are the components of the circulatory system that transport blood throughout the human body.

I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Hence, option D is correct.

Learn more about blood vessels here:

https://brainly.com/question/4601677

#SPJ2

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

Answers

Answer:

A and C would least be affected

Explanation:

because a doesn't live off of insects and see if insects do disappear it still has seed stuff all back on

Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

What is the survival of the fittest?

This theory suggests that the fittest organisms survive in the environment and reproduce.

The fittest organisms have most of the required traits to survive. Bird A eats the seeds, Bird -B eats the insects, and bird C eats both seeds and insects,

Therefore, Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

Learn more about survival of the fittest:

https://brainly.com/question/1226176

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Answers

Cutting chicken and tomato on the same cutting board

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?


5. Explain the process through which natural selection can lead to a new species of organism.

Answers

Answer:

Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to specistion, where one species gives rise to a new and distincly different species.

where does mold come from​

Answers

Answer:

Mold will grow in places with a lot of moisture, such as around leaks in roofs, windows, or pipes, or where there has been flooding. Mold grows well on paper products, cardboard, ceiling tiles, and wood products. Mold can also grow in dust, paints, wallpaper, insulation, drywall, carpet, fabric, and upholstery

Answer:

Mold comes from wetness.

Explanation:

When there is enough moisture and just enough light, mold will grow. In fact, mold is classified as a type of plant: fungi.

Please mark me as brainliest

Select the correct answer.
Which activity does NOT contribute to global warming?
OA Driving cars
B. Releasing gases
C. Walking
OD Burning fuel

Answers

Answer:

walking

Explanation:

C. Walking doesn’t cause any harm to the environment or cause any sort of environmental change due to global warming issues. Walking is safe opposed to using fossil fuels.

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

Answers

Answer:

losing weight after childbirth

Explanation:

This contributes to the disease being the second leading cause of death of Americans. Losing weight after childbirth.

What can high blood pressure cause?

Factors that can lead to high blood pressure have: A diet high in salt, fat, and/or cholesterol.

Chronic diseases such as kidney and hormone problems, diabetes, and high cholesterol.

Family background, quite if your parents or other close relatives have high blood pressure.

Thus, option "A" is correct,  Losing weight after childbirth.

To learn more about childbirth click here:

https://brainly.com/question/16013075

#SPJ2

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because
Other Questions
11x + x helppp plzzz How many solutions does the following system of equations have?y = 2x + 6y = 4x + 12A) One solutionB) Infinitely Many SolutionsC) No SolutionD) Two Solutions Create a graph to show your relationship. Make sure you include all the parts for a graph and show the data clearly. Include a title for the graph and label the x- and y-axes. Fast ill give so many points what is calorie defined asA: a unit of energy B: Food C: Exercise D: A unit of oil GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 25pts- Which of the following would be considered an endothermic process?A. Fireworks explodingB. Water freezing into iceC. Steam condensing from a gas to a liquidD. Water boiling How long does a player continue to serve? in vollyball What is the measure of each angle in a hexagon if the lengths of all six sides are equal? Ayuda nesesito llenar eso What is the quotient of 1476 and 12 Estimate, then add. Write each sum in the simplest form. Write the number 0.00058 in scientific notation.will mark brainliest. these sentences describe conditions after the fall of the Roman and gotha Empires match each description to the correct Empire Invaders destroyed Hindu temples powerful Lords broken empire into separate kingdoms without trade people had to find their own food and basic necessities the feudal system began as people turn to Lourdes for protection Kunis were absorbed into the local culture knowledge of math and science was losti'm at lost some one help me TwT Why do chloroplasts appear only in plant cells and lysosomes appear only in animal cells? The magnetic field due to a utility wire is 0.10 mT when you are at a distance of 10 meters from it. What current (in Amperes) flows through the wire? Please help me find this answer What are amendments. In the right triangle shown, m\angle Y = 30\degreemY=30m, angle, Y, equals, 30, degree and XY= 6XY=6X, Y, equals, 6. PLEASE HELP !! ILL GIVE 40 POINTS ; PLUS BRAINLIEST !! DONT SKIP ANSWER. Using Pathos, "You are trying to persuade an audience that they should buy a particular brand of cereal." Write a persuasive sentence