which right are parents exercising when they sign a statement asking that a new school be built in their community?

Answers

Answer 1

When parents sign a statement asking for a new school to be built in their community, they are exercising their right to petition the government for a redress of grievances.

This right is protected by the First Amendment to the United States Constitution, which guarantees the right to freedom of speech, assembly, and petition. The right to petition the government is an important component of democracy, allowing citizens to bring their concerns and requests to the attention of their elected officials and seek remedies for perceived prejustice or grievances. In this case, the parents are using their collective voice to request that the government take action to build a new school in their community to provide better educational opportunities for their children.

To know more about petition click here:

brainly.com/question/549211

#SPJ4


Related Questions

in registering african americans to vote, the voting rights act of 1965 authorized the attorney general to

Answers

The Voting Rights Act of 1965 authorized the Attorney General to send federal examiners to register qualified voters who had been denied the right to vote based on their race.

This provision was aimed at ending discriminatory practices such as literacy tests and poll taxes that were used to prevent African Americans from exercising their right to vote. The Act also included provisions that prohibited jurisdictions with a history of discriminatory voting practices from making changes to their voting laws without approval from the federal government. The goal was to ensure that all citizens, regardless of their race, had equal access to the ballot box.

To know more about discriminatory   click here:

brainly.com/question/6185037

#SPJ4

the supreme court used its power of judicial review to strike down part of an act of congress for only the second time in which of the following cases?

Answers

The Supreme Court used its power of judicial review to strike down part of an act of Congress for only the second time in Marbury v. Madison (1803). In this case, William Marbury was appointed as a justice of the peace by President John Adams during the last days of his presidency.

However, the commission papers were not delivered to Marbury before the end of Adams' presidency, and the new President, Thomas Jefferson, ordered his Secretary of State, James Madison, not to deliver the commission. Marbury then filed a lawsuit against Madison, seeking a writ of mandamus that would require Madison to deliver the commission. The Supreme Court, led by Chief Justice John Marshall, declared that the portion of the Judiciary Act of 1789 that gave the Court the power to issue writs of mandamus was unconstitutional, and therefore Marbury's lawsuit could not be granted. This case established the principle of judicial review, which gives the Supreme Court the power to declare acts of Congress unconstitutional.

To know more about Supreme Court click here:

brainly.com/question/844146

#SPJ4

#the supreme court used its power of judicial review to strike down part of an act of congress for only the second time in which of the following cases?

what is one impact of third parties in american politics?

Answers

One impact of third parties in American politics is that they can serve as a "spoiler" or influence the outcome of an election.

In a winner-takes-all system like that used in most U.S. elections, a third-party candidate who receives even a small percentage of the vote can potentially swing the election in favor of one major party or the other. This can happen if the third-party candidate attracts voters who might otherwise have supported one of the major-party candidates.

Third parties can also help bring attention to issues and ideas that may be ignored by the major parties, and can serve as a check on the power of those parties. However, third-party candidates often face significant barriers to entry, such as difficulty in getting on the ballot and lack of media coverage, which can limit their ability to have a significant impact on the political process.

To know more about elections click here:

brainly.com/question/29760616

#SPJ4

which u.s. supreme court case involved a family suing a school system saying the segregation of schools was unfair and was hurting children?

Answers

The U.S. Supreme Court case that involved a family suing a school system saying the segregation of schools was unfair and was hurting children was Brown v. Board of Education (1954).

The Brown v. Board of Education case was a landmark decision of the U.S. Supreme Court in which the Court ruled that American state laws that established segregation in public schools are unconstitutional. It was a pivotal moment in the civil rights movement that challenged racial segregation in the United States.In 1951, Oliver Brown, a black father in Topeka, Kansas, tried to enroll his daughter, Linda Brown, in the white-only Sumner Elementary School.

The school system denied Linda's enrollment due to her race, which required her to attend the black-only Monroe Elementary School. The Browns, along with twelve other Topeka families, filed a lawsuit against the Board of Education of Topeka Public Schools.

You can learn more about Brown v. Board of Education (1954) at

https://brainly.com/question/11960172

#SPJ11

what is proctor’s main purpose in bringing mary warren to court in act iii of the crucible?

Answers

In Act III of The Crucible, Proctor's main purpose in bringing Mary Warren to court is to prove that the accusations of witchcraft are false and to save his wife, Elizabeth Proctor, from being convicted.

Mary Warren, who is one of the girls accusing people of witchcraft, had previously admitted that their accusations were false, but she is now too afraid to speak out against the other girls. Proctor believes that if Mary Warren testifies in court and tells the truth, the accusations will be exposed as fraudulent and his wife will be cleared of any wrongdoing.However, Mary is afraid of Abigail and the other girls and eventually breaks down, claiming that Proctor is the devil's man. Proctor's attempt to expose the truth is thwarted, and he is ultimately arrested for witchcraft himself.

To know more about witchcraft click here:

brainly.com/question/8159939

#SPJ4

what is an exception to the statute of frauds? collateral promises contracts dealing with land promissory estoppel contracts under the ucc

Answers

Collateral promises made in connection with a primary agreement, contracts for the sale of goods over $500 under the UCC, and contracts where one party has reasonably relied on the other's promise.

Collateral promises refer to promises made by a third party to guarantee the performance of a primary obligation between two parties. These promises can be oral or written and are often made to provide additional security to a creditor. Collateral promises are an exception to the Statute of Frauds, which requires certain contracts to be in writing to be enforceable. In such cases, the collateral promise can be enforced even if the primary agreement is not in writing. However, for the collateral promise to be enforceable, it must be made in connection with the primary obligation and must be for the benefit of the promisor. Collateral promises are common in loan agreements, where a third party agrees to be responsible for the debt of the borrower if they default.

Learn more about Collateral promises here:

https://brainly.com/question/26985573

#SPJ1

why was there a conflict between confucian scholars and the emperor?

Answers

Confucian scholars and the emperor had disagreements because the scholars adhered to the traditional teachings of right conduct and setting a good example rather than enforcing strict rules and they disapproved of the government.

What is meant by conflict?Conflicts arise when different interests, viewpoints, or even core ideals clash. In society, conflict will always exist, and its causes might range from personal to racial to class-based to caste-based to political. We want a certain event typically a negative one to occur in a story. We aren't overly interested until it happens. Yet, issues give rise to stress, not tension to problems. These issues are known as conflicts in literature. Conflict is a more exact term for thwarted, imperiled, or competing desire.Conflict behavior refers to overt activities made by one party in a conflict scenario that are directed towards the opposing party with the intent of getting that party to give up or alter its objectives.

To learn more about conflict, refer to:

https://brainly.com/question/846617

gitlow v. new york nationalized the fourteenth amendment over this issue.

Answers

Gitlow v. New York was a landmark U.S. Supreme Court case in 1925 that established the principle of selective incorporation, which is the idea that certain provisions of the Bill of Rights are applicable to the states through the Due Process Clause of the Fourteenth Amendment.

In Gitlow v. New York, the Court considered the case of Benjamin Gitlow, a socialist who had been arrested and convicted under New York's criminal anarchy law for distributing left-wing literature. Gitlow argued that his right to free speech, which was protected by the First Amendment of the U.S. Constitution, had been violated.

The Supreme Court agreed with Gitlow and ruled that the Due Process Clause of the Fourteenth Amendment "incorporated" the freedom of speech guarantee of the First Amendment, thereby making it applicable to the states. This decision had significant implications for the protection of individual rights and liberties in the United States, as it paved the way for the selective incorporation of other provisions of the Bill of Rights over time.

To know more about incorporation click here:

brainly.com/question/814339

#SPJ4

how are 14th amendment due process protections related to the civil rights act of 1968?

Answers

14th amendment due process protections related to the civil rights act of 1968 forbids states from denying any person "life, liberty or property, without due process of law" or to "deny to any person within its jurisdiction the equal protection of the laws.”

On July 9, 1868, the 14th Amendment to the Constitution was approved, granting citizenship to "all persons born or naturalized in the United States," which included recently freed former slaves. In addition, it forbids states from denying any person "life, liberty or property, without due process of law" or to "deny to any person within its jurisdiction the equal protection of the laws.” The 14th Amendment, which is more frequently cited in court cases than any other amendment due to its explicit mention of the role of the states, significantly increased the protection of civil rights for all Americans.

Learn more about 14th Amendment at:

brainly.com/question/29793577

#SPJ4

law regulates the structure and administration of government agencies and their relationships with citizens, employees, and other governments. a. criminal b. public c. private d. civil

Answers

Law regulates the structure and administration of government agencies and their relationships with citizens, employees, and other governments is Public Law. (B)

Public law regulates the structure and administration of government agencies and their relationships with citizens, employees, and other governments. It covers areas such as constitutional law, administrative law, criminal law, and international law.

Public law establishes the power of the government and ensures the protection of individual rights. It sets out the roles and responsibilities of government bodies, defines the limits of their authority, and establishes procedures to ensure the fair and equitable enforcement of laws.

It also governs the relationships between governments and citizens, as well as between governments and other governments.(B)

To know more about Public Law click on below link:

https://brainly.com/question/31145481#

#SPJ11

according to article 7 of the nar code of ethics, which of these statements is most accurate when accepting compensation from parties to a transaction?

Answers

Article 7 of the National Association of Realtors (NAR) Code of Ethics states that real estate agents must disclose to their clients any financial benefits they receive from the transaction.

This includes compensation from both the buyer and the seller, as well as any referral fees or compensation from other parties. The disclosure must be made in a timely and complete manner, and the agent must obtain the client's informed consent before accepting any compensation. This helps to ensure transparency and avoid conflicts of interest, as clients are able to make fully informed decisions about their transactions with all relevant information disclosed to them by their agent.

To know more about National Association of Realtors click here:

brainly.com/question/31226349

#SPJ4

___________makes it easier for employees to win discrimination lawsuits

Answers

There are several factors that can make it easier for employees to win discrimination lawsuits, but one of the most important is evidence.

Evidence can take many forms, including documentation of discriminatory actions, witness testimony, and statistical data that shows patterns of discrimination. When employees have strong evidence to support their claims of discrimination, they are more likely to be successful in court. Additionally, having a clear and comprehensive anti-discrimination policy in place can also strengthen an employee's case. This policy can serve as evidence that the employer was aware of the discriminatory behavior and failed to take appropriate action to prevent it. Overall, having solid evidence and a strong anti-discrimination policy can significantly increase the likelihood of success in a discrimination lawsuit.

To know more about lawsuits click here:

brainly.com/question/30392587

#SPJ4

We are an organization that strongly supports the 2nd Amendment and we prepare responsible American gun owners to avoid danger, save lives, and keep their loved ones safe. Tell us how our mission resonates with you.

Answers

The mission of this organization, which fervently supports the Second Amendment by educating "responsible American gun owners to prevent danger, save lives, and keep their loved ones safe," is timely given that society has recently experienced issues due to the misuse of guns rather than their proper use for defense.

What guarantees does the second amendment provide?

The Second Amendment to the United States Constitution states that no one's right to keep and bear arms shall be infringed because a well-regulated militia is vital to the security of a free State.

Its objective is to protect an individual's right to own a handgun for non-military uses and to use such a weapon for legal purposes such as self-defense within the home.

How does the organization's mission relate to ours?

Despite the fact that the United States Constitution enables individuals to acquire and possess firearms, we do not agree that there are organisations that focus on training citizens to use weapons since we consider that this is a measure that may generate danger in society. Additionally, we think that the state should have the legal ability to use guns to protect its citizens. It should also give them with security.

Learn more about second amendment: https://brainly.com/question/29894002

#SPJ1

in roe v. wade (1973) the u.s. supreme court ruled a. that the right to privacy extends to an abortion b. women have a right to an abortion at any time during a pregnancy c. to legalize abortion with regulations to consider the interests of the mother, the state and the unborn child d. only a and b e. only a and c

Answers

Answer:

e. only a and c.

Explanation:

In the landmark case Roe v. Wade (1973), the U.S. Supreme Court ruled that the right to privacy extends to an abortion, and that the Constitution protects a woman's right to choose to have an abortion. However, the Court also ruled that the right to an abortion is not absolute, and that the state has a legitimate interest in regulating abortion to protect the health of the mother and the potential life of the fetus. The Court established a trimester framework for evaluating state abortion regulations, with greater state restrictions on abortion permitted as the pregnancy progresses.

A person is driving to a friend's wedding. She is wearing a formal dress that creases easily. She doesn't wear her seatbelt because it will wrinkle her dress. What advice would you give her?

Answers

Explanation:

I would strongly advise the person to prioritize her safety and wear her seatbelt, regardless of whether it may cause some wrinkles on her dress.

While looking presentable is important for a wedding, the safety of the driver and passengers is even more crucial. In the event of a collision, not wearing a seatbelt could lead to serious injuries or even fatalities, which are much more significant than the appearance of the dress.

To avoid or minimize any wrinkles caused by the seatbelt, the person can try adjusting the seatbelt height, using a seatbelt pad, or bringing a handheld steamer or iron to the wedding to touch up her dress if necessary. It is important to remember that safety should always come first, and that there are ways to mitigate any potential damage to clothing.

the forensic nurse examiner is evaluating a defendant for legal sanity. what finding does little to help the nurse determine legal sanity of the defendant

Answers

The finding that does little to help the nurse determine the legal sanity of the defendant is The defendant's emotional state is anxious or fearful.

What is the role of forensic nursing?

Forensic nursing is a medical specialty that encompasses a wide range of healthcare roles. These nurses assess and treat victims of violent and criminal acts. They serve as liaisons between the criminal justice system and healthcare providers. The role of the forensic nurse examiner is to assess the medical needs of victims of violence and provide evidence for legal cases.

This is accomplished by gathering medical data and other evidence and presenting it to legal authorities. The forensic nurse examiner assesses the mental state of victims as well as defendants in a case to help determine the circumstances surrounding the event.

What is legal sanity?

The ability of an individual to understand and appreciate the nature and consequences of their conduct is referred to as legal sanity. In other words, legal sanity refers to a person's state of mind at the time a crime was committed. Legal sanity is an important component of criminal law since it is necessary for a person to be sane at the time of the crime to be held responsible for their actions.What finding does little to help the nurse determine legal sanity of the defendant?The defendant's emotional state is anxious or fearful is the finding that does little to help the nurse determine the legal sanity of the defendant.

To know more about forensic nurse examiner refer here:

https://brainly.com/question/22925514

#SPJ11

Carrie was a top scholar in the legal field. Roger hired her to teach a Business Law course in his private school. Roger agreed to pay Carrie $15,000 per month for six months. The contract was signed and effective on January 1st, with classes starting on January 9th.

Carrie transferred her right to February’s payment to her friend Jen. Jen did not give Carrie anything for the right to payment; Carrie was just being nice.

On March 10th, Roger sold his school to Kyle. As part of the sale, Roger transferred to Kyle the right to have Carrie teach at the school.

Carrie decided she did not want to teach at the school if Kyle owned it, so on April 1st, she paid Mary $20,000 and transferred her obligation to teach to Mary.

Identify the type of transfer (of the right to payment) from Carrie to Jen and discuss the relevant Chapter 16 law to explain if the transfer is valid. (Write at least 2-3 sentences).
Identify the type of transfer (of the right to have Carrie teach) from Roger to Kyle and discuss the relevant Chapter 16 law to explain if the transfer is valid. (Write at least 2-3 sentences).
Identify the type of transfer (of the obligation to teach) from Carrie to Mary and discuss the relevant Chapter 16 law to explain if the transfer is valid. (Write at least 2-3 sentences).

Answers

Answer:

1. The type of transfer from Carrie to Jen is an assignment. An assignment occurs when a party transfers a contractual right to another party. The assignment of the right to payment is valid as long as it is not prohibited by the original contract or by law. In this case, the contract between Roger and Carrie did not prohibit the assignment of the right to payment, and there is no law that prohibits it, so the transfer is valid.

2. The type of transfer from Roger to Kyle is an assignment. When a contract is assigned, the new assignee steps into the shoes of the original party and assumes all rights and obligations under the contract. An assignment can be valid unless the contract prohibits it or the obligations that are being assigned have already been performed. In this case, the contract between Roger and Carrie did not prohibit assignment, and the obligation to have Carrie teach had not yet been performed. Therefore, the transfer is valid.

3. The type of transfer from Carrie to Mary is a delegation. A delegation occurs when a party transfers their obligation to another party. The general rule is that obligations under a contract are not transferable unless the contract specifically allows it. In this case, there is no mention of delegation in the original contract, so the transfer could be invalid. However, if the obligation being delegated is for services that are personal in nature, such as teaching, the delegation may be invalid. In this case, the court would need to determine if teaching is a personal service.

Please help me with this form.

Premium Court pays District of Columbia (DC) unemployment tax and makes the required deposits of both federal and state unemployment taxes on a timely basis.
DC applies a rate of 0.7 percent to the first $9,000 of wages per employee and thus Premium Court paid state unemployment taxes of $496.30 to DC in 2022. DC is not subject to a credit reduction and there was no overpayment of FUTA in 2021. Use this information to complete Parts 1-4 (as necessary) of Form 940.

Answers

1b. If you had to pay state unemployment tax in more than one state, you are a multi-state employer

1b. Check here

Complete Schedule A

How to present the information

Based on the information provided, Premium Court only paid state unemployment tax in one state, which is the District of Columbia (DC).

Therefore, they are not considered a multi-state employer.

The response to the given questions should be:

1a. If you had to pay state unemployment tax in one state only, enter the state abbreviation.

1a. DC

1b. If you had to pay state unemployment tax in more than one state, you are a multi-state employer

1b. Check here

Complete Schedule A

Leave this section blank, as Premium Court is not a multi-state employer.

Read more about tax here:

https://brainly.com/question/1775528

#SPJ1

(q004) are civil rights strengthened by a presidential administration’s actions, or by rulings in the supreme court, and why?

Answers

Civil rights can be strengthened by both a presidential administration's actions and by rulings in the Supreme Court. Each plays a distinct role in promoting and protecting civil rights in the United States.


1. Presidential administration's actions: The executive branch, led by the president, has the power to create policies and enforce laws that can have a significant impact on civil rights. For instance, a president can issue executive orders that further civil rights protections, allocate resources towards enforcement, or promote social equity through various government programs.

Additionally, the president has the power to appoint leaders to key positions within the government, such as heads of agencies, who can also work towards advancing civil rights. In these ways, a presidential administration can play a crucial role in strengthening civil rights.


2. Rulings in the Supreme Court: The Supreme Court, as the highest court in the United States, has the power to interpret the Constitution and determine the legality of laws and government actions. Through their rulings, the Supreme Court can set important legal precedents that establish or uphold civil rights protections.

Landmark cases such as Brown v. Board of Education, which ended racial segregation in public schools, demonstrate the significant impact the Supreme Court can have on civil rights.


In conclusion, both a presidential administration's actions and rulings in the Supreme Court contribute to strengthening civil rights. While the president and their administration can implement policies and programs that advance civil rights, the Supreme Court's role in interpreting the Constitution and establishing legal precedents is equally important in ensuring the protection and promotion of these rights.

To know more about Civil rights refer here: https://brainly.com/question/21057720#
#SPJ11

What are the three basic common characteristics of state constitution ?

Answers

popular sovereignty, limited government and separation of powers!
1) Separation of Powers: State constitutions typically divide the powers of government among different branches, such as the legislative, executive, and judicial branches. This ensures that no one branch has too much power and provides a system of checks and balances.
2) Bill of Rights: Most state constitutions include a bill of rights that outlines the individual rights and protections afforded to citizens, such as freedom of speech, religion, and the press.
3) Republican Form of Government: State constitutions typically establish a republican form of government, meaning that power is ultimately held by the people through their elected representatives. This is in contrast to a monarchy or dictatorship, where power is held by a single individual or group.
While these are the three basic common characteristics, state constitutions can vary widely in their content and structure, depending on the history, culture, and political values of each state.

a form of government in which power is held by the people, who vote to elect their representatives.

Answers

Democratic is a form of government in which power is held by the people, who vote to elect their representatives.

Since "democracy" is derived from the Greek words "demos," which means "people," and "kratos," which means "power," democracy can be defined as a form of government that is based on the will of the people. The ability of the people to choose their leaders is the primary characteristic of a democracy. So, in a sense, a democracy is a form of popular rule. The fundamental tenet is that by taking part in the creation of these rules, people rule themselves. democracy in our governments.

Since the people elect their representatives as Members of the Legislative Assembly (MLAs), they hold the primary power in a democracy. The members of the ruling party then form the government, with some of them being named ministers.

Learn more about democracy at:

brainly.com/question/13158670

#SPJ4

a tree in connie’s yard fell during the last storm and damaged her neighbor’s car. connie did not have insurance that covered this type of accident and has not paid the neighbor for the damage. the neighbor has decided to sue connie in court. which type of lawsuit would this be?

Answers

This would be a civil lawsuit for property damage.

The neighbor is seeking compensation from Connie for the damage to their car that was caused by the fallen tree on Connie's property. The neighbor would need to prove that Connie was negligent in maintaining her property and that this negligence led to the damage to the car. The outcome of the lawsuit will depend on the evidence presented by both parties and the decision of the judge or jury.

Since Connie did not have insurance that covered this type of accident, she may be held personally responsible for the damages caused. The neighbor would need to provide evidence of the damage caused and the cost of repairs in order to successfully pursue this type of lawsuit.

To know more about lawsuit click here:

brainly.com/question/30392587

#SPJ4

how has the geneva convention impacted the world today?

Answers

The Geneva Conventions are a set of international treaties that establish the standards for humanitarian treatment during war.

The conventions have had a significant impact on the world by establishing protections for civilians, prisoners of war, and medical personnel during armed conflicts. The conventions have also helped to establish international norms and expectations for the behavior of combatants during war, including limits on the use of certain weapons and tactics. The conventions have been ratified by the vast majority of countries in the world, demonstrating a global commitment to the principles of humane treatment during armed conflict. Overall, the Geneva Conventions have played a critical role in promoting human rights and minimizing suffering during times of war.

To know more about humanitarian click here:

brainly.com/question/28248356

#SPJ4

Question # 10
Match List
Match the job to the tasks associated with it.

Put responses in the correct input to answer the question.

paralegals

legal secretaries

court reporters

mediators

Answers

We can match the jobs to the tasks associated with it in the following way:

Paralegals: Experienced and knowledgeable persons handling paper work for court cases such as divorce, estates, bankruptciesLegal secretaries: Provide administrative, typing and copying supportCourt reporters: Transcribe spoken or recorded speech into written form; often need to do voice writing as well.Mediators: Solve legal disputes in the workplace, families, and community with complete confidentiality.

Who is a mediator?

A mediator is a professional trained to act as a neutral facilitator during a mediation process. He is usually an impartial third party in a mediation.

Mediation is a process in which parties discuss disputes, and the mediator helps them to reach an agreeable settlement.

A mediators play a role in some of these situations:

domestic relations,worker's compensation,commercial transactionslabor or community relations,legal depositions or settlements, etc.

Learn more about a mediator at brainly.com/question/30501868.

#SPJ1

a contract entered into by an intoxicated person can be either be voidable or valid: a. true b. false

Answers

The answer is "true." A contract entered into by an intoxicated person can be either voidable or valid.

When a person is intoxicated, their judgment may be impaired, and they may not fully understand the terms and implications of a contract. In such cases, the contract may be considered voidable, meaning that the intoxicated person has the option to either affirm or reject the contract. However, if the intoxicated person was still capable of understanding the nature and consequences of the contract despite their intoxication, the contract may still be considered valid. Ultimately, the determination of whether a contract entered into by an intoxicated person is voidable or valid will depend on the specific circumstances of the case and the applicable laws and regulations.

To know more about voidable click here:

brainly.com/question/30471036

#SPJ4

What do lawsuits related to performance management usually involve?

Answers

Charges of discrimination or unfair termination are frequently included in lawsuits brought against performance management.

What is meant by lawsuits?In a civil court of law, a lawsuit is a legal action brought by one or more persons (the plaintiff or claimant) against one or more other parties (the defendant). The ancient term "suit in law" is present in just a tiny number of laws still in effect today.A $206 billion tobacco settlement was reached in 1998. The largest legal settlement ever reached was the Tobacco Master Settlement Agreement, which was signed in November 1998. You can seek justice for any losses or harm physical or emotional you may have suffered as a result of the other party's acts by bringing a lawsuit. The party that you are suing will be referred to as the defendant and you as the one who is making the claim will be referred to as the plaintiff.

To learn more about lawsuits, refer to:

https://brainly.com/question/27880380

what term has the following definition-- the illegal practice of refusing to offer credit or insurance in a community based on a discriminatory basis?

Answers

The term that has the following definition-- the illegal practice of refusing to offer credit or insurance in a community based on a discriminatory basis is redlining.

Redlining is a practice that is considered to be discriminatory, illegal, and unethical. It refers to a financial institution's or insurance company's refusal to provide credit or insurance services in a specific area, either geographic or demographic, based solely on that area's racial and ethnic makeup or economic class.

The United States' history of redlining can be traced back to the 1930s, when the federal government began mapping out neighborhoods in metropolitan areas and categorizing them as "safe" or "risky" for investment. These maps' markings determined who would have access to mortgages, insurance, and other financial services. The term "redlining" is derived from the practice of drawing a red line on a map around specific areas.

Areas that were marked in red were considered to be high-risk areas, and financial institutions refused to offer credit or insurance to people living in those areas. This resulted in those areas remaining poor and segregated, as people were unable to acquire property or gain access to economic opportunities. Redlining had a long-term impact on communities, particularly those made up of Black and Hispanic people.

Homeownership was difficult to achieve, which meant that wealth could not be built through property ownership. When homeownership and property values fell, these neighborhoods lost vital tax revenue, making it difficult for communities to fund education, infrastructure, and other necessary public services. Redlining made it harder for people living in segregated areas to access quality healthcare, good jobs, and safe housing. Redlining remains a critical issue in many areas.

To know more about redlining, refer here:

https://brainly.com/question/28245308#

#SPJ11

which group achieved the right to vote in the twenty-sixth amendment?

Answers

It granted All United State citizens age 18 years or older ..

What types of cases require questioned document examiners?

Answers

Death investigations, threats, and robberies.

Answer:

Questioned document examiners can be called upon to investigate a variety of cases related to documents, including:

1. Forgery: when a document is suspected to have been forged or manipulated

2. Fraud: when a document is suspected to be fraudulent or to contain fraudulent information

3. Document alteration: when a document has been altered from its original form

4. Disputed wills: when the legitimacy of a will is in question

5. Anonymous letters or threats: when a document is suspected to be authored by an unknown person

6. Counterfeit currency: when a document is suspected to be counterfeit or fake, such as banknotes or checks

These are just some examples of the types of cases that may require the expertise of a questioned document examiner.

what was the result of the worcester v. georgia supreme court case?

Answers

Answer:

Georgia's license law was unconstitutional and Worcester's conviction should be overturned.

Explanation:

On review of the case, the Supreme Court in Worcester v. Georgia ruled that because the Cherokee Nation was a separate political entity that could not be regulated by the state

Other Questions
which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3