Which property is shared by the cells of all living things?

Answers

Answer 1

Answer:

cells, growth, reproduction, adaptation, homeostasis, use of energy and response to the environment

Answer 2

The property that is shared by the cells of all living things the cells contain DNA composed of adenine, thymine, guanine, and cytosine. The correct option is A.

What are living things?

Living things are those things that are alive, The main property of a living thing can distinguish them from non-living things. These properties are growth and reproduction.

The living cells are those cells that made all the living matter. The living cell is composed of macromolecules. The cell is composed of DNA and different cell organelles.    

DNA is present in every living organism. It determines the genetic difference of every organism. It is the same in every cell.

Thus, the correct option is A. The cells contain DNA composed of adenine, thymine, guanine, and cytosine.

To learn more about living things, refer to the link:

https://brainly.com/question/5337986

#SPJ6

The question is incomplete. Your most probably complete question is given below:

A. The cells contain DNA composed of adenine, thymine, guanine, and cytosine.

B. The cells have chromosomes that are located inside a membrane-bound- nucleus.

C. The cells are surrounded by a phospholipid bilayer and a cell wall made of

cellulose.

D. The cells rely on mitochondria to carry out aerobic cellular respiration.


Related Questions

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

which muscle group relates best with the term midline?

Answers

The oblique is the muscle group that best relates with the term midline.

The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:

The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.

It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.

The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.

Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.

Learn more here: https://brainly.com/question/19486604

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

How does thermal energy impact the lower layers of atmosphere?

Answers

Answer:

Explanation:

Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere

In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?

Answers

Yes, reducing poaching will help increase the elephant population

A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?

Answers

Answer:

This spacecraft can travel

[tex]72000km[/tex]

in an otherwise normal cell, what happens if one mistake is made during dna replication?

Answers

Answer:

Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.

Explanation:

what are the two major anatomical subdivisions of the nervous system?

Answers

Answer: The nervous system has two main parts:

The central nervous system is made up of the brain and spinal cord.

The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Explanation:

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

A change in pH has the greatest impact on which life proces

Answers

Answer:

Aquatic Organisms

If the pH of water is too high or too low, the aquatic organisms living within it will die. pH can also affect the solubility and toxicity of chemicals and heavy metals in the water ¹². The majority of aquatic creatures prefer a pH range of 6.5-9.0, though some can live in water with pH levels outside of this range.

Explanation:

Adding more OH- ions increases the pH, making the substance more basic. Increasing the pH will increase the number of OH- ions, so the equilibrium will shift to the left. Decreasing the pH will increase the number of H3 O+ ions; they'll ''use up'' the OH- ions, thus shifting the equilibrium to the right.

plz answer correctly. thank you.

Answers

Answer:

Mitosis and cytokinesis

Explanation:

Answer:

see below

Explanation:

1) A- Interphase and mitosis

2) Interphase

Which of the following elements is not a metalloid?

Answers

Answer:

gallium

Explanation:

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2

tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?

Answers

Answer:

Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.

Explanation:

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –

Answers

Answer:

b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Explanation:

Answer:

b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

Explanation:

c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology

Answers

Answer:

guess we were in the same boat I have

Explanation:

Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today

Help this is due in an hour….

Answers

Answer:

I'm sure it's A

Explanation:

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

which muscle is used when giving your grandmother a kiss on the cheek?

Answers

Sternocleidomastoid

Explanation:

what is the name of the tiny air sacs in your lungs?

Answers

Answer:

alveoli

Explanation:

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

Other Questions
Lee las siguientes oraciones, escribe los signos de exclamacin e interrogacin que hacen falta.a. Tienes hambre?!Vamos al restaurante nuevo.b. Nadie entiende por qu sali gritando:c. Cllate No quiero discutir ms.No ms.d. Profesor, ya estn listas las notas definitivase. Qu alegra verte A health club charges a one-time sign-up fee and a monthly membership fee. Theequation y = 35x + 20 represents what the health club charges. Find the rate ofchange.= 1. What was the name of the man who named the Super Continent? *George WashingtonWilliam SmithAlfred Wegener Helppp ppleasee ??!! What is the wavelength of a radio wave that has a frequency of 9.40 X 10^8Hz?3.1 The energy needs of an eagle range between 350-600 calories per day. If it gets 120 calories from consuming 1 snake, how many snakes can it have What best describes why Odysseus gave his wine to the Cyclops? you divide a number by 3, add 6, then subtract 7. The result is 4. What is the number? I need help please asap!! Why is it important to form a hypothesis at the beginning of an experiment?What is a scientific theory?What is a scientific law? Help me with this it is math How do the passages' themes compare? Both passages have the theme "time erases everything." "Elgin Marbles" has the theme "art outlasts even death," while "Ozymandias" has the theme "death comes to everything." Both passages have the theme "nature is cruel." "Elgin Marbles" has the theme "decay is inevitable," while "Ozymandias" has the theme "fame survives death." what is the difference between exergonic and exothermic reactions? find the value of the expression -15.08 -8.43 According to Adams, Jackson- Was a fake and a phony.- Was as ignorant as his followers.- Filled a need among the Americans people. What happens to the size of an Object when it is heated ? according to abraham maslow, the highest need is ________. What color is the sky? How many moles of Oz would be required to generate 13.0 mol of NO2in the reaction below assuming the reaction has only 74.1% yield?2 NO (g) + O2 (g) 2 NO2 (g) The Enclosure Movement in England helped contribute toindustrialization because it