Which phrase best completes this list?
explain reasoning, if correct will mark as brainliest.

Which Phrase Best Completes This List?explain Reasoning, If Correct Will Mark As Brainliest.

Answers

Answer 1

Correct option is D, Effects of industrial revolution includes Lower price on goods.

What was the Industrial Revolution's significance?

It symbolised the shift from an agrarian economy to an industry-driven economy where things were produced using mechanisation. This led to a surge in business activity, and subsequent commercial expansion was encouraged by transportation advancements.

The Industrial Revolution produced many great results. A few of these included an increase in wealth, the production of commodities, and the standard of living.

The populace had access to less expensive goods, nicer homes, and a more nutritious food. Education increased significantly throughout the Industrial Revolution.

What factor contributed most to the Industrial Revolution?

The development of capitalism as an economic philosophy, which aided affluent people in starting their own firms, was the first major factor. The subsequent significant factor was the globalisation of European empire.

To learn more about industrial revolution from given link

https://brainly.com/question/546336

#SPJ1


Related Questions

What document outlined a promise to the Jewish people that they would be given their own state in their historic homeland?

Balfour Declaration
Sykes-Picot Agreement
Zionist manifesto
Truman Doctrine

Answers

Answer: Balfour Declaration

Explanation:

The Balfour Declaration, issued by the British government in 1917, outlined a promise to the Jewish people that they would be given their own state in their historic homeland. The document was a letter from British Foreign Secretary Arthur Balfour to the leader of the British Jewish community, Lord Rothschild, in which the British government declared its support for the establishment of a Jewish national homeland in Palestine. The Balfour Declaration was an important precursor to the eventual establishment of the State of Israel in 1948.

Answer:  Balfour Declaration

Explanation:

Middle class women during the Industrial Revolution:

went to work in numbers near equal to men.

were primarily responsible for home life.

received approximately 50% of university degrees.

generally did not hire servants.

Answers

Middle-class women during the Industrial Revolution were primarily responsible for home life. Thus, option (b) is correct.

What are revolution?

The term revolution refers to a fundamental shift away from the status quo in the fields of past times and political science, typically affecting the self-established social structures and governmental structures.

In the industrial revolution, several women worked with lower wages. As compared to men, women get lower wages, and later, often as children, they also start working.

Therefore, option (b) is correct.

Learn more about the Revolution here:

https://brainly.com/question/1291142

#SPJ1

Why is hourly labor considered a variable (flexible) factor of production

Answers

Answer:

Hourly labor is considered a variable or flexible factor of production because it can be easily adjusted according to changes in the level of production output.

In other words, the amount of labor input required can be varied in response to changes in the level of demand for the product or service being produced. For example, if demand for a product suddenly increases, a company can hire more workers to produce more units. Conversely, if demand falls, the company can reduce its workforce by laying off workers or reducing their working hours.

Hourly labor is therefore considered a flexible factor of production because it can be readily adjusted in the short run to adapt to changes in the level of demand, whereas other factors of production such as machinery or buildings may be less flexible or more difficult to adjust quickly.

Explanation:

PLEASE SOMEONE HELP (30 POINTS)
Which three were famous Broadway hits during the 1960s?
Annie
Hair
Cabaret
Same Time, Next Year
The Odd Couple
Grease​

Answers

The three famous Broadway hits during the 1960s included :

Hair Cabaret The Odd Couple

What were the opening hits ?

Grease opened on Broadway in 1972, Annie opened in 1977, and Same Time, Next Year opened in 1975.

Hair is a rock musical with music by Galt MacDermot and book and lyrics by James Rado and Gerome Ragni. It premiered off-Broadway in 1967 and then opened on Broadway in 1968.

Cabaret is a musical with music by John Kander, lyrics by Fred Ebb, and a book by Joe Masteroff. It opened on Broadway in 1966 and is set in 1931 Berlin during the rise of the Nazi party.

Find out more on Broadway hits at https://brainly.com/question/4001097

#SPJ1

This political cartoon, which was drawn by Thomas Nast, appeared in Harper’s Weekly on October 7, 1871.

The message of this cartoon is reflective of what situation in the late 1800s?

A. Political machines promoted nativism by preventing immigrants from voting in local elections.
B. Political machines prevented election fraud by making sure no voter was intimidated at the ballot box.
C. Political machines maintained power by manipulating elections.
D. Political machines protected voters from powerful city bosses.

Answers

The "Brains," as Thomas Nast called them, were Tweed's body with a money bag in lieu of his face. They were the motivation behind government corruption in New York.

The political drawings by Thomas Nast, what was their major point?

Nast was a staunch supporter of this idea. Nast utilized Harper's as his platform to make candidates responsible for the issues of the time, such as the economy, government corruption, immigration, & civil rights, by using satire and skillful caricatures.

What was the subject of Thomas Nast's political cartoons?

He painted religious education advocacy on the part of the populace as a danger to democracy. His writing included frequent reference to the autocratic papacy in Rome, uneducated Irish Americans, and dishonest Tammany Hall politicians.

To know more about Thomas Nast visit:

https://brainly.com/question/13826497

#SPJ1

What is the world's largest ancient earth and stone construction project?

Answers

Answer: b

Explanation:

a

manlalayag na na
karating sa quebec

Answers

Answer:

Jacques Cartier

Explanation:

Si Jacques Cartier ay nagmula sa bansang Pranses at sa katunayan ay siya ang nagpangalan sa buong bansa bilang Canada, alinsunod sa hari ng Pranses noong unang Panahon. Kaya naman halos ang buong bansang Canada ay nagsasalita at alam ang wikang Pranses.

If you were a supporter of W.E.B. Du Bois and the NAACP, why would you have a hard time backing Marcus Garvey?

Select the best answer from the choices provided.
A.
His slogans, uniforms, and pomp appealed to the poor and uneducated.
B.
His mass movement did not rely on the Talented Tenth.
C.
His Negro Zionism was counter to the NAACP's mission of improving U.S. laws and policies.
D.
All answers are correct.

Answers

The NAACP's goal of making laws and policies in the United States better was opposed by his Negro Zionism.  Option D . all are correct .

Which person was Marcus Garvey?

The Universal Negro Improvement Association (UNIA) was founded in 1914 by Marcus Garvey (1887–40). He advocated for black people to take control of their lives and start their own businesses rather than enduring discrimination from white employers. He started a restaurant, a newspaper, and the Black Star Line, which was the first US shipping company owned by black people. "Garveyism" was the practice of black individuals establishing black-owned businesses as a means of achieving economic independence and success. Garvey argued in "The Negro's Greatest Enemy," which was published in 1923, that African Americans needed to take charge of their own futures because they were their own worst enemies. He was a pioneer in the development of the black nationalism movement.

To learn more about Marcus Garvey visit :

https://brainly.com/question/4421138

#SPJ1

Which of the following was a reason that the U.S. government created Amtrak?
Question 8 options:

a)

to maintain service despite a decline in rail passenger travel

b)

to consolidate and oversee the railroad industry

c)

to increase market competition with other forms of ground travel

d)

to bail-out failing state rail operations

Answers

The statement that was a reason that the U.S. government created Amtrak is: a) To maintain service despite a decline in rail passenger travel.

Which of the following was a reason that the U.S. government created Amtrak?

Amtrak, officially known as the National Railroad Passenger Corporation, was created by the U.S. government in 1971 to operate most intercity passenger rail service in the United States. The creation of Amtrak was a response to the decline of passenger rail travel in the 1950s and 1960s, which had led many private railroads to discontinue or reduce passenger service.

Amtrak was intended to provide a stable and reliable passenger rail service that would maintain essential transportation links between cities and regions, even in areas where private railroads were no longer operating.

Learn more about Amtrak here:https://brainly.com/question/28293005

#SPJ1

Which statement accurately describes a totalitarian system of government?

Responses

It pursues peaceful means of achieving its goals.

It pursues peaceful means of achieving its goals.

It guarantees basic freedoms and civil rights to all citizens.

It guarantees basic freedoms and civil rights to all citizens.

It demands unquestioning loyalty of all citizens to the leader.

It demands unquestioning loyalty of all citizens to the leader.

It encourages political, cultural, and religious diversity.

It encourages political, cultural, and religious diversity.

Answers

The statement which accurately describes a totalitarian system of government is it demands unquestioning loyalty of all citizens to the leader. The Option C is correct.

What is a totalitarian system of government?

Totalitarianism refers to a type of government that seeks total control over its citizens' lives. It is distinguished by a strong central rule that uses coercion and repression to control and direct all aspects of individual life.

It does not allow for individual liberty. Traditional social institutions and organizations are discouraged and suppressed, making people more willing to join a unified movement. Totalitarian states typically pursue a single goal to the exclusion of all others, directing all resources toward its achievement at any cost.

Read more about totalitarian

brainly.com/question/463275

#SPJ1

in the parable of the prodigal son, jesus taught about

The proper use of money and property
The need to avoid poverty and famine
The compassion and mercy of God toward sinners
The necessity of never sinning

Answers

In the parable of the prodigal son, Jesus taught about the compassion and mercy of God toward sinners.

What is the parable of the prodigal son?

Luke 15:11–32 contains a description of the Prodigal Son. The father had two boys. The elder son promised the younger son the money, and the elder son agreed to deliver it to him. The younger son eventually moved away from home to reside in a "far country". It is one of Jesus Christ's stories. I In the context of verses 1-3, Jesus tells three parables to a gathering of Pharisees and scribes who were criticizing him for eating and drinking with sinners.

Know more about prodigal son - brainly.com/question/30142623

#SPJ1

the sixty Region and their capital ​

Answers

Answer:

There are 16 regions of Ghana

In what ways does the podcast suggest the Declaration of Independence and the Constitution were hypocritical when written? Do you agree?

Answers

The podcast suggests that the Declaration of Independence and the Constitution were hypocritical when written because they declared that all men were created equal yet did not recognize the rights of Native Americans, African Americans, and women.

What is  Podcast ?

A podcast is a digital audio file made available on the Internet for downloading to a computer or mobile device, typically available as a series, new episodes of which can be received by subscribers automatically. Podcasts are often distributed through syndication feeds, allowing users to subscribe to a podcast and receive new episodes automatically. Podcasts typically contain audio files, although some may contain video or other digital files.

In addition, the Founding Fathers wrote about the rights of self-governance and freedom from oppression, yet allowed for the continued practice of slavery.

I do agree that the Declaration of Independence and the Constitution were hypocritical when written. The Founding Fathers wrote lofty ideals and promises of freedom and equality, yet they failed to extend these same rights to everyone. This is a clear display of hypocrisy that is still felt today.

To learn more about Podcast

https://brainly.com/question/25336911

#SPJ1

Tennessee’s nickname as the “Perfect 36” comes from its support of which progressive issue?


A. antitrust legislation
B. conservation
C. prohibition
D. women’s suffrage

Answers

Tennessee became a member of the Perfect 36 on August 24, 1920. In other words, it became the last state required for the 19th Amendment, which granted women the right to vote in America, to be ratified.

The correct answer is D

When did the 19th Amendment become a law?

The Nineteenth Amendment, which was approved by Senate of June 4, 1919, and enacted in August 1920, was a significant step in the long struggle for political equality among women. The Senate's protracted journey to ratifying the Constitution's 19th Amendment is depicted in this timeline of significant turning points.

Who promoted the voting rights of women?

The National Woman Suffrage Organization is founded by Elizabeth Cady Stanton and Susan B. Anthony. By a Congressional constitutional amendment, the organization's main objective is to grant women the right to vote.

To know more about 19th Amendment  visit:

https://brainly.com/question/30555049

#SPJ1


What grade was Kathrine currently in when she was offered a full
scholarship?

Answers

We can see here that Kathrine was just a freshman when she was offered a full scholarship.

What is scholarship?

A scholarship is a type of financial aid or grant that is awarded to students to help cover the costs of their education. Scholarships are typically awarded based on a variety of criteria, including academic merit, financial need, athletic or artistic ability, leadership potential, community service, or a combination of these factors.

We see here that the question about Kathrine is related to Hidden Figures by Margot Lee Shetterly.

She was actually a freshman when she got full scholarship.

Learn more about scholarship on

#SPJ1

What is the largest city in crimea

Answers

Answer:

Sevastopol

Explanation:

Sevastopol is the largest

Ghana merchants often aquired goods by engaging in what?
Responses

loud arguing
loud arguing

silent trade
silent trade

death matches
death matches

arm wrestling

Answers

Ghana merchants often acquired goods by engaging in silent trade.

What is silent trade?

Silent trade, also known as , depot trading, or silent trade, is a mechanism that enables dealers who do not speak the same language to conduct business silently. Group A would leave trade products in a conspicuous location and announce their departure, for example, by ringing, firing, or tapping. Throughout the beginning of time, akin to the prehistoric Ghana Empire, silent marketing has been practiced. By the Niger swash, the Ghanaian swab traders would leave pounds of the swab, and in exchange, the gold dealers would leave a respectable amount of gold. Typically, one group goes to a predetermined location, drops the products to be swapped, and then leaves, perhaps making a call or ding stroke.

To learn more about silent trade click on the given link:

https://brainly.com/question/415098

#SPJ1

This is an excerpt from Presidential Proclamation 2914 made on December 16, 1950.

Whereas events in [Asia] and elsewhere constitute a grave threat to the peace of the world and imperil the efforts of the country and those of the United Nations to prevent aggression and armed conflict; and…. Whereas the increasing menace of the forces of communist aggression requires that the national defense of the United States be strengthened as speedily as possible: Now, therefore, I, Harry S. Truman, President of the United States of America, do proclaim the existence of a national emergency, which requires that the military, naval, air, and civilian defenses of this country be strengthened as speedily as possible to the end that we may be able to repel any and all threats against our national security and to fulfill our responsibilities in the efforts being made through the United Nations and otherwise to bring about lasting peace.
How did this proclamation impact the development of the Cold War?


It led to the reunification of Korea under a democratic government modeled after the United States.
It set the precedent for the United States engaging in military actions without formal declarations of war.
It set the precedent for the United States participating only in peacekeeping operations sanctioned by the United Nations.
It led to the United States and the Union of Soviet Socialist Republics (USSR) working together to help struggling nations in Asia.

Answers

Answer:

its C

Explanation:

What events led to the fall of rome

Answers

Answer:

The fall of Rome is a complex historical event that is attributed to a combination of political, economic, and military factors, rather than a single cause. Some of the key events that contributed to the decline and eventual fall of Rome include:


1. Political instability: In the 3rd century AD, Rome saw a period of political instability and chaos as the empire was ruled by a series of weak and ineffective emperors. This led to a lack of central authority and weakened the state's ability to maintain order and control.


2. Economic troubles: The economy of the Roman Empire was strained by high levels of taxation, inflation, and a dependence on slave labor. This led to a decline in trade and a reduction in revenue for the state, making it difficult to maintain the military and infrastructure.


3. Military defeats: The Roman Empire was faced with numerous military defeats and invasions from barbarian tribes in the 4th and 5th centuries AD. These invasions weakened the state's military power and left it vulnerable to further attacks.


4. Social unrest: The empire was also plagued by social unrest, including class conflict between the rich and poor, political corruption, and religious turmoil. This led to a decline in social cohesion and a breakdown in the rule of law.


5. Division of the empire: In 395 AD, the Roman Empire was divided into two halves, the Western and Eastern empires. The Western half soon became weaker and more vulnerable to invasion, while the Eastern half continued to prosper for centuries.

These factors, along with others, contributed to the gradual decline and eventual fall of the Roman Empire in 476 AD. The fall of Rome had a profound impact on Western civilization and marked the end of the ancient world and the beginning of the Middle Ages.

In his 1933 inaugural address, President Roosevelt called for:
OA. wise and courageous action.
OB. treating the Depression as a national emergency like war.
OC. reorganizing the use of national resources.
OD. All of the above

Answers

In his 1933 inaugural address, President Roosevelt called for treating the Depression as a national emergency like war.

Option B is correct.

When someone starts a significant new job, the first speech they give is called an inaugural speech. the nation's inaugural speech by the president. The first of a series of planned events is an inaugural event: the beginning of the archaeological society's meeting.

When was Theodore Roosevelt's inaugural speech given?

Following President William McKinley's death earlier that day, Theodore Roosevelt's first inauguration as the 26th president of the United States took place on Saturday, September 14, 1901, at the Ansley Wilcox House at 641 Delaware Avenue in Buffalo, New York.

Learn more about President Roosevelt:

brainly.com/question/4633369

#SPJ1

How did Justinian select people for government office? What was the result of his method?

Answers

reorganized the government of the Byzantine Empire and enacted several reforms to increase accountability and reduce corruption.

Why did the Kennedy administration begin to act after Project C in Birmingham, Alabama?

Responses

President Kennedy needed congressional support for his legislative agenda.

President Kennedy needed congressional support for his legislative agenda.

The Supreme Court ordered the executive branch to protect civil rights.

The Supreme Court ordered the executive branch to protect civil rights.

Civil rights leaders threatened to use violence to achieve their aims.

Civil rights leaders threatened to use violence to achieve their aims.

The violence against protestors had been televised nationally.

Answers

Answer:

President Kennedy needed congressional support for his legislative agenda.

Explanation:

just took the quiz

Which of the public opinion do you consider the most important?

public opinion to choose from: Race, gender, age, elite influence, party, economics self-interest, and focusing events

Answers

In reality, public opinion is considered as a major influence in statecraft. We think that once the public's perspectives on public issues are recognized and acted upon, the situation will improve.

What is an example of recognized?

I can always tell who he is by the way he walks. They immediately detected the odor. The United States government has now acknowledged the newly established country. They refused to acknowledge the deal. Think, dream, wonder, plan, imagine, analyze, visualize, gaze, agree, want, consider, estimate, guess, hesitate, hope, enjoy, realize, recognize, recall, know, forget, expect, prefer, and remember. Earned income is known as realized income. If a corporation ships out items worth $10,000 and includes an invoice with 30-day terms, the company does not recognize the $10,000 in income until it receives a check for that amount. Recognized revenue, on the other hand, is documented but not necessarily received.

Know more about public's Visit:

https://brainly.com/question/11353457

#SPJ1

Help Please Due tomm

Answers

Answer:

I will help you vro mark me BRAINLIST

Please help its due today

Answers

Answer:i think it b

Explanation:

im srry if i got it wrong

Which of the following was NOT an effect of the Transportation Revolution?
A increased settlement in the West
B environmental damage from land clearing
C freed the colonies from British rule
D Native Americans forced out of their land

Answers

The freed colonies from British rule were not an effect of Transportation Revolution.

What was the transportation revolution?

The transportation revolution refers to the period of significant advancements in transportation technology, infrastructure, and services during the 19th century. This period was marked by the introduction of steam power, canal systems, railways, and improved roads, which transformed the way people and goods were transported. Steam engines, invented by James Watt, replaced traditional horsepower and sail power, making transportation faster and more efficient. Canals were built to connect waterways, enabling goods to be transported easily and quickly. The railway network was expanded rapidly, connecting towns and cities and improving access to markets and raw materials. This revolution greatly impacted economic development, social mobility, and cultural exchange, paving the way for the modern transportation system we have today.

To learn more about transportation revolution, visit:

https://brainly.com/question/30715016

#SPJ1

GUYS PLS HELP MEEE
near what geographic areas did many new industrial towns develop?

Answers

Explanation:

Many new industrial towns developed near areas with natural resources, such as coal, iron, and water. This includes regions like the Appalachian Mountains in the eastern United States, the Ruhr Valley in Germany, and the Midlands in England. Other factors that contributed to the development of industrial towns include transportation infrastructure, such as railroads and waterways, and access to labor.

the triple alliance included what people

Answers

Triple Alliance, secret agreement was between Germany, Austria-Hungary, and Italy formed in May 1882 and renewed periodically until World War I.

What was the Triple Alliance?

Germany, Austria-Hungary, and Italy joined forces militarily to form the Triple Coalition. It was established on May 20th, 1882, and was extended on a regular basis until it expired in 1915, during World War I. Since 1879, Germany and Austria-Hungary had a tight relationship.

If any of its allies were assaulted, each country vowed to defend them. The Triple Coalition, which included Germany, Austria-Hungary, and Italy. They were opposed by the France, Russia, and England-led Triple Entente.

In the event that France or Russia launched an attack, the three countries agreed to stand by one another. It was extended at intervals of five years, but in 1914, Italy broke its promise by refusing to assist the Central Powers.

To learn more on Triple Alliance from the link:

https://brainly.com/question/1375584

#SPJ1

how was Jamaica’s end of slavery different from the revolution in Haiti?

Answers

Answer:

Explanation:The Haitian Revolution was the first and only slave uprising that led to the establishment of a free state without slavery and ruled by non-whites and former slaves. This feat needs to be recognized more in today's society as one of the marquee revolutions in history.

How did nativism affect ethnic relations in the Gilded Age?

Answers

Many of these new immigrants were coming from eastern and southern Europe and for many English-speaking, native-born Americans of Northern European descent the growing diversity of new languages, custom, and religions triggered anxiety and racial animosity.
Other Questions
Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor determine which of the following features they have in common. private vs public enterprises debate Please provide steps! You are given a primary amino acid sequence of a protein.Explain how you would predict the secondary and tertiary structuresthat the mature version of the given protein would adopt. ABC Incorporated shares are currently trading for $32 per share. The firm has 1.13 billion shares outstanding. In addition, the market value of the firms outstanding debt is $2 billion. The 10-year Treasury bond rate is 6.25%. ABC has an outstanding credit record and has earned a AAA rating from the major credit-rating agencies. The current interest rate on AAA corporate bonds is 6.45%. The historical risk premium over the risk-free rate of return is 5.5%. The firms is estimated to be 1.1, and its marginal tax rate, including federal, state, and local taxes, is 40%.a. What is the cost of equity?b. What is the after-tax cost of debt?c. What is the WACC? Fill in the blank with the French word that best completes the sentence.La sur de mon pre est________.ma surma tantema fillema cousine Question:What is the importance of being educated? Cite and explain the things thhat Filipinos consider to be educated.Note:(I would really appreciate it if it was a simple answer. But if not, it's fine. :) ) What is illustrated by the following line from the second inaugural address: "seeking to destroy it without warseeking to dissolve the union"?a. Allusion b. Didacticismc. Dramaticd. Irony e. Parallelism a ballon contains 7.36 g of oxygen gas, how many oxygen molecules are in the balloon Calculate the interest earned when $46 230 is invested for 9 years at 7.8% p.a., with interest compounded twice a year. Scientists use a technique to abort the formation of seeds in the plant during its early stages. This type of procedure could be: a. Stimulative Parthenocarpy b. Vegetative Parthenocarpy c. Stenosperm PLEASE HELP!!! IT'S URGENT Find the values of x and y. Write your answer insimplest form.X45X =y =y16&