The thalamus is the part of the vertebrate brain which develops from the embryonic diencephalon and acts as a relay center by processing the afferent sensory information and sending it on to the cerebral cortex.
The thalamus is a pair of structures located in the center of the brain, just above the brainstem. It is composed of multiple nuclei, each of which has a specific function related to sensory processing, motor control, and other cognitive processes.
The thalamus receives sensory information from the peripheral nervous system and processes it before sending it to the appropriate area of the cerebral cortex for further processing and interpretation.
To know more about thalamus here
https://brainly.com/question/13179936
#SPJ4
describe the relationship between dingo density and amount of riverine area:
the first strand cdna synthesis corresponds to the____
The first strand cDNA synthesis corresponds to the double stranding using DNA.
The process of creating complementary DNA (cDNA) from an RNA template by reverse transcription is known as cDNA synthesis. Reverse transcriptases (RTs) direct the synthesis of the first strand of cDNA using an RNA template and a primer complementary to the RNA.
This cDNA may then be utilised directly as a template for the Polymerase Chain Reaction (PCR). Reverse transcription and polymerase chain reaction (RT-PCR) is a technique that enables the identification of low abundance RNAs in a sample and the synthesis of the matching cDNA, hence aiding the cloning of low copy genes.
Other methods include employing DNA Polymerase I and DNA Ligase to double-strand the first-strand cDNA. Direct cloning without amplification is possible using these reaction products. The RT or external supply of RNase H activity in this instance is required.
Learn more about DNA synthesis:
https://brainly.com/question/30669006
#SPJ4
Why do you feel scientists classify animals?
Answer: It is necessary to classify animals for their easy identification, their study and research
Explanation:
Answer:
scientists group organisms into groups to nake it easy to study them. It is also done to help people understand the topic more easily
Explanation:
On the microscope is a rotating nosepiece that holds the ___________ lens that can magnify the object you are looking at on your slide.
Answer: objective lenses
Revolving Nosepiece or Turret: This is the part that holds two or more objective lenses and can be rotated to easily change power. Objective Lenses: Usually you will find 3 or 4 objective lenses on a microscope. They almost always consist of 4X, 10X, 40X and 100X powers.
Explanation:
any 2 advantage of dry cell
Answer:
please make me brainalist and keep smiling dude I hope you will be satisfied with my answerExplanation:
The advantages of a dry cell:
Dry cell is small in size and light in weight too due to which it can be transported from place to place. There is no risk of leakage of chemicals in a dry cell.Answer:
The compact size of a dry cell makes it suitable for powering small electronic devices. ( toys, flashlights, portable radios, cameras, hearing aids). The electrolyte used in dry cells is relatively not so harmful to the environment.
Explanation:
hope this helps
synovial joints are considered very weak joints because of the great range of motion they allow. which of the following structures helps to stabilize a synovial joint?synovial joints are considered very weak joints because of the great range of motion they allow. which of the following structures helps to stabilize a synovial joint?synovial fluidarticular cartilageligamentsfibrous capsule
Synovial joints are considered very weak joints because of the great range of motion they allow ligaments.
While synovial joints do allow for a wide range of motion, they can be stabilized by ligaments, which are strong bands of connective tissue that connect bones to each other and help to limit excessive movement at the joint. The fibrous capsule also helps to stabilize the joint by enclosing the joint and providing additional support, while the synovial fluid lubricates the joint and helps to reduce friction during movement. The articular cartilage covers the surfaces of the bones where they meet at the joint, providing a smooth surface for the bones to glide against each other.
To know more about Synovial joints
brainly.com/question/5847359
#SPJ4
one surprising aspect of the immune system is that individuals make responses against human tissues from different individuals, causing serious problems for organ and tissue transplantation. the basis for this immune response is:
The basis for this immune response is the major histocompatibility complex (MHC) in the immune system.
What is the major histocompatibility complex?The major histocompatibility complex (MHC) is a gene complex that encodes cell surface molecules that are necessary for the acquired immune system to identify foreign antigens, usually proteins from invading microorganisms, and to distinguish them from self-antigens. This complex also plays a critical role in histocompatibility, or the compatibility of tissues and organs transplanted from one individual to another. Because MHC genes are highly polymorphic, meaning they vary greatly between individuals, they can be used to differentiate individuals and populations.
In humans, the major histocompatibility complex is also known as the human leukocyte antigen (HLA) system. There are three types of MHC genes, with classes I, II, and III. Classes I and II are critical for immune responses, while class III genes are involved in immune system regulation and other functions. MHC class I molecules are expressed on the surface of almost all nucleated cells and present peptides derived from intracellular proteins, while MHC class II molecules are found mainly on professional antigen-presenting cells such as dendritic cells, macrophages, and B cells, and present peptides derived from extracellular proteins.
Therefore, the immune system response against human tissues from different individuals is because of the major histocompatibility complex (MHC) in the immune system.
Here you can learn more about major histocompatibility complex (MHC)
https://brainly.com/question/29525257#
#SPJ11
1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.
Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.
What is the difference between transcription and translation in DNA?Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.
During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.
Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.
To demonstrate these processes, let's take the following DNA segment as an example:
DNA sequence: TACAGCGACGCGTATCGAGG
Transcription:
The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).
Template DNA strand: ATGTCGCTGCGCATACTCC
The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).
mRNA sequence: AUGUCGCUGCGCAUACUCCG
Translation:
The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.
AUG-UCG-CUG-CGC-AUA-CUC-CG
Using the genetic code table, we can determine the amino acid sequence of the protein:
AUG: Methionine
UCG: Serine
CUG: Leucine
CGC: Arginine
AUA: Isoleucine
CUC: Leucine
The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.
Learn more about transcription and translation at: https://brainly.com/question/11214205
#SPJ1
what serves as an emulsifying agent for fats in the small intestine?
In the small intestine, the emulsification of fats is essential for their digestion and absorption. Bile salts serve as the primary emulsifying agent for fats in the small intestine.
Bile salts are amphipathic molecules, meaning they have both hydrophilic (water-loving) and hydrophobic (water-fearing) regions. This unique structure allows bile salts to interact with both water and fat molecules, making them effective emulsifiers.
When fat enters the small intestine, bile salts are secreted by the liver and released into the duodenum, the first part of the small intestine. The bile salts then interact with the fat molecules, breaking them down into smaller droplets and suspending them in the watery intestinal contents.
This increases the surface area of the fat droplets, making them more accessible to digestive enzymes, such as pancreatic lipase, which can break them down further into smaller fatty acids and glycerol molecules that can be absorbed by the small intestine.
Therefore, bile salts play a critical role in the digestion and absorption of dietary fats in the small intestine, by emulsifying them into smaller droplets that can be more efficiently digested by pancreatic lipase and absorbed by the intestinal cells.
To learn more about intestines
https://brainly.com/question/1751875
#SPJ4
Animal cells have a cell membrane.
The cell membrane protects the cell from its surroundings.
Combine the sentences into one sentence.
The cell membrane, also called the plasma membrane, is found in all cells and separates the interior of the cell from the outside environment. The cell membrane consists of a lipid bilayer that is semipermeable. The cell membrane regulates the transport of materials entering and exiting the cell.
what types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele? (check all that apply.)
The types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele are:
A) frameshift mutationB) silent mutationC) missense mutationF) addition of 2 ntG) addition of 1 ntFrameshift mutations occur when nucleotides are added or deleted from a DNA sequence, causing a shift in the reading frame during translation. This results in a completely different amino acid sequence from the original, often resulting in premature termination or an elongated protein.
Addition of 2 nt or 1 nt can also cause a frameshift mutation, leading to a longer protein. These mutations occur when one or two nucleotides are added to the DNA sequence, shifting the reading frame during translation.
Silent mutations, missense mutations, substitution mutations, deletion of 2 nt, deletion of 1 nt, and splice site mutations do not necessarily result in a larger protein, as they typically involve changes to individual nucleotides or small sections of the DNA sequence.
To learn more about mutations, here
https://brainly.com/question/30696458
#SPJ4
The complete question is:
What types of gene mutations can result in proteins that are larger (longer polypeptide chains) than the protein produced by the normal allele? (check all that apply.)
A) frameshift mutationB) silent mutationC) missense mutationD) substitution mutationE) deletion of 2 ntF) addition of 2 ntG) addition of 1 ntH) deletion of 1 ntI) splice site mutationsLooking at the cross between a heterozygous and a homozygous dominant animal for the trait of hair color below. Black hair is dominant (B) to white hair (b). If the father has the genotype of (BB) and the mother has the genotype (Bb), describe how you would complete the Punnett square and then describe what the possible offspring's hair color could be based on the punnett square.
In complete dominance the dominant allele hides the expression of the recessive allele. Genotype: 50% homozygous dominant BB. 50% heterozygous Bb. Phenotype: 100% black hair.
What is complete dominance?
Complete dominance is an inheritance pattern that occurs when the dominant allele of a gene masks the expression of the recessive allele. This is evident in heterozygous individuals who carry both alleles and only express the dominant phenotype.
In the exposed example, B (black hair) is dominant over b (white hair)
Cross: father x mother
Parentals) BB x Bb
Gametes) B B B b
Punnett square) B B
B BB BB
b Bb Bb
F1) Genotype:
1/2 = 50% of the progeny is expected to be homozygous dominant BB
1/2 = 50% of the progeny is expected to be heterozygous Bb
Phenotype: 100% of the progenny is expected to express black hair
You can learn more about complete dominance at
https://brainly.com/question/1953851
#SPJ1
a kind of mutation that can change every amino acid that follows the point of mutation is called ?
A frameshift mutation is a type of mutation that can alter every amino acid that follows the point of mutation. It occurs when a single nucleotide is inserted or deleted within a gene sequence. This insertion or deletion alters the reading frame of the gene, resulting in a different sequence of amino acids which can have serious consequences.
For example, if a single nucleotide is inserted, the amino acid sequence will be shifted forward by one codon, resulting in a completely different protein product.
Similarly, if a single nucleotide is deleted, the amino acid sequence will be shifted backward by one codon, resulting in a completely different protein product. Frameshift mutations can cause a wide range of problems, from minor phenotypic changes to complete loss of function.
For example, a frameshift mutation in a gene that codes for a hormone receptor could lead to the cell not being able to recognize the hormone, resulting in the cell not performing its usual function. As such, frameshift mutations can have serious consequences and can result in serious diseases.
Know more about frameshift mutation here
https://brainly.com/question/14364090#
#SPJ11
which term is used to describe an individual with characteristics different from others in the same population?
The term used to describe an individual with characteristics different from others in the same population is "outlier."
An outlier is an observation that is significantly different from other observations in a dataset. Outliers can occur due to various reasons, such as measurement errors, sampling errors, or genuine differences in the population. In statistics, outliers can have a significant impact on the overall interpretation of data, as they can skew the results and affect the accuracy of statistical analysis.
Therefore, it is important to identify and handle outliers appropriately to ensure the validity and reliability of statistical analysis.
To learn more about outlier refer to:
brainly.com/question/26958242
#SPJ4
What are the advantages and disadvantages of solar panels?
Please help due today i will mark brainlist
Answer:
Advantages of Solar Energy Disadvantages of Solar Energy
Reduces Electricity Bills Weather Dependent
Diverse Applications Solar Energy Storage is Expensive
Low Maintenance Costs Uses a Lot of Space
Technology Development Associated with Pollution
Explanation:
ADVANTAGES:
1. Solar energy is a renewable energy. So it means that it can be recycled and reused over and over again. It also have unlimited supply as It is obtained from the sun directly.
2. Solar energy can Help you to cope up with your bills. And be more considerate about electrical energy. It is cheap to maintain.
3. Solar energy is also considered as a renewable energy because it is non pollutant meaning it does not harm the environment in any ways.
DISADVANTAGES:
1. The initial cost for instalment is very high. Though it is not very recommendable for everyone.
2. It is weather dependent. Meaning it will not provide Energy in rainy or cloudy days.
3. Solar panels are not suitable for all kinds of rooftops so it needs a special place to be installed in.
Think about the long sections of peeled celery. Did you see what you thought you would see? Based on what you observed, what can you conclude about the movement of water through the celery stalk? Explain your reasoning. (8 points)
Since it has many xylem tubes in the stalk and so quickly absorbs water, celery is a useful plant for illustrating capillary action. The light green foliage will change to a reddish and blue hue.
How does water flow within a celery stalk?Permeability motion be demonstrated by flow of water through celery. Both plants and people depend on capillary movement. Water travels upward from the plant's root system through stems to the leaves and branching. The nutrients and minerals that the plant requires for growth are present in the water that travels through the stem.
What was the celery experiment's outcome?The experiment also with celery stick indicates that this occurs using specialized tubes, known as xylems, which absorb the food colouring. Celery leaves' poration speeds up the process, and you may speed it up even more by blow drying the leaves.
To know more about capillary visit:
https://brainly.com/question/15471683
#SPJ1
What transfers DNA to the ribosome?
Answer: mRNA
Explanation: Messenger RNA
which is a true statement about ribosomes? multiple choice polyribosomes are the subunits of ribosomes. ribosomes are active in carbohydrate synthesis. ribosomes contain dna and protein. ribosomal subunits leave the nucleus after being formed by the nucleolus. ribosomes are only found associated with the endoplasmic reticulum in prokaryotic cells.
Answer:
there
Explanation:
Ribosomal subunits leave the nucleus after being formed by the nucleolu
Ribosomes are composed of two subunits, the large and small subunits, which are produced in the nucleolus of the nucleus. The true statement about ribosomes is ribosomal subunits leave the nucleus after being formed by the nucleolus.
Ribosomes are responsible for protein synthesis in the cell. After their formation, the ribosomal subunits leave the nucleus and come together in the cytoplasm or on the endoplasmic reticulum to form functional ribosomes.
This process allows ribosomes to carry out their role in protein synthesis throughout the cell. The other statements in the options are not accurate.
Therefore, the true statement is ribosomal subunits leave the nucleus after being formed by the nucleolus.
For more information regarding ribosomes, visit:
https://brainly.com/question/9333250
#SPJ6
what was the most significant conclusion that gregor mendel drew from his experiments with plants quilzet biology chapater 14
The most significant conclusion that Gregor Mendel drew from his experiments with plants was that heredity is determined by discrete units called genes.
Genetics is the scientific discipline that examines how characteristics are passed from one generation to the next. It also analyses the mechanisms underlying these processes. Gregor Mendel, an Augustinian monk, established the groundwork for genetics with his work on pea plants, which he published in 1866.
Mendel's key conclusion was that heredity is determined by discrete units called genes, which occur in pairs. These genes are passed from one generation to the next in a predictable manner, obeying the principles of probability. In addition, Mendel discovered that these genes may be dominant or recessive in their expression.
According to Mendel's model, these genes combine in a predictable manner during reproduction, with each parent contributing one of two possible versions of a gene to their offspring. This interaction creates the genetic diversity seen within and between populations.
Learn more about genetics here:
https://brainly.com/question/30459739
#SPJ11
Although solar energy could supply all of the world's energy needs, why isn't it used to do so
There are several reasons why solar energy is not currently used to supply all of the world's energy needs: Cost, Infrastructure, Weather-dependent, Energy storage, and Political and economic factors.
Cost: The initial cost of installing solar panels and other solar technologies can be expensive, which can be a barrier for many people and countries.
Infrastructure: Solar energy requires a significant amount of land and infrastructure to be effective. It can be difficult to find suitable locations for solar farms, and there can be resistance from local communities to large-scale solar installations.
Weather-dependent: Solar energy production is dependent on the availability of sunlight, which can be affected by weather patterns such as clouds, rain, and snow. This can make solar energy less reliable than other forms of energy production.
Energy storage: Solar energy production can exceed demand during peak production times, which means that energy storage solutions are needed to provide power during times when sunlight is not available.
Political and economic factors: The fossil fuel industry has significant political and economic power, which can make it difficult to transition to renewable energy sources like solar.
To know more about solar energy here
https://brainly.com/question/9704099
#SPJ4
g he estrous cycle has 4 phases. the first phase is called estrous . during this phase the stimulates the developments of follicles and the follicular cells secrete . this hormone stimulates the production of and the thickening of the endometrium. when reaches a peak, and ovum is released. this phase is called
The hormone stimulates the production of cervical mucus and the thickening of the endometrium. When estrogen reaches a peak, an ovum is released in a process called ovulation. This phase is called estrus.
Most mammalian species, including domestic animals like cows, pigs, and horses as well as some wild species, have an estrous cycle, which is a reproductive cycle. The female reproductive system undergoes a number of hormonal and physical changes over the course of the cycle, which are what define it.
Proestrus, estrus, metestrus, and diestrus are the four phases that make up the estrous cycle. Each phase is distinguished by particular physiological and hormonal changes that get the female ready for sex and potential pregnancy.
Proestrus is the first stage of the estrous cycle. The follicular cells in the ovaries emit the hormone oestrogen during this period, which promotes the growth of follicles.
To know more about estrous click here
brainly.com/question/9531456
#SPJ4
you count 42 yeast cells in one 'foursquare' volume on your hemocytometer. what is the concentration of cells in that sample? g
The concentration of cells in that sample is [tex]1.05[/tex]× [tex]10^6[/tex] cells/mL.
We are given that, The number of yeast cells = 42
Volume of hemocytometer = Foursquare volume.
Now, The concentration of cells in the sample is the number of cells divided by the volume. We'll use the following formula:
Concentration = Number of cells / Volume
In this case, the volume is in a foursquare. The volume of a hemocytometer square is usually 1/25 of the whole surface area of the hemocytometer.
We know that the area of the hemocytometer is 9 mm × 9 mm or 81 mm².
Therefore, the area of each square is 1/25th of 81 mm², or 3.24 mm².
The volume of each square is equal to the depth of the chamber, which is usually 0.1 mm, multiplied by the area. This equals 0.324 cubic mm.
1 cubic mm = 1/1000 mL = 1/1000 × [tex]10^-^6[/tex] L = [tex]10^-^9[/tex] L
So, the volume of the square is 0.324 × [tex]10^-^9[/tex] L
The concentration can now be calculated as follows:
Concentration = Number of cells / Volume
= 42 cells / 0.324 × [tex]10^-^9[/tex] L
= 42 / 0.324 x [tex]10^-^9[/tex]cells/mL
= 1.05 x[tex]10^6[/tex] cells/mL.
Therefore, the concentration of yeast cells in the given sample is 1.05 ×[tex]10^6[/tex] Cells/mL.
To know more about Cells refer here :
https://brainly.com/question/13920046
#SPJ11
what would probably happen to a male elephant that doesn’t have tusks?
Tusks are used to fight Elephants. A tuskless elephant's survival chances would be less due to competition.
What is competition in an ecosystem?Competition in an ecosystem refers to the interactions between organisms that compete for the same resources, such as food, water, shelter, or mates. These resources are often limited in availability. As a result, organisms that depend on them must compete with other members of their species or with other species.
Competition can occur within a species, known as intraspecific competition, or between different species, known as interspecific competition.
Tusks serve a variety of purposes for male elephants, including fighting for dominance, attracting mates, and foraging for food. Male elephants without tusks may face challenges in a particular area. They may have to depend more heavily on other means of communication and foraging, such as vocalizations and using their trunks to gather food.
Learn more about the competition, here:
https://brainly.com/question/8911564
#SPJ2
all are characteristics of erythrocytes except: group of answer choices makes up large percentage of total blood cells lacking a nucleus or mitochondria involved with carrying oxygen to body cells high surface area to volume ratio due to biconcave disk shape integral to inflammatory and immune responses
All are characteristics of erythrocytes except: integral to inflammatory and immune responses. The correct option is e.
Erythrocytes, also known as red blood cells, are one of the three types of blood cells that are found in the human body. These blood cells are the most numerous of all the blood cells, comprising about 40-45% of the total volume of blood, and they are unique in shape, structure, and function.
The erythrocytes are characterized by the following:
Group of answer choices that makes up a large percentage of total blood cells
Lacking a nucleus or mitochondria
Involved with carrying oxygen to body cells
High surface area to volume ratio due to biconcave disk shape
Integral to inflammatory and immune responses
The fifth option given in the question, integral to inflammatory and immune responses, is not a characteristic of erythrocytes. This is because erythrocytes do not have any role in the inflammatory and immune responses, as they lack the organelles necessary for carrying out these processes. Instead, these responses are carried out by other types of blood cells, such as leukocytes or white blood cells, which are specialized in this function.
Therefore, the correct answer to this question would be option E, "integral to inflammatory and immune responses."
Here you can learn more about Erythrocytes
https://brainly.com/question/16794540#
#SPJ11
6. Cells combine with similar cells to form_______?
A big cell
O Organ
O Tissue
All of the above
Tissue.
Explanation:
Cells combine with similar cells to form Tissue.
Answer:
Tissue cells.
Explanation:
Similar cells, when combined together, form tissues, and similar tissues in turn form as part of a organ. When there are multiple organs inside a organism, it would be generally termed as a organ system.
~
Learn more about tissues, here:
https://brainly.com/question/13308565
what of the following statements best characterizes general intelligence during adolescence?
Adolescence is characterised by five main traits: bodily growth and development, an undefined position, greater decision-making, increased pressures, and the search for oneself.
Intelligence remains constant, but the underlying brain processes that support intelligence dramatically advance. Adolescence has been defined as the time in a person's life when they are no longer children but also not quite adults. An individual goes through significant physical and psychological changes during this time. Also, the teenager goes through changes in social expectations and beliefs. Sexual maturation goes hand in hand with physical growth and development, frequently resulting in romantic partnerships.
Adolescence, the stage of life between childhood and adulthood, is difficult and marked by observable changes in one's physical appearance, mental health, emotional state, social interactions, and behavioural patterns.
Learn more about Adolescence here:
https://brainly.com/question/3501577
#SPJ1
during transcription, on which strand will rna polymerase be located? during transcription, on which strand will rna polymerase be located? on the coding strand on the template strand it depends on the orientation of the gene
During transcription, RNA polymerase will be located on the template strand.
The template strand is the complementary strand of DNA that is used as a template to create a complementary RNA molecule.
The coding strand, also known as the sense strand, is the strand of DNA that has the same sequence as the RNA transcript (with T replaced by U). However, RNA polymerase does not bind to this strand during transcription.
The orientation of the gene is also not relevant to the location of RNA polymerase during transcription. RNA polymerase will always bind to the template strand of DNA and use it as a template to create a complementary RNA molecule.
Learn more about RNA polymerase here:
https://brainly.com/question/30564448
#SPJ11
what was esther lederberg was able to demonstrate with her replica plating experiments wileyplus
Lederberg's replica plating experiments provided important evidence for the existence of spontaneous mutations in bacteria, and helped to lay the foundation for the field of bacterial genetics.
Esther Lederberg was able to demonstrate the presence of spontaneous mutations in bacteria using her replica plating experiments. In her experiments, Lederberg took a bacterial culture and made several copies of it on different agar plates.
She then exposed each plate to a different condition, such as an antibiotic, to see if any bacteria would grow under that condition. She found that some bacteria would grow on certain plates but not on others, suggesting that they had acquired a resistance to the specific condition being tested.
Lederberg then used replica plating to transfer bacteria from the original plate to a new plate without exposing them to any conditions, and found that some of the bacteria still grew on the plates that they previously could not. This indicated that some bacteria had spontaneously acquired mutations that allowed them to survive under the new conditions.
To know more about replica plating here
https://brainly.com/question/27334956
#SPJ4
what is the term for metabolic pathways that release stored energy by breaking down complex molecules? group of answer choices bioenergetic pathways thermodynamic pathways catabolic pathways anabolic pathways
The term for metabolic pathways that release stored energy by breaking down complex molecules is catabolic pathways. The correct answer is option c.
What are metabolic pathways?A metabolic pathway is a linked series of chemical reactions occurring in a cell that metabolizes a specific molecule or group of molecules. A metabolic pathway is controlled by enzymes that transform specific molecules into various components of the cell.
Catabolic pathways: A catabolic pathway is a metabolic pathway that breaks down complex molecules into simpler ones. The degradation of complex molecules, such as polysaccharides, lipids, and proteins, produces energy in living organisms.
Catabolism is a set of metabolic pathways that decompose molecules into smaller and more readily usable forms of energy. This catabolic method releases energy, which can then be used to produce adenosine triphosphate (ATP).
Some examples of catabolic pathways are the breakdown of glucose during cellular respiration and the breakdown of lipids during beta oxidation. The correct answer is option c.
To know more about metabolic pathway refer to-
brainly.com/question/30367723#
#SPJ11
true or false? according to bill gates's talk, covid-19 could be the last pandemic if we take the right steps?
It is FALSE that according to Bill Gates's talk, COVID-19 could be the last pandemic if we take the right steps.
While Bill Gates has talked about the importance of taking steps to prevent future pandemics, he has not made a definitive statement that COVID-19 could be the last pandemic. In fact, he has emphasized that the world needs to be prepared for the possibility of future pandemics, as viruses can emerge unexpectedly and rapidly spread across the globe. Gates has advocated for investing in disease surveillance and research, developing vaccines and therapeutics, and improving global cooperation to better respond to future outbreaks.
To know more about COVID-19
brainly.com/question/30975256
#SPJ4