Answer:
D. Agricultural runoff
Explanation:
How are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Answer:
I don't know
Explanation:
I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?
1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.
Hold on, our servers are swamped. Wait for your answer to fully load.
Which of the following factors would make the smallest contribution to determining the climate of an ecosystem?
a.
precipitation patterns
b.
ocean currents
c.
geographic features such as mountain ranges
d.
magma under the earth's crust
Answer:
Latitude. ...
Elevation. ...
Ocean Currents. ...
Topography. ...
Vegetation. ...
Prevailing winds.
И a whole
•
The cell of
an elephant will be not be larger than that of an ant give reasons?
Answer:
Explanation:
The cell of an elephant will be not be larger than that of an ant.
This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.
So the cell of the elephant will not be larger than that of an ant.
Hope it helps!
Please mark as brainliest!
PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or
Answer: ?
Explanation:
Describe how the picture below represents the function of the immune system
Answer:
The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.
Explanation:
Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
Answer:
i dont know i need points
Explanation:
Nondisjunction that occurs during meiosis II produces what?
Answer:
Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.
During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?
a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance
Answer: Characteristics acquired during an organism's life are generally not passed on through genes.
Explanation:
The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.
What are acquired traits?Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.
For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.
Therefore, the correct option is A.
Learn more about Traits here:
https://brainly.com/question/24886772
#SPJ6
Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.
Answer:
To save itself.
Explanation:
The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.
What do decomposers leave behind after getting their energy?
А
chlorophyll and vitamins
B
carbon dioxide and water molecules
C С
elements like carbon, nitrogen and phosphorus
D
energy-rich carbohydrates
Q
Answer:
Carbon and nitrogen
Explanation:
Decomposers gain energy and nutrients and energy by breaking down dead organisms and animal waste. Through that process they release nutrients. Which are carbon and nitrogen. To give nutrients to the ecosystem.
Answer:
carbon and dioxide,nitrogen and phosphorus
Explanation:
it's right 100% did the ap3x quiz
PLEASE HELP I NEED HELP (Plant related / Project stuff)
Answer:
B, D, A, E, C
Explanation:
1. environmental factors
2. growth
3. adaptation
4. organism
5. genetic factors
I don’t have a lot of time please help!
No websites or links.
Don’t answer it if you don’t now. Thanks
The transfer of heat is responsible for many of the events that occur on Earth. Which of the following events is most directly caused by radiation from the Sun?
the circulation of air
the warming of Earth’s surface
the movement of ocean currents
the movement within Earth’s mantle
Answer:
the circulation of air
Explanation:
air is from a sun
In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine
Answer:
31%
Explanation:
Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If
G = 19% then C= 19%
19% + 19% = 38%
100% - 38% = 62%
62% for A and T
Divide by 2 and you get
31%
Is this person male or female? Why? :l
Answer:
I think Female because hey aren't any Y chromosomes
hope this helps
have a good day :)
Explanation:
how does rock turn into soil
Answer:
Rocks turn into soil through the process of weathering.
Explanation:
Weathering is when rocks are broken down into smaller pieces
When uncontrolled, the cell cycle becomes cancer. It forms lumps called..?
Answer:
Tumours are groups of abnormal cells that form lumps or growths. They can start in any one of the trillions of cells in our bodies.
Explanation: (:
Answer:
It forms lumps called tumors.
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.
c) Explain why wheat is not able to grow well in
nitrate poor soil.
Answer:
When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to
Help me please! Do 1,2,3 by filling in the blank!!!!
and no website
REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?
Answer:
carries the blood components throughout the body
Explanation:
plasma is the largest part of your blood.
Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations
Answer:
OA increased soil aeration due to an increase in earthworm populations.
Answer:
it is B. decreased rainfall due to a prolonged period of drought
Explanation:
trust me i got it right on my quiz
Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.
Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.
Answer:
I'm in school I'll help you when get home around 4:30
In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?
Both of these
Genetic Drift
Founder Effect
None of these
Answer: Both of these
Explanation: trust me
All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat
Answer:
A) population
Explanation:
Answer:
A. population
Explanation:
for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"
for example, on a map, you may see population of a certain species for square mile.
Who ever Answer this right will get brainliest
Answer:
See Explanation
Explanation:
Pathogens are disease causing organisms in the body. They attack diverse cells, organs, tissues and systems in the body thereby causing them to malfunction (to become diseased).
Antibodies are the body's natural protective mechanism against pathogens. Antibodies engulf these pathogens and digest them. Then they produce certain chemicals called antitoxins which now destroy the toxins produced by these pathogens in the body.
Also they activate the systems involved in fighting pathogens by punching the cell wall of invading pathogens.
what was explained by darwins theory of biological evolution
Answer:
When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.
Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.
Explanation:
What was explained by it? Evolution. But how did it explain evolution? That is in the answer.
when are chromosomes (dna) copied?
Answer:
Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.
Have a good day. :)
Answer:
Chromosome replication
Explanation:
Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.
Explain how biotechnology has used the idea of ‘cut and paste’ when it comes to biotechnology *not multiple choice question*
Answer:
Biotechnology, the use of biology to solve problems and make useful products. The most prominent area of biotechnology is the production of therapeutic proteins and other drugs through genetic engineering. ˗ˏˋ ❤︎ ࿐
Explanation:
Someone’s help me please
Answer:
trailmix
Explanation: