Answer:
It involves facilitated diffusion.
Explanation:
Facilitated diffusion uses channel proteins. Channel proteins allow substances to travel through a membrane going with the gradient. Since active transport goes against the gradient, facilitated diffusion would not be a characteristic of it.
please help me, 50 points
What type of bond are the arrows pointing to below in the picture
Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline
3- Scissors are an example of a complex machine.
Answer:
A :3
Explanation:
Just did acceleratted ed. Hope this helps!
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answer:
1 and 5
Explanation:
https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question
Answer:
1.ATTAGC(ATACTAC)GGGC
5. ATGAATGC(ATACTACC)GGGC
What does “denature” mean in terms of protein structure?
Explanation:
Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.
NEED ASAP
Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.
Answer:
D
Explanation:
The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.
Consider the plant cells in the image below. What is a function of the cell structure that is labeled x?
Answer:
c) It provides support to the plant
Answer:c
Explanation:
What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry
Answer:
THE ANSWER is B
Explanation:
i need to poop
Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.
Answer:
New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.
Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures. One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body. Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.
Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage (Arbogast, 1995). The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance. CHL is the most common chlorophyll derivative used for cancer related studies (Chernomorsky, 1999). Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies (Sarkar, 1994). CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer (Arbogast, 1995).
Explanation:
Hope this is what you wanted.
Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune
In the outer layer of the sun, energy is transported outward by the rising of hot plasma and sinking of cooler plasma. This transfer is known as
Answer: Convection.
Explanation:
We have 3 types of heat transmission.
Radiation: Heat is transported as electromagnetic waves, this is not the case shown here.
Conduction: When we have two objects with different temperatures and we put them in contact, the system will want to go to equilibrium (both objects have the same temperature) so the hot object will give heat to the cooler object. We usually see this with solid objects.
Convection: It is the heat transfer due to the bulk movement of the molecules, so this need a material medium (it can not take place in solids, because the position of the molecules is fixed in the solids).
Then the rising of hot plasma and sinking of cooler plasma is convection.
Please put the following in order from Least Inclusive to MOST inclusive...
Organs Molecules Organ Systems
Organism Cells Tissue
A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs
Choose one carbon sink and explain how the carbon gets out of it.
Answer::
Explanation:
What’s the answer ????????
Answer:
D: Electrons are transferred from one atom to another.
Explanation:
Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.
Hope this helps!
A cell membrane has permeability, which means that the membrane:
Answer:
transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.
Explanation:
I barley know what your trying to say
science is so confusing to me!
Select all answers that are correct.
If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:
the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself
Answer:
second one.
Explanation:
not sure but it's the only answer that goes with the other laws
what are thylakoids? I will give BRAINLIEST!!
Answer:
each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.
Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.
Explanation:
Answer:
They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).
Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT
Answer:
it's B
Explanation:
A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.
What is Yo-yo?Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.
By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.
Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.
To learn more about Total energy of the system, refer to the link:
https://brainly.com/question/478253
#SPJ5
The field of Astronomy is not related to technology
O True
False
Answer:
false
i hope this helps and goodluck!
Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell
Answer:
a controls what enters and leaves the cell
Explanation:
which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.
Answer: Its A.
Explanation:
None
The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.
What is force?A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.
The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.
Learn more about force, here:
https://brainly.com/question/13014979
#SPJ5
A location's weather depends on...
Question 1 options:
A. temperature
B. clouds
C. precipitation
D. all of the above
Answer:
D
Explanation:
its obvious
Answer:
D all of the above
Explanation:
The temperature is the heat or cold in the weather.
The clouds can change the temperature in the weather.
Precipitation is what most people think of when you say weather.
Example of reproduction
Answer:
a deer giving birth to a baby deer
What are the differences between the Big Bang Theory and the Steady State Theory?
Answer
One is a move and the other is a part of a state.
Explanation:
Answer:
The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.
What problems can pseudoscience cause for society?
Answer:
It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?
… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.
The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.
Cells are the basic unit of life. Some cells are single-celled organisms and others
are specialized to do a specific function for an organism. Even though cells are
structurally different depending on the organism, all cells have this in common?
A. The presence of nucleic acid
B. The absence of a nuclear envelope
C. The presence of a cell wall
D. The absence of ribosomes
Answer:
A. The presence of nucleic acid
Explanation:
At what temperatures can monarch fly?
Answer:55 degrees
Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.
Answer:
Temperatures need to be above 55 degrees Fahrenheit.
Explanation:
Match each mineral property to the correct description.
crystal system
the ability to attract certain metals
cleavage
the number and angle of crystal faces
magnetism
the ability of a mineral to break along flat
surfaces
fracture
an irregular way of breaking apart
fluorescence
the ability to produce a visible glow
Answer: here you go hope this helps
Explanation:
Matching each mineral property to the correct description is:
crystal systemthe number and angle of crystal faces
cleavagethe ability of a mineral to break along flat surfaces
magnetismthe ability to attract certain metals
fracturean irregular way of breaking apart
fluorescencethe ability to produce a visible glow
A mineral property are those things that make up or characterize a mineral. For example, things like crystal forms, luster, color, etc are all ways to recognize a mineral.Read more here:
https://brainly.com/question/6736830
Which of the following is caused by bad genes? *
Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague
Explain the law's of segregation and independent assortment.
Answer:
The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.
Explanation:
I know it late but can u plz mark me brainliest?
Dependence and Addiction are the
same thing?
a. True
b. False
Answer:
b
Explanation:
one is a necessity, the other is a struggle