The streak of iridium in the Earth's crust in Wyoming indicates a time when Earth was bombarded by asteroids of the following are possible explanations for the strange occurrence of iridium in the Earth's crust in Wyoming
Is iridium one of the most scarce metals found in the crust of the Earth?Only rhenium, ruthenium, and rhodium are rarer elements than iridium, which is the fourth rarest element in the Earth's crust. Yet, between the Cretaceous and Paleogene geological eras, 65 million years ago, Luis Alvarez and his team of researchers discovered a strange thin layer of iridium-rich clay in 1980.
Both its melting temperature and density are quite high. The substance with the greatest resistance to corrosion is iridium.
learn more about iridium
https://brainly.com/question/28882711
#SPJ1
what fluid is found at the base of the petals
What is the term for the process by which mRNA is used to make a protein?
The term for the process by which mRNA is used to make a protein is "translation".
Translation is a key process in gene expression, whereby the sequence of nucleotides in mRNA is read and used to synthesize a protein. During translation, the mRNA is read by ribosomes, which use the sequence of nucleotides to assemble a specific sequence of amino acids into a protein. The sequence of amino acids determines the structure and function of the protein, and ultimately its role in the cell or organism.
The process of translation involves a complex series of steps, including the recognition and binding of mRNA by ribosomes, the selection and assembly of amino acids, and the folding and modification of the protein. Understanding the process of translation is essential for understanding the fundamental workings of cells and organisms, and has important implications for fields such as biotechnology and medicine.
Definition: Meat extract, Yeast extract, Peptone (pepsic, tryptic and papainic), Agar-Agar ,gelatin Please help me necessary
Answer:
Explanation:
Meat extract: Meat extract is a concentrated meat stock that is made by boiling meat in water and then straining out the solids. The resulting liquid is then further processed to produce a thick, flavorful extract that is used as a base for soups, gravies, and other dishes.
Yeast extract: Yeast extract is a natural flavoring made from yeast cells that have been broken down using enzymes or heat. It is commonly used as a flavoring agent in soups, stews, sauces, and other savory dishes.
Peptone: Peptone is a complex mixture of amino acids that is produced by the partial hydrolysis of proteins. It is commonly used as a nutrient source in microbiology and biotechnology applications.
Agar-Agar: Agar-Agar is a gelatinous substance derived from red algae. It is commonly used as a gelling agent in food and pharmaceutical products.
Gelatin: Gelatin is a protein that is derived from collagen, which is found in the connective tissue of animals. It is commonly used as a gelling agent in food products such as jellies, marshmallows, and gummy candies.
What observation proves that a cell is a eukayote?
3. Circle the words that correctly complete the sentences.
•The individuals selected for breeding have certain traits, which are determined
by [alleles/engineering].
• The alleles for selected traits become [less/more] common in a population as
its genetic diversity [decreases/increases].
The individuals selected for breeding have certain traits, which are determined by alleles.
• The alleles for selected traits become [more] common in a population as its genetic diversity decreases
What are alleles?Alleles are different versions of a gene that exist at the same location (locus) on a chromosome. Each individual inherits two copies of each gene (one from each parent), and therefore two alleles at each locus.
Alleles may differ in their DNA sequence, resulting in differences in the physical or functional characteristics of the trait they control. For example, the gene for eye color has different alleles that produce brown, blue, or green eyes.
The combination of an individual's alleles at a particular locus is known as its genotype, and the physical expression of the genotype is called its phenotype.
learn about Alleles here https://brainly.com/question/23516288
#SPJ1
In dragons, blue horns
(B) are dominant to
yellow horns (b).
What percent of these
offspring would have
yellow horns?
50%
75%
0%
25%
The answer is 25 percent
Transcribe and translate the following strands of DNA. Then answer the questions about protein synthesis.
1. DNA: TACCATCGATTGGAAGACCTTAACGAGCTAACT
mRNA:
amino acids:
2. DNA: CTGTTACTTTCAATCGTACACCAACACTGCTTTC
mRNA:
amino acids:
Answer:
so I don't know this one but will tell you how to solve it.
Explanation:
During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.
Which of the following is not a common reason why individuals or groups use the ocean to dump our garbage?
Companies opt to save money by using ocean dumping.
Governments have limited funds for proper garbage disposal.
Ocean waters increase the rate of decomposition of garbage.
Landfills or incineration are not possible for a town or city.
Answer: Ocean waters increase the rate of decomposition of garbage.
Explanation: I took the quiz
Suggest why it is very difficult to eradicate an introduced species,
once it has settled into a new place.
Answer: This is because they might not have any predators or there NATURAL ENVIROMENT IS DIFFICULT to find or destroy
Explanation:
What is speciation? Describe the three things required.
Speciation is the evolutionary process by which new species arise from existing ones.
What is speciation?Speciation occurs when a group of organisms becomes reproductively isolated from the rest of their population, preventing gene flow between the two groups.
There are three key requirements for speciation to occur:
Genetic isolation: This occurs when a group of individuals becomes separated from the rest of their population, either geographically or ecologically, and is prevented from interbreeding with them. This can lead to the accumulation of genetic differences between the two groups.
Genetic divergence: Once genetic isolation occurs, the two populations can begin to evolve separately. This can happen as a result of genetic drift, natural selection, or other evolutionary mechanisms, leading to the accumulation of genetic differences between the two groups.
Reproductive isolation: Over time, the genetic differences between the two groups may become so pronounced that members of the two populations are no longer able to interbreed successfully, even if they are brought back into contact with one another.
Learn more about speciation at: https://brainly.com/question/2113835
#SPJ1
Unit 9 Study Guide - The Restless Earth Science. I NEED ANSWERS ASAP!!!!!!! PLEASE ANSWER!!! PLEASE HURRY!!!! PLEASE ANSWER ALL 21!!!! THERE ARE 21 QUESTIONS PLEASE ANSWER THEM ALL AS SOON AS YOU CAN!!!!!!!!!!!!!!!!!
The image is a graph showing the trend of global temperatures over the past century, based on data collected from various sources. The graph indicates that global temperatures have been steadily rising since the 1900s, with the past few decades showing a particularly sharp increase.
What is the graph's primary trend?The main trend shown in the graph is the steady increase in global temperatures over the past century, with a particularly sharp increase in the past few decades. This trend is a cause for concern as it indicates that the Earth's climate is changing at an unprecedented rate.
What factors contribute to the increase in global temperatures?The increase in global temperatures is primarily caused by human activities that release greenhouse gases, such as carbon dioxide, into the atmosphere.
These gases trap heat from the sun, leading to a warming effect on the Earth's surface. Other factors that contribute to the increase in global temperatures include deforestation, industrial activities, and transportation.
To know more about global temperatures,visit:
https://brainly.com/question/9089155
#SPJ1
-. Two genes-pointy-ness of chin and pointy-ness of nose-have the following
alleles: P = pointy chin, p = round chin, N = round nose, n = pointy nose. A man
with a pointy chin and pointy nose mates with a woman with a round chin and
ound nose and produces a child with a pointy chin and round nose. What are all
he possible genotypes for this child?
2. Inhumans, short fingers (F) and widow's peak (W) are dominant over long
ingers (f) and straight hairline (w). A heterozygote for both genes reproduces
with a similar heterozygote. What is the chance of any one child having the same
phenotype as the parents?
The possible genotypes for the child are: Pn and pn from the descriptions in the question.
What are the possible genes?To determine this, we can use a Punnett square. The man has the genotype PPnn (pointy chin and pointy nose), and the woman has the genotype ppNN (round chin and round nose).
The offspring genotype possibilities are PNn, PnN, Pnn, and pnn. However, we are told that the child has a pointy chin and a round nose, so the only possible genotypes for this phenotype are Pn and pn.
Therefore, the child could have the genotype Pn (pointy chin, round nose) or pn (round chin, pointy nose).
Learn more about genes:https://brainly.com/question/8832859
#SPJ1
the relaxed pairing at the blank position of the codon and the blank position of the anticodon are blank and blank to follow the traditional base pair rules. this allows for a single trna to recognize multiple codons.
The relaxed pairing at the third position of the codon and the first position of the anticodon are wobble and able to follow the traditional base pair rules. This allows for a single tRNA to recognize multiple codons.
Relaxed pairing at the third position of the codon and the first position of the anticodon refers to the ability of the genetic code to tolerate non-standard base pairing between these positions during translation. Specifically, the third position of the codon (also known as the wobble position) can form non-Watson-Crick base pairs with the first position of the anticodon, allowing a single tRNA molecule to recognize and bind to multiple codons that differ only in this position. This phenomenon expands the coding capacity of the genetic code and helps to optimize the efficiency of protein synthesis.
To know more about protein synthesis
brainly.com/question/29763759
#SPJ4
3. The amount of nitrogen in the soil, water, and air have become unbalanced because
a. fish produce too many nitrates.
b. human beings have destroyed too many plants.
c. human beings use too many fertilizers.
d. human beings grow crops that don't use very many nitrates.
Nitrogen is actually considered the most vital thing for assisting plant growth. Nitrogen is part of the chlorophyll molecule, which gives plant life their green shade and is involved in developing food for the plant thru photosynthesis.
Lack of nitrogen indicates up as familiar yellowing (chlorosis) of the plant.
What are the fundamental motives of nitrogen loss from the soil?Image end result for three The quantity of nitrogen in the soil, water, and air have turn out to be unbalanced due to the fact a. fish produce too many nitrates. b. human beings have destroyed too many plants. c. human beings use too many fertilizers. d. human beings grow crops that do not use very many nitrates.
Nitrogen can be misplaced from agricultural lands via soil erosion and runoff. Losses thru these occasions commonly don't account for a giant portion of the soil N budget, however should be regarded for surface water fine issues.
Learn more about nitrogen soil, water here;
https://brainly.com/question/20848502
#SPJ1
4. If one parent of a couple has Huntington's disease (assume that this parent is
heterozygous), calculate the fraction of their children that would be expected to
develop the disease. What if both parents were heterozygous?
If one parent of a couple has Huntington's disease , 50 percent of their children that would be expected to develop the disease if both parents were heterozygous.
What is Huntington's disease ?Huntington's disease is a brain condition in which brain cells, or neurons, in specific areas of the brain begin to degrade. As the neurons degenerate, the illness can cause hormonal disturbances, cognitive decline, and uncontrolled movements. Huntington's disease is a hereditary condition. It is handed down from generation to generation. If one of the parents has Huntington's disease, the child has a 50% risk of developing it as well. If the child does not contract the disease, he or she will not pass it on to their offspring. There is no family history of Huntington disease in 1% to 3% of individuals who have the disease.
What is heterozygous condition ?In genetics, heterozygous means having received different versions (alleles) of a genomic marker from each biological parent. As a result, a person who is heterozygous for a genomic marker has two distinct forms of that marker.
To know more about Huntington's disease , visit ;
brainly.com/question/12572808
#SPJ1
30. What is the potential where a cell membrane must be more positive than negative to initiate an impulse?
A.action potential
B.stimulus
C.threshold potential
D.membrane potential
The threshold potential is the value at which a cell membrane must be more positively charged than negatively charged in order to produce an impulse.
Threshold potentialThe threshold potential is a crucial depolarization level that must be attained in order for a neuron to initiate an action potential or nerve impulse.
Voltage-gated ion channels in the membrane of a neuron open when the membrane potential reaches the threshold potential, enabling an influx of positively charged ions into the cell.
The result is a fast depolarization of the cell membrane, which generates an action potential that travels the entire length of the neuron.
It's crucial to understand that the threshold potential varies depending on the kind and location of the neuron, in addition to other elements like temperature and the presence of toxins or medications.
learn more about impulse here
https://brainly.com/question/477839
#SPJ1
Why are two primers necessary for pcr amplification to work?
Answer:Two primers are utilized, one for each of the complementary single strands of DNA released during denaturation. The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the complementary strand of DNA (the sense strand).
Explanation:
Circle the correct words to complete the sentences.
• Human insulin is now made with a biotechnology called [genetic
engineering/selective breeding].
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell.
•After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin.
Answer:
Human insulin is now made with a biotechnology called [genetic engineering/selective breeding]. (Genetic engineering)
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell. (Copy, a bacterial)
• After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin. (bacterial, bioreactor)
What is the purpose of the digestive enzymes found in the synaptic cleft?
The synaptic cleft does not contain any digesting enzymes. Neurotransmitters are released into the synaptic cleft, a tiny space between neurons, to carry messages from one neuron to the next.
What function do enzymes serve in the synaptic cleft?Certain neurotransmitters are broken down by synaptic enzymes, which are found in the synaptic cleft. A synapse is the junction of two neurons where neurotransmitters carry information.
In the synaptic cleft, what enzyme is present?A type-B carboxylesterase enzyme called acetylcholinesterase is largely found in the synaptic cleft, with a minor amount being present in the extrajunctional region. The muscle secretes acetylcholinesterase, which is kept bound to it by collagen linked to the basal lamina.
To know more about synaptic cleft visit:-
https://brainly.com/question/6346282
#SPJ1
06. A deer population increases in size from 2000 to 2300 individuals over one year. Calculate the growth rate of the population during this time interval. (3mks)
Answer:
15%
Explanation:
(2300 - 2000) / 2000 = 15%
steps
To calculate the growth rate of the deer population during this time interval, we need to use the following formula:
Growth rate = (final population size - initial population size) / initial population size
Plugging in the given values, we get:
Growth rate = (2300 - 2000) / 2000
Growth rate = 0.15 or 15%
Therefore, the growth rate of the deer population during this time interval is 15%
chatgpt
B. Mark True or False statements
4. If all seeds fall under the parent plant they will grow into very healthy plants.
An organism has a total of 32 chromosomes. What is the organism's diploid number? ______ Haploid number ______
Answer:
16 hap rest
Explanation:
Do you think the adaptations of the animal you chose are a result of its environment, genes, or both? Explain your answer.
Answer:
The adaptations are result of both the environment and genes. Animal develop adaptive characteristics in response to their environmental challenges. These adaptations help the animals survive in their environment. The animals are more likely to reach reproductive age. So,these adaptive traits are more likely to be passed on to offspring.In the case of cheetahs,tan coloring,conservation of water, and fast legs are traits that help them survive in the savanna. These traits,like all the other characteristics of cheetahs,are genetically passed from parents to offspring.
Explanation:
if it helped you please mark me a brainliest :))
ASAP!!!A scientist designed an experiment to test where a plant's matter came from. She
measured the starting mass of a willow tree, the soil, and the container. After five
years, she repeated the measurements and observed that the tree gained 74 kg (164
lbs) but the soil had not changed much at all (only lost 57 g, approximately 0.12 lbs).
1. Use evidence, from the results, to explain that the idea that the mass of a tree
comes from the soil, is incorrect. 2 points
2. Why is it incorrect to say that the tree's mass comes from sunlight? 1 point
3. If the mass of the tree does not come from the soil or sunlight, explain the trees
increase in mass. 2 points
Explanation:
The fact that the soil did not change significantly after five years, while the tree gained 74 kg, suggests that the tree's mass did not come from the soil alone. If the tree had gained all its mass from the soil, the soil would have lost an equivalent amount of mass, which did not occur. Therefore, this evidence suggests that the mass of a tree does not come solely from the soil.
While sunlight is necessary for photosynthesis, which allows the tree to produce glucose, the mass of a tree does not come directly from sunlight. Rather, the tree uses the glucose produced during photosynthesis to build its own tissues, such as leaves, branches, and roots. Therefore, while sunlight is necessary for the tree to grow, it is not the source of the tree's mass.
The tree's increase in mass is primarily due to the process of photosynthesis. During photosynthesis, the tree uses energy from sunlight to convert carbon dioxide and water into glucose, which it then uses to build new tissues. Additionally, the tree may have also taken up nutrients, such as nitrogen and phosphorus, from the soil, which it incorporated into its tissues. However, it's important to note that the majority of the tree's mass comes from the carbon that it takes up during photosynthesis, rather than the nutrients in the soil.
Which describes this landform?
anticline
shearing
syncline
tension
Answer:
since there is no picture we cannot help you but ive seen this question before with a picture and it was C. syncline
Explanation:
Answer: c. syncline
Explanation:
39. Imagine that you are at the local fitness center and see a bunch of girls from your school. So, you try to impress them by doing bicep "curls". What is the correct sequence for how your nervous system tells your
muscles to move and "curl" the weight?
1.motor neuron-brain-spinal cord-muscle
2. brain-spinal cord-motor neuron-muscle
3.muscle- motor neuron-spinal cord-brain
4.brain-motor neuron-spinal cord-muscle
The correct sequence for how your nervous system tells your muscles to move and "curl" the weight is:
Brain-spinal cord-motor neuron-muscle; option 2.
What is the correct sequence for how your nervous system tells your muscles to move and "curl" the weight?The movement of the bicep "curls" is initiated by the brain, which sends a signal down the spinal cord to the motor neuron.
The motor neuron then transmits the signal to the muscles in the bicep, causing them to contract and move the weight.
This sequence of events is known as the motor pathway and is responsible for voluntary movement in the body.
Learn more about nervous system at: https://brainly.com/question/869589
#SPJ1
The basic unit of life is a cell. A student is studying for an exam comparing structure and functions of a plant cell and an animal cell. The student has to be able to identify the different organelles and the most likely location. Which type of proposed model would be best for the student to utilize in their studies and why?
A) The student should utilize a mathematical model comparing the percent of types of organelles in each so that they understand
the amount in each type of cell.
B) The student should utilize a hand-held size physical model of each type of cell so that they are able to see and compare the types
and locations of the organelles and how the organelle’s functions relate.
C) The student should utilize microscopic slides with real animal and plant cells so that they are able to identify the organelles and
location in a real cell and not a pretend one.
D) The student should utilize a model of the human body and plant so that they can understand how the cells of each type work with
the rest of the structure.
E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Answer: E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Explanation:
Structurally, plant and animal cells are very similar because they are both eukaryotic cells. They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, golgi apparatus, lysosomes, and peroxisomes. Both also contain similar membranes, cytosol, and cytoskeletal elements.
Both animal and plant cells have mitochondria, but only plant cells have chloroplasts.
Animal cells have centrioles, centrosomes (discussed under the cytoskeleton), and lysosomes, whereas plant cells do not. Plant cells have a cell wall, chloroplasts, plasmodesmata, and plastids used for storage, and a large central vacuole, whereas animal cells do not.
The different types of plant cells include- collenchyma, sclerenchyma, parenchyma, xylem, and phloem.
One way to discourage food sovereignty would be to:
Please choose the correct answer from the following choices, and then select the submit answer button.
Answer choices
promote local control of land, seeds, and other needed agricultural resources.
encourage food growth for export.
value food providers' right to live and work with dignity.
recognize that solutions must be place-based.
Answer:
Encouraging food growth for export would be one way to discourage food sovereignty
Explanation:
.This is because if the focus is on exporting food, it may lead to a situation where the domestic market is neglected, and food production is not geared towards meeting local needs. This could result in food shortages and make the local population dependent on imported food. In such a scenario, the control over food production and distribution would lie with external forces rather than local communities, which goes against the idea of food sovereignty.
If given: two solutions separated by a semi-permeable membrane. One side is 15% solute and the other is 30% solute. In what direction will water move?
Answer: Water will likely move to the 30% side to balance out the substance.
Explanation: In osmosis, water always move to wherever there is more solutes so that the solution is balanced out with an equal amount of solutes on both sides of the semi-permeable membrane.
Site-specific recombination is catalysed by:
DNA polymerase
Integrases
Gyrases
Topoisomerases
Answer: B
Explanation:
Site-specific recombination is catalyzed by integrases.