Which correctly describes malignant tumors?

Answers

Answer 1

Answer:

Malignant means that the tumor is made of cancer cells, and it can invade nearby tissues. Some cancer cells can move into the bloodstream or lymph nodes, where they can spread to other tissues within the body—this is called metastasis.

Answer 2
Malignant tumors is a cancer cells
Cancer cells are cells which when it divides it divides more than the needed cell as it causes didorder

Related Questions

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

Answers

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

Identify the type of system used for mass production. Tommy owns a toy factory and uses a in which all the machines and workers at workstations process each manufactured item in the same order. This system is suitable for mass production.

Answers

Pretty sure it’s assembly line :)

A Maximum-Minimum thermometer has two stems which record the highest and lowest temperatures during a period of time. A small metallic piece in each stem indicates the temperature. A. 55o C, 35o C, 45o C B. 45o C, 25o C, 35o C C. 55o C, 25o C, 35o C D. 45o C, 25o C, 30o C 4. M

Answers

Answer:

The correct option is A: 55° C, 35° C, 45° C

Explanation:

The Six's thermometer is a device to record maximum and minimum values of temperature within a given period of time. It is a glass tube in a U shaped manner that contains mercury, which is dependent on the expansion of alcohol in order to register a maximum reading. It is made use of for the purpose of meteorology, horticulture etc.

The metallic piece in each stem indicates the temperature of 45°C, 25°C, 35°C. That is option B.

A maximum-minimum thermometer is an instrument used to measure both the minimum and maximum temperature of a given area for a period of time.

The maximum-minimum thermometer is used in the following fields:

Horticulture: This is useful in the sustainable production of cultivated food and ornamental plants as temperature of the area in use needs to be monitored.

Meteorology: This is useful in this field to monitor the temperature of different locations.

The range for a maximum-minimum thermometer is -30°C to 50°C.

Therefore, the metallic piece in each stem will indicate the temperature of 45°C, 25°C, 35°C which is within the range.

Learn more about thermometers here:

https://brainly.com/question/25034625

Classify the following organisms into their respective kingdoms (i) Yeast (ii) Penicillium (iii) Rhizobium (iv) Mushroom (v) Amoeba (vi) fish

Answers

Answer:

(i) Yeast- Kingdom Fungi

(ii) Penicillium- Kingdom Fungi

(iii) Rhizobium- Kingdom Eubacteria

(iv) Mushroom- Kingdom Fungi

(v) Amoeba- Kingdom Protista

(vi) fish- Kingdom Animalia

Explanation:

Living organisms were classified into a large group called KINGDOM, which represent the largest and most generic grouping consisting of organisms that share a few similarities. The kingdoms that living organisms were classified into are as follows: Plantae, Animalia, Fungi, Protista, Eubacteria, Archaebacteria, etc.

Based on the question, the mentioned organisms are classified into the following kingdoms:

(I) Yeast: Yeast is a unicellular microbe classified under the Kingdom Fungi due to possession of chitin in its cell wall and other similar features with members of kingdom Fungi.

ii) Penicillium- Penicillium is a genus classified under the Kingdom Fungi.

(iii) Rhizobium- Rhizobium is a genus of prokaryotic organism (lack membrane-bound nucleus and organnelles) classified under the Kingdom Eubacteria.

(iv) Mushroom- Mushrooms are saprophytic (heterotrophic) species of organisms classified under the Kingdom Fungi.

(v) Amoeba- Amoeba is a genus of unicellular eukaryotes classified under the Kingdom Protista.

(vi) fish- Fishes are organisms classified under the Kingdom Animalia

Which of the following answers correctly lists the four main types of macromolecules?

A.
DNA, RNA, triglycerides, water

B.
Monosaccharides, water, DNA, triglycerides

C.
Water, oxygen gas, ammonia, carbon

D.
Carbohydrates, lipids, proteins, nucleic acids

Answers

Answer:

D. carbohydrates, lipids, proteins, and nucleic acids

[tex]hope \: it \: helps[/tex]

Answer:

D

Explanation:

They are the main types of macromolecules

Question
Select the correct answer.
Which of the following conditions would likely lead to the slowest rate of weathering?
a dry, temperate region with few hills or valleys
a steep mountain in a region with a cold climate
a hilly region that receives heavy, acidic precipitation
a region with heavy rainfall, where temperatures vary greatly
Submit

Answers

The condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly.

What is weathering?

Weathering simply refers to the deterioration of rocks, soils and minerals substances through contact with water or even biological organisms.

So therefore, the condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly

Learn more about weathering:

https://brainly.com/question/2341950

SPJ1

Answer:

A dry temperate region with few hills or valleys

Explanation:

this is right on plato

Why do hurricanes lose strength once they reach the land?
O A. Hurricanes can't replenish their water from the ground.
B. Hurricanes gain strength from the warmth of the ocean water.
C. Hurricanes lose strength when they reach a warm front on land.
D. Friction with the ground stops hurricane spinning.

Answers

Answer: b

Explanation: cause hurricanes gain strength from water

Hurricanes lose strength once they reach the land because hurricanes gain strength from the warmth of the ocean water. The correct answer is option B.

A hurricane is a large, rotating storm that forms over tropical or subtropical waters. Hurricanes are characterized by strong winds, heavy rain, and storm surges, which can cause significant damage and loss of life.

Hurricanes gain strength from the warmth of the ocean water. This is why hurricanes tend to lose strength once they reach land. When a hurricane is over the ocean, it draws its energy from the warm water, which causes the air to rise and creates a low-pressure area. This low-pressure area then draws in more warm, moist air from the surrounding area, which fuels the hurricane and causes it to intensify.

Once a hurricane moves over land, it loses its source of warm water and can no longer draw in the moisture it needs to maintain its strength. This causes the hurricane to gradually weaken and dissipate.

Since, hurricanes gain strength from the warmth of the ocean water, it loses its source of warm water and eventually its strength. Option B is the correct answer.

Learn more about hurricanes here:

https://brainly.com/question/33034641

#SPJ6

Which of these statements best sums up evolution?
rapid change in species’ habits and features
rapid development of vestigial structures in a species
change in a population through new species being made
change in a population through genetic variation over time

Answers

Answer:

change in a population through genetic variation over time

Explanation:

took the test

Briefly explain what was done in the experiment where pigeons could choose which button to peck in the Skinner box. How does this relate to self-control?

Answers

In this experiment, Skinner placed a pigeon inside a box that contained a button that when pressed released water or food. This pigeon went through periods of deprivation of water and food, but over time, he realized that when he pecked the button he had access to these two elements. Skinner called this behavior operant behavior, which is the behavior that occurs controlled by its consequences.

Although Skinner did not specifically study self-control, with this experiment, we can make a connection between operant behavior and self-control, since both are behaviors shown as a way to change the environment in which they are inserted, but this change also affects them.

In the process of urine formation:_____.
a. first filtrate is formed, then tubular fluid, then urine.
b. tubular fluid is formed, then filtrate, then urine.

Answers

Answer:

b i think is your answer

Explanation:

2. Exocrine glands, such as sweat glands, secrete fluids
glands secrete hormones directly into the bloodstrea
3. The _______ gland plays an important role in puberty
4. Epinephrine, triggering the "fight or flight" response
glands, which sit on top of the kidneys.
5. Most glands that secrete hormones operate using fe
When hormone concentrations are high, the gland w
the hormone.
6. Many cells produce chemicals called_____ hormon
impact inflammation and reproduction.
7. The gland that helps regulate growth, body temperat
lod the

Answers

Answer:

pituitary gland

Prostaglandins

oestrogen and testosterone

Explanation:

The pituitary gland plays an important role in puberty. Puberty refers to the time in which a boy or girl sexually mature. Many cells produce chemicals called Prostaglandins hormone which impact inflammation and oestrogen and testosterone are the hormones which is responsible for the maturation of eggs in female and sperm in male. these hormones plays a vital role in the growth and development of human body.

Answer:

1.Hormones

2. endocrine

3. pituitary

4. adrenal

5. less

6. prostaglandins

7. thyroid

8. Steroidal hormones enter the cell directly and interact with DNA inside the nucleus. These hormones change gene expression, affecting the RNA that is produced and the proteins that are translated in a cell. Nonsteroid hormones do not enter the cell. Instead, they bind to specific receptors on the outside of the cell membrane. This triggers molecules called secondary messengers, such as cAMP, to begin their work of relaying information in the cell, where other chemicals, messengers, and proteins are involved to create a cellular response.

Explanation:

Penn Foster

Hemoglobin is the blood protein responsible for the transport of oxygen. Carbon monoxide disturbs oxygen transport by

Answers

Answer:

Answered below

Explanation:

Hemoglobin is found in the red blood cells and is responsible for the transportation of oxygen from the lungs to the various body cells.

Oxygen binds to hemoglobin because it has a high affinity for it. This aids its transportation. When it gets to the cells it unbinds and get transported into the cell for use in energy production.

Carbon monoxide is an odourless, dangerous gas which has more affinity for hemoglobin than oxygen. Therefore when carbon monoxide is inhaled, it quickly binds to hemoglobin, thereby displacing oxygen. It binds to hemoglobin for a longer period and due to this, the body does not get any oxygen and cells begin to die.

Symptoms of carbon monoxide poisoning include dizziness, headaches, fatigue and coma.

HELP ASAP DUE NOW PLSSS HELP 10 points and brainlist Which arrows show matter moving from a producer to an omnivore? Select all that apply.

Answers

Answer:

my best guess is number answer 2 and answer 4

because crows love to eat desert woodrats and for the last one i watched it in national geo, its like a cycle grass hopper died by a mouse dies by a rattle snake.

what is a protron needed for

Answers

Answer:

Function in the atom

Explanation:

The protons inside an atom's nucleus help bind the nucleus together. They also attract the negatively charged electrons, and keep them in orbit around the nucleus. The number of protons in an atom's nucleus determines which chemical element it is.

describe how a cell acquires the O2 the cell needs for its metabolic processes and how a cell gets rid of the CO2 that is doesn't need and can actually be harmful to the cell?

Answers

Answer:

Cells absorb oxygen and release CO2 via the bloodstream. Please find below detailed explanation

Explanation:

Oxygen and carbondioxide (CO2) are the major gaseous substances involved in celluar respiration. Aerobic celluar respiration, which is the process by which cells obtain energy, requires oxygen to occur. The oxygen initially gets breathed in as a constituent of air, which later passes through air sacs and gets attached to hemoglobin in red blood cells. Hemoglobin transports oxygen throughout the cells of the body.

After the process of celluar respiration is done, carbondioxide (CO2) is released back into the bloodstream, which carries it to the lungs. The CO2 is released when we breathe out.

Cilia in cells along the trachea ad nasal passage secrete blank which traps dirt and particles from the air

Answers

Answer:

Yes it secretes blank to trap and particles from the air

CH 7 What will be the effect if a
toxin make a pore ( o ) in the
inner membrane of the
mitochondria​

Answers

Answer:

Mitochondria is known as the powerhouse of the cell as it provides energy to the cell for performing different functions.

If a toxin causes pore in the inner membrane of the mitochondria and  increases the permeability of the mitochondrial membranes. The permeability of mitochondrial membranes leads to mitochondrial swelling and causes cell death through necrosis and apoptosis.

Which type of organism developed first?

Answers

al

answer: algae

explanation: because the were the first ones to adapt with water and land...

3. List the molarities at which water exited the potato strips. Why did water move out of the potato strips? Were these solutions hypotonic, hypertonic, or isotonic?

Answers

Answer:

The water came out of the strips of the potatoes because a process of balance and oxygen balance called osmosis occurs.

Explanation:

The potato was subjected to a hypertonic environment and it is considered hypotonic, that is why the water seeks to go out to the outside in order to generate that it finds a balance in relation to a solvent solvent.

A teenager throws a 7.26 kg rock into a lake, trying to make a big splash. If the rock is travelling at a speed of 7.5 m/s, how much kinetic energy does the rock have?

Answers

Explanation:

K.E = 1/2mv²

1/2 x 7.26 x 7.5²= 204.19j

Which statement best describes the relationship of photosynthesis and energy? 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose. 2.The process of photosynthesis is energy-releasing because the process converts light energy into free energy that can be used for cell functions. 3.The process of photosynthesis is energy-conserving because no energy is used throughout the process of forming glucose and oxygen molecules. 4.The process of photosynthesis is energy-wasting because photosynthesis is an inefficient process that depletes the cell of energy stored in the bonds of glucose.

Answers

Answer:

3 is appropriate statement that describes photosynthesis

the correct answer for this question is 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose.

The possibility of magnifying contaminating sequences present in a nucleic acid pool is a drawback associated with PCRs high level of sensitivity (i.e., potential for exponential amplification).
A. True
B. False

Answers

Answer:

True

Explanation:

The Polymerase Chain reaction (PCR) is a technique widely used in molecular biology to identify specific DNA fragments generally in a size range of 100 to 1000 base pairs (bp). PCR sensitivity refers to the potential of the PCR technique to specifically amplify the desired sequence in the sample. PCR is a highly sensitive (and also specific) method with values around 100% if the experimental conditions are proper. However, to reach these values, it is imperative to work in optimal conditions by eliminating contaminant factors in the sample which may alter PCR amplification.

The type of teeth seen in blank are usually broad and flat

Answers

Answer:

Molars

Explanation:

Molars are the teeth furthest back in our mouth. Their broad, flat surfaces help grind food as we eat...

hope this answer correct :)

Assume that white color is dominant over yellow color in squash. If pollen from the anthers of a heterozygous white-fruited plant is placed on the pistil of a yellow-fruited plant, show using ratios the genotypes and phenotypes you would expect the seeds from this cross to produce. 1. Genotypes 1/2 Ww 1/2 Ww 1:1 ratio | Phenotypes All white 1:0 ratico
2. Genotypes 1/2 wW 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio
3. Genotypes- 3/4 Ww 1/4 ww 1:1 ratio | Phenotypes 3/4 white 1/4 yellow- 1:1 ratio
4. Genotypes-1/2 ww 1/2 ww = 1:1 ratio l Phenotypes-1/2 white 1/2 yellow-1:1 ratio

Answers

Answer:

2. Genotypes 1/2 Ww 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio

Explanation:

This question involves a single gene coding for fruit color in squash. The allele for white color (W) is dominant over the allele for yellow color (w).

If a heterozygous white-fruited plant (Ww) is crossed with a yellow-fruited plant (ww), the following gamete combinations will be produced by each parent:

Ww- W and w

ww- w and w

Using these gametes in a punnet square (see attached image), offsprings with genotypes: Ww and ww will be produced in the ratio 1:1

(1/2) Ww will be phenotypically white-fruited

(1/2) ww will be phenotypically yellow-fruited

Hence, the seed offsprings of this cross will possess:

Genotypes 1/2 Ww, 1/2 ww in 1:1 ratio

Phenotypes 1/2 white, 1/2 yellow in 1:1 ratio

In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled “Environmental Hypotheses of Hominin Evolution.” In his paper, Potts claimed that great variations in environmental conditions over time were responsible for the adaptability of humans and the success of our species. Which would most likely be found in his paper?

Answers

This question is incomplete because the options are missing; here is the missing section:

Which would most likely be found in his paper?

A. A review of modern human anatomical structure.

B. Evidence of changing environmental conditions, with references.

C. The reasons competing hypotheses are wrong.

D. His opinion of what will happen to the survival of the human race.

The answer to this question is B. Evidence of changing environmental conditions, with references.

Explanation:

In texts such as scientific articles, the central point is expressed by the main claim or hypothesis as this is supported and explained through evidence in the articles. This means Potts article focuses on the environmental changes and how these contributed to the human species adaptability.

Due to this, it is expected the article explains the changes in environmental conditions, and the connection of these to adaptability. Moreover, because this is a scientific article all ideas should be supported with evidence collected by the author including references to other reliable sources. Thus, "evidence of changing environmental conditions, with references" is expected to be found in this article.

Answer: B

Explanation: I took the test :)

What are the different alleles available for the cross shown in this Punnett square? a and a A and a A and A

Answers

Answer:

A and a

Explanation:

Answer:

b

Explanation:

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the ________ muscle.

Answers

Answer:

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the Longissimus muscle

Explanation:

The Longissimus is a group made of three muscles: longissimus capitis, longissimus cervicis and longissimus thoracis. It has the length of the vertebral column.

It is placed in the back, and as the statement says, it originates on the sacrum and transverse of each vertebra. Each of them originates at the transverse elements and insert in the costal ones.

Shelly, an eight-year-old child from a low-income family, is displaying symptoms such as growth failure, diarrhea, and pneumonia. Which of the following is Shelly most likely suffering from?
a. Iron deficiency
b. Folate deficiency
c. Iodine deficiency
d. Vitamin A deficiency
e. Zinc deficiency

Answers

Answer:

The correct answer is e.

Explanation:

Zinc is an essential intracellular trace element most abundant in the human body, which participates in important structural and catalytic regulatory functions, it is an integral part of many tissues, being essential for the synthesis of biomolecules such as DNA and proteins, as well as for degradation of the same. The deficiencies of any nutrient may be due to a decrease in its intake, an increase in the body's needs and therefore, its requirements, or a decrease in the bioavailability of the nutrient due to the way in which it is found in food. Zinc deficiency causes multisystemic, sometimes fatal, manifestations if not detected and corrected early. Symptoms of severe zinc deficiency are slowing or disruption of growth and development, delayed sexual maturation, characteristic skin rashes, chronic and severe diarrhea, impaired immune system, poor wound healing, loss of appetite, decreased sensitivity to the touch, night blindness, inflammation, opacity of the corneas and behavioral problems.

Which of the following sources would be most likely to have reliable data

Answers

What are the options we are working with?

how many lactobacillyus present in 1 lire of curd packet

Answers

A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.

hope it helps

Other Questions
Alguien que sepa cmo se resuelve sto que me ayud a solucionarlo,es urgente,doy 25 puntos The best advice for setting a study session is Write these numbers in standard form 0.000 05 A brochure describing the benefits of a product to the target audience is an example of which type of document?a design briefa design critiquea design mediuma design proposal Find each product.1. (5a3b)(2ab)2.5y(-y2+7y-2)PLEASE HELP!!?! The marked price of a mobile set is Rs3500 and the shopkeeper allows of 10%discount? (I) find the amount of discount. (ii)How much should a customer pay for it after discount. please halp quickly i will give brainliest Suppose GDP consists of wheat and rice. In 2005, 20 bushels of wheat are sold at $4 per bushel, and 10 bushels of rice are sold at $2 per bushel. In 2004, 20 bushels of wheat are sold at $2 per bushel and 10 bushels of rice are sold at $1 per bushel. Using 2004 as the base year, it follows that, for 2005. Group of answer choices Nominal GDP is $100, real GDP is $50, and the GDP Deflator is 50. Nominal GDP is $100, real GDP is $50, and the GDP Deflator is 200. Nominal GDP is $40, real GDP is $100, and the GDP Deflator is 50. Nominal GDP is $50, real GDP is $100, and the GDP Deflator is 200. Currently Baldwin is paying a dividend of $19.69 (per share). If this dividend were raised by $3.64, given its current stock price what would be the Dividend Yield? Consider the inequality x3 + 4x2 - 5x < 0.Select all intervals for which the statement is true.There may be more than one correct answer. Select all correct answers. A solenoid 26.0 cm long and with a cross-sectional area of 0.580 cm^2 contains 490 turns of wire and carries a current of 90.0 A. Calculate: (a) the magnetic field in the solenoid; (b) the energy density in the magnetic field if the solenoid is filled with air; (c) the total energy contained in the coils magnetic field (assume the field is uniform); (d) the inductance of the solenoid. Which metal will react spontaneously with Cu2+ (aq) at 25C?HgMgAgAu On January 1, 2021, the Highlands Company began construction on a new manufacturing facility for its own use. The building was completed in 2022. The company borrowed $2,200,000 at 8% on January 1 to help finance the construction. In addition to the construction loan, Highlands had the following debt outstanding throughout 2021: $9,000,000, 10% bonds $6,000,000, 8% long-term note Construction expenditures incurred during 2021 were as follows: January 1 $900,000 March 31 1,500,000 June 30 1,160,000 September 30 900,000 December 31 700,000Required: Calculate the amount of interest capitalized for 2016 using the specific interest method. John lent 2,550 to Mohan at 7.5 per centper annum. If Mohan discharges the debt after8 months by giving an old black and whitetelevision and 1,422.50. Find the price ofthe television. [Pinocchio's] tears had dried and only hard, dry sobs shook his wooden frame. But these [sobs] could be heard by the faraway hills . . . Carlo Collodi, Pinocchio Which of the following is the concept illustrated with the misentered data? A. The procedure for constructing the confidence interval is not robust. The smaller the sample size, the less resistant the mean. Therefore, the confidence interval is more robust. Question 30 The Royal Fruit Company produces two types of fruit drinks. The first type is pure fruit juice, and the second type is pure fruit juice. The company is attempting to produce a fruit drink that contains pure fruit juice. How many pints of each of the two existing types of drink must be used to make pints of a mixture that is pure fruit juice Read the excerpt from Thoughts and Sentiments. But the whole business of slavery is an evil of the first magnitude, and a most horrible iniquity to traffic with slaves and souls of men; and an evil, sorry I am, that it still subsists, and more astonishing to think, that it is an iniquity committed amongst Christians, and contrary to all the genuine principles of Christianity, and yet carried on by men denominated thereby. Read the excerpt from Letters of the Late Ignatius Sancho, An African. That subject, handled in your striking manner, would ease the yoke (perhaps) of manybut if only of oneGracious God!what a feast to a benevolent heart!and, sure I am, you are an epicurean in acts of charity. In these excerpts, how do both men use God and religion to achieve their purpose? A.) Both men claim that good Christians and enlightened individuals will support the abolishment of slavery. B.) Both men invoke God and use their Christian faith to establish a common ground with their intended audiences. C.) Both men claim that slavery is the utmost of un-Christian practices and that slaveholders are immoral. D.) Both men call on the grace of God to help them make their arguments and to be heard. Agnes, a waitress at a restaurant, suffers severe anxiety attacks when business gets really busy at her job. As a result, she is a very ineffective waitress when the restaurant is crowded. For this reason, she is fired. Maybe her employer could have assigned Agnes to shifts when the restaurant is not busy, but this would have irritated the other waitresses, caused significant scheduling difficulties, and appreciably increased expenses. If Agnes sues the restaurant under the Americans with Disabilities Act (ADA), the restaurant's best argument would be: David is making rice for his guests based on a recipe that requires rice, water, and a special blend of spice, where the rice-to-spice ratio is 15:115:115, colon, 1. He currently has 404040 grams of the spice blend, and he can go buy more if necessary. He wants to make 101010 servings, where each serving has 757575 grams of rice. Overall, David spends 4.504.504, point, 50 dollars on rice.