Some of the areas that undergo substantial structural change during adolescence include:
Prefrontal cortexTemporal cortexParietal cortexFrontal cortexAdolescence is a period characterized by various changes that occur within the human body, including the brain. The brain undergoes various changes, including structural changes in different areas of the cortex.
The prefrontal cortex, for instance, is a critical part of the brain that matures throughout adolescence. During adolescence, the prefrontal cortex undergoes extensive structural changes that help the brain to become more efficient in handling complex cognitive tasks.
The temporal cortex is another critical part of the cortex that undergoes substantial structural changes during adolescence. This area is responsible for handling sound recognition, including speech and music. In adolescents, the temporal cortex undergoes extensive structural changes that help in improving language proficiency.
The parietal cortex is yet another area of the cortex that undergoes substantial structural changes in adolescence. This part of the cortex is responsible for spatial perception, including depth, and plays an essential role in visual and auditory processing.
Finally, the frontal cortex is another critical part of the cortex that undergoes substantial structural changes during adolescence. This area is responsible for controlling executive functions, such as attention, impulse control, decision-making, and emotional regulation.
-------------------------------------
Which areas of the cortex undergo substantial structural change in adolescence? (select all that apply)
Prefrontal cortexTemporal cortexParietal cortexFrontal cortexTo learn more about adolescence refer - https://brainly.com/question/30451097
#SPJ11
what was the first disease shown to be bacterial in origin? what was the first disease shown to be bacterial in origin? cholera malaria yellow fever tuberculosis anthrax
The first disease shown to be bacterial in origin was cholera. It is characterized by diarrhea, vomiting, and dehydration
Cholera is an acute gastrointestinal infection caused by the bacteria Vibrio cholera, which is found in contaminated water or food. In 1854, John Snow, an English physician, concluded that cholera was spread through water contaminated with feces, leading to the first scientific demonstration that a disease was caused by bacteria. This realization was an important milestone in the history of medicine, as it showed that diseases were caused by microorganisms and could be prevented and treated by controlling their environment. Cholera remains an important disease, especially in developing countries, where sanitation is often poor and water-borne diseases are common.
Learn more about Cholera: https://brainly.com/question/3837264
#SPJ11
why is it important to inactivate the bamhi and hindiii restriction enzymes before ligating the fragments?
It is important to inactivate the BamHI and HindIII restriction enzymes before ligating the fragments because these enzymes can cause degradation of the target DNA fragments.
In order to inactivate the restriction enzymes, the reaction mixture should be subjected to high heat (usually 65-70°C) for about 10-15 minutes. The heat denatures the restriction enzymes, inactivating them. The following are the reasons why the inactivation of restriction enzymes is important:
Restriction enzymes (BamHI and HindIII) are used in molecular biology research to cut DNA into smaller fragments, which are then used for a variety of purposes. DNA ligase is used to connect these fragments back together. In the absence of DNA ligase, the fragments remain in their cut form and cannot be used for any further research. In the presence of restriction enzymes, there is a possibility of DNA degradation, which can cause the fragments to become unusable.In conclusion, inactivating restriction enzymes before ligation is important because it prevents DNA degradation, thereby ensuring that the target DNA fragments remain intact and usable.
Learn more about restriction enzyme at https://brainly.com/question/1127662
#SPJ11
a protein on a cell surface that binds to a signaling molecule is an example of which element of cellular communication?
A protein on a cell surface that binds to a signaling molecule is an example of a receptor, which is an element of cellular communication. Receptors are molecules found on the surface of cells that have the ability to recognize and bind to specific signaling molecules, typically hormones or neurotransmitters.
When these molecules bind to the receptor, they initiate a cascade of events inside the cell, ultimately resulting in a cellular response.
Receptors play an important role in cellular communication because they allow cells to respond to specific signals. This is an essential element of cellular communication as it allows cells to respond appropriately to various stimuli. Receptors are also highly specific, meaning that only certain molecules can bind to them. This ensures that cells will respond to the correct signal and allows for highly regulated communication.
Receptors can be further divided into two types: intracellular and extracellular. Intracellular receptors are located inside the cell, and when a signaling molecule binds to them, the signal is transmitted directly to the nucleus where the appropriate response can be initiated.
Extracellular receptors, such as the one mentioned in the question, are located on the cell surface and when a signaling molecule binds to them, the signal is transmitted to the cell membrane where the response is initiated.
In conclusion, a protein on a cell surface that binds to a signaling molecule is an example of a receptor, an element of cellular communication. Receptors are molecules found on the surface of cells that can recognize and bind to specific signaling molecules, allowing cells to respond to specific signals and allowing for highly regulated communication.
To know more about cellular communication refer to-
https://brainly.com/question/22287917#
#SPJ11
do not add any more lactose and watch what transpires. note what happens and why this occurs. how could you re-activate the lacz gene?
The lacZ gene is responsible for the enzyme β-galactosidase which breaks down lactose. When no more lactose is added, the lacZ gene is not activated and the β-galactosidase enzyme does not break down lactose. To re-activate the lacZ gene, you would need to add lactose back in so that the β-galactosidase enzyme is activated and lactose is broken down.
Lactose is a disaccharide sugar composed of glucose and galactose, which is found in milk. Lactose can be hydrolyzed into glucose and galactose through the catalytic action of lactase enzymes. This reaction occurs in the small intestine, and the glucose and galactose are then absorbed and used as energy by the body.
When lactose is present, the lac operon is activated, and the genes involved in lactose metabolism are transcribed into messenger RNA. When lactose is absent, the lac operon is turned off, and these genes are not expressed.
To re-activate the lacZ gene, it is necessary to add lactose or a lactose analog such as IPTG to the culture medium. IPTG is an inducer of the lac operon that does not bind to the repressor protein, allowing the genes involved in lactose metabolism to be expressed even in the absence of lactose.
When lactose is present, the lac operon is activated, and the genes involved in lactose metabolism are transcribed into messenger RNA. When lactose is absent, the lac operon is turned off, and these genes are not expressed.
Therefore, if no more lactose is added to the culture medium, the lac operon will turn off, and the genes involved in lactose metabolism will not be expressed. This occurs because the repressor protein binds to the operator site of the operon, preventing RNA polymerase from transcribing the genes involved in lactose metabolism.
Learn more about lacz gene here:
brainly.com/question/30871045
#SPJ11
which term does not belong in this group? group of answer choices experiential nurture hereditary environmental
Answer:
hereditary
Explanation:
Menu
QUIZ
Ecosystems
What are the characteristics of a healthy ecosystem?
Select each correct answer.
O New species are able to quickly take over resources and reproduce.
O Only one species is able to meet all of its needs.
O Many species are able to interact and meet all of their needs.
O Populations stay at stable levels.
O Only the strongest species successfully compete for resources.
The characteristics of a healthy ecosystem include Many species being able to interact and meet all their needs and populations staying stable. So, the correct answers are (c) and (d).
What is meant by ecosystem?An ecosystem is a community of living organisms, such as plants, animals, and microorganisms, that interact with each other and their non-living environments, such as air, water, and soil. The components of an ecosystem are interconnected and rely on each other for survival.
Can an ecosystem consist of human-made things?Yes, an ecosystem can consist of human-made things. Human activities can create new ecosystems or change existing ones. For example, cities are human-made ecosystems that include buildings, roads, and other infrastructure that interact with human and animal populations and the surrounding natural environment. Agricultural systems, such as farms and plantations, are also human-made ecosystems that can support a variety of plant and animal species.
To learn more about agriculture, visit here:
https://brainly.com/question/31113136
#SPJ9
which of the following characteristics apply to all species in kingdom protista? group of answer choices eukaryotic unicellular heterotrophic possess cell walls aquatic
The following characteristics apply to all species in the kingdom Protista is eukaryotic. All species in Kingdom Protista are eukaryotic, meaning they have a membrane-bound nucleus and other organelles in their cells.
None of the following characteristics apply to all species in the Kingdom Protista:
Heterotrophic: Some protists are heterotrophic (i.e., they obtain their nutrition from other organisms), but some are autotrophic (i.e., they produce their own food through photosynthesis).Possess cell walls: Some protists have cell walls, but not all. Some have cell membranes only.Aquatic: While many protists are aquatic, some are found in soil, or in the bodies of other organisms.Learn more about Kingdom Protista: https://brainly.com/question/15377222
#SPJ11
what does this help explain about genetics. and the change occur in a species over time?
Evolution helps explain how genetic variation arises and how it is passed on from one generation to the next.
How do organisms evolve overtime?As organisms reproduce, mutations and genetic recombination can introduce new genetic variations into a population. Over time, natural selection and other evolutionary forces can act on these variations, leading to changes in the frequency of certain traits within a population.
Evolution also helps to explain how species change over time. As populations accumulate genetic variations and adapt to different environmental conditions, they may become distinct from their ancestors and other related species. This process of speciation can ultimately result in the formation of new species.
Learn more on evolution here: https://brainly.com/question/4207376
#SPJ1
The complete question is:
Evolution is the process by which populations of organisms change over generations. What does this help explain about genetics. and the change occur in a species over time?
Find the amino acid chain that forms from the mRNA sequence DNA
sequence below.
GATCGATACCATTCGGCGCATACTTCG
Answer:
mRNA= CUA GCU AUG GUA AGC CGC GUA UGA AGC
Amino acid chain=LEU ALA MET VAL SER ARG VAL STOP SER
Explanation:
Find the START codon (AUG). Start reading in groups of 3 and check against a codon table. When you get to a STOP (UAA, UAG, UGA) you’ve got that protein strand’s sequence.
if dna contains the code for making proteins, wherein the structure of the double helix do you think the code is found?
DNA contains the code for making proteins. The code in DNA is found in the structure of the double helix in several different ways.
The double helix structure is composed of two strands of nucleotides that are linked together by hydrogen bonds. The code is found in the sequence of nucleotides along each strand of the double helix. The sequence of nucleotides is what determines the genetic code. The genetic code is read in groups of three nucleotides called codons. Each codon codes for a specific amino acid, which is then used to build proteins. In addition to the sequence of nucleotides, the code is also found in the way that the double helix is folded and coiled. The three-dimensional structure of the double helix determines which parts of the DNA are accessible and which parts are not. This, in turn, determines which genes are expressed and which are not. The double helix structure of DNA is a complex structure that contains the code for making proteins in many different ways.
To learn more about DNA :
https://brainly.com/question/16099437
#SPJ11
plant foods that do not provide all nine essential amino acids in proportions needed to synthesize protein adequately are called:
Plant foods that do not provide all nine essential amino acids are called Incomplete proteins.
What are amino acids?
Amino acids are organic compounds that contain both an amine and a carboxylic acid functional group. They are the building blocks of proteins, which are chains of amino acids. There are 20 different amino acids, which are classified according to the structure of their side chains.
Amino acids are important for a number of biological processes, including metabolism, enzyme function, and cellular communication.
Learn more about amino acids here:
https://brainly.com/question/28362783
#SPJ1
why are trees found in areas of high precipitation rather than grasses? why are grasses found in drier areas?
Trees require more moisture than grasses, which is why they are found in areas of high precipitation rather than grasses. Trees are better at storing and utilizing water than grasses, so they can survive in areas with more water. Additionally, trees are able to access water deeper in the soil, allowing them to survive longer periods of drought.
Grasses, on the other hand, can survive in drier areas due to their shallow root systems. Grasses also have specialized leaves that are designed to reduce water loss, and their waxy cuticles help keep moisture in. This allows them to survive in arid environments.
In conclusion, trees require more moisture than grasses, making them better suited to areas of high precipitation, while grasses are adapted to drier climates.
Know more about precipitation here:
https://brainly.com/question/18109776
#SPJ11
in the respiratory system, the movement of respiratory gases in the blood between the lungs and the cells of the body is known as
In the respiratory system, the movement of respiratory gases in the blood between the lungs and the cells of the body is known as gas exchange.
Gas exchange involves two main processes: external respiration and internal respiration. External respiration is the exchange of gases between the lungs and the blood, while internal respiration is the exchange of gases between the blood and the body's cells. The movement of respiratory gases in the blood between the lungs and the cells of the body is known as gas exchange in the respiratory system. During this process, oxygen ([tex]O2[/tex]) is transported from the lungs to the body's tissues and carbon dioxide ([tex]CO2[/tex]) is transported from the body's tissues to the lungs to be exhaled. Gas exchange occurs in the alveoli of the lungs, which are small sacs surrounded by capillaries, where oxygen and carbon dioxide diffuse across their thin walls.
The oxygen diffuses into the blood while the carbon dioxide diffuses out of the blood and into the alveoli to be exhaled. The blood then carries the oxygen to the body's tissues where it is used for cellular respiration, and carries the carbon dioxide back to the lungs to be exhaled.
For more such questions on gas exchange , Visit:
https://brainly.com/question/14685776
#SPJ11
if proteins were composed of ony 12 differnet kinds of amino acis, what would be the smalleat possible codon size in a genetix system witghn 4 differneyt nucleotides
If proteins were composed of only 12 different kinds of amino acids, the smallest possible codon size in a genetic system within 4 different nucleotides would be 2 nucleotides long.
Amino acids are organic compounds that are the building blocks of proteins. There are 20 different types of amino acids that are involved in building proteins. However, proteins can be composed of a single type of amino acid or multiple types of amino acids.
A codon is a group of three nucleotides that specify a particular amino acid. Each codon represents a specific amino acid. There are 64 different codons that can be formed using the four nucleotides (adenine, guanine, cytosine, and uracil) in RNA.
The smallest possible codon size in a genetic system within 4 different nucleotides would be two nucleotides long. If there were only 12 different types of amino acids, then each amino acid would be represented by at least two codons.
Since there are only four nucleotides available in a genetic system, each codon would need to be two nucleotides long to represent at least 12 different types of amino acids.
To know more about amino acids, refer here:
https://brainly.com/question/14583479#
#SPJ4
2. why is it easier for the cell to repair a single-stranded break than a double stranded break on the dna
It is easier for a cell to repair a single-stranded break than a double stranded break on DNA because of the structure of the DNA molecule.
Single-stranded breaks occur when one strand of DNA is separated from the other, which leaves the remaining strand intact and ready for repair. In contrast, double-stranded breaks involve both strands of the DNA molecule being separated and in need of repair. This requires more work for the cell because both strands must be repaired simultaneously.
To repair a single-stranded break, the cell can use the remaining strand as a template to restore the broken strand. However, with a double-stranded break, the cell must piece together both strands from other parts of the DNA molecule. This process is much more difficult, as it requires the cell to find matching pieces of DNA that can be joined together, which can be a time consuming process. Therefore, it is much easier for the cell to repair a single-stranded break than a double stranded break on the DNA.
To learn more about DNA, click here:
https://brainly.com/question/264225
#SPJ11
the pulmonary trunk receives blood from the right ventricle and conducts it toward the lung. the pulmonary trunk is a(n)
The pulmonary trunk receives blood from the right ventricle and conducts it toward the lungs. The pulmonary trunk is a(n) artery.
Pulmonary trunk: The pulmonary trunk is a blood vessel that is responsible for transporting blood from the right ventricle of the heart to the lungs. It is a short, wide vessel that is approximately 5 cm in length and 3 cm in diameter. It divides into left and right pulmonary arteries, which further divide into bronchial arteries and supply oxygen to the lung tissue.
Blood: The blood is a bodily fluid that is responsible for carrying nutrients, oxygen, and other vital substances to the tissues and organs of the body. It also helps in the elimination of waste products from the body.
Right Ventricle: The right ventricle is the lower chamber of the heart that is responsible for receiving blood from the right atrium and pumping it out to the lungs via the pulmonary trunk.
Lung: Lungs are the main organs responsible for breathing. They are a pair of spongy, air-filled organs located on either side of the chest. They are responsible for taking in oxygen and expelling carbon dioxide from the body.
Learn more about right ventricle: https://brainly.com/question/26387166
#SPJ11
the incomplete breakdown of fat that occurs when carbohydrates are not available produces: group of answer choices amino acids. glycogen bodies. ketone bodies. glucose fragments.
The incomplete breakdown of fat that occurs when carbohydrates are unavailable produces ketone bodies.
Ketone bodies are synthesized in the liver when carbohydrate stores are low. The body generates ketones in the liver from fat stores, and they serve as a replacement energy source when blood sugar levels are low.
When glucose (a carbohydrate) is scarce, the body must burn fat to create energy. This breakdown of fat results in the formation of ketones, which can be used later by the body as a fuel source.
In other words, when carbohydrates are unavailable, the body breaks down fat into ketone bodies as a backup energy source. As a result, the incomplete breakdown of fat produces ketone bodies when carbohydrates are unavailable.
Learn more about fat: https://brainly.com/question/29517492
#SPJ11
7. Which of the following organisms could be considered a primary
consumer and a secondary consumer according to the food web?
A. Fox
B. Snake
C. Caterpillar
D. Mouse
why do muscle cells use creatine phosphate instead of glycolysis to supply atp for the first few seconds of muscle contraction
Muscle cells use creatine phosphate instead of glycolysis to supply ATP for the first few seconds of muscle contraction because it is more efficient and quicker to generate energy using creatine phosphate than glycolysis.
What is creatine phosphate?Creatine phosphate, also known as phosphocreatine, is a high-energy compound found in muscle cells. It is used to generate energy by donating its phosphate group to ADP, generating ATP, which can then be used by muscle cells to produce energy. ATP, or adenosine triphosphate, is the energy currency of the body that is necessary for muscle contractions to occur.
The phosphagen system, also known as the creatine phosphate system, is the primary source of ATP for the first few seconds of muscle contraction. The creatine phosphate system produces ATP at a faster rate than glycolysis and does not require oxygen to generate energy, making it the ideal energy source for short, intense bouts of exercise such as sprinting or weightlifting.
Read more about ATP:
https://brainly.com/question/893601
#SPJ11
describe the two laws of inheritance put forward by gregor mendel. for each, also describe how you think modern genetics has clarified or supported these early concepts.
Gregor Mendel proposed two laws of inheritance: the Law of Segregation and the Law of Independent Assortment.
The Law of Segregation states that during gamete formation, pairs of alleles separate so that each gamete receives one allele from each parent.
The Law of Independent Assortment states that genes for different traits are sorted independently of each other during gamete formation.
Modern genetics has supported these early concepts by demonstrating that allele segregation is determined by the number of chromosomes and the law of independent assortment is determined by the genes being on different chromosomes.
To know more about Law of Independent Assortment click on below link:
https://brainly.com/question/29556097#
#SPJ11
the fluid portion of the blood is the: group of answer choices lymphocyte. erythroblast. thymus. plasma.
The fluid portion of the blood is Plasma. The correct answer is (d).
Blood is made up of four main components: plasma, red blood cells, white blood cells, and platelets. Among the four major components, plasma is the most abundant, accounting for approximately 55% of the total volume of blood.
The term “plasma” refers to the liquid component of blood, as well as the complex mixture of proteins and other substances that are dissolved or suspended within the fluid.
Plasma is a clear, yellowish liquid that is mostly made up of water, but it also contains a wide range of dissolved substances such as electrolytes, nutrients, gases, hormones, and waste products.
In addition to the dissolved substances, plasma also contains proteins such as albumin, globulins, and fibrinogen. These proteins play a crucial role in maintaining the body’s fluid balance and transporting other substances throughout the body.
Blood plasma plays an important role in maintaining the body’s homeostasis. It helps to regulate the pH, osmotic pressure, and overall volume of the blood. It also carries vital nutrients and oxygen to the cells and removes waste products and carbon dioxide from the body.
Additionally, plasma contains antibodies and other components of the immune system that help to protect the body against infections and diseases.
In summary, Plasma is the correct answer and is an essential component of the blood that plays a critical role in maintaining the body’s overall health and well-being.
To know more about plasma, refer here:
https://brainly.com/question/18207038#
#SPJ11
please someone help me!!!!
Her conclusion is invalid. Cell A is a eukaryotic cell because it has a nucleus and other membrane-bound organelles. Cell B is a prokaryotic cell because it does not have a nucleus or other membrane-bound organelles.
What are eukaryotic cells and prokaryotic cells?Eukaryotic cells and prokaryotic cells are two types of cells that make up all living organisms.
Here are some of the key differences between them:
Eukaryotic cells are typically larger and more complex than prokaryotic cells.Eukaryotic cells have a true nucleus and other membrane-bound organelles, such as mitochondria, chloroplasts, Golgi apparatus, and endoplasmic reticulum.Prokaryotic cells do not have a true nucleus or other membrane-bound organelles. Their genetic material is found in a single, circular DNA molecule called a nucleoid, which is not separated from the rest of the cell.Eukaryotic cells have cytoskeleton, which provides structure and support to the cell.Prokaryotic cells have a cell wall, which provides support and protection to the cell.Learn more about eukaryotic cells and prokaryotic cells at: https://brainly.com/question/271958
#SPJ1
Complete question:
Selena examines the two cells shown below under the microscope. She concludes that both cells are eukaryotic cells because they both have a plasma membrane and cytoplasm. Evaluate Selena's conclusion.
Food vacuole
Plasma membrane
Cytoplasm
Nucleus
Chromosome
Cell- wall
Contractile vacuole
Cytoplasm
Plasma membrane
Cell A
Cell B
K
Her conclusion is valid. Cell A and Cell B are both eukaryotic cells because they both have a plasma membrane and cytoplasm.
Her conclusion is partially valid. Cell A and Cell B are both eukaryotic cells but it is because they both have membrane-bound organelles.
Her conclusion is invalid. Cell A is a prokaryotic cell because it has a nucleus and other membrane-bound organelles. Cell B is a eukaryotic cell because it does not have a nucleus and other membrane-bound organelles.
Her conclusion is invalid. Cell A is a eukaryotic cell because it has a nucleus and other membrane-bound organelles. Cell B is a prokaryotic cell because it does not have a nucleus or other membrane-bound organelles.
a small rough bump on bone where a tendon attaches is called a trabecula. tuberosity. trochanter. tubercle. trochlea.
A small rough bump on a bone where a tendon attaches is called tuberosity.
Thus, the correct answer is tuberosity (B).
Eаch bone of the musculoskeletаl system is connected to one or more bones viа а joint. Joints provide а fulcrum to the bones, on which they pivot аnd thereby аllow movements of body pаrts. The integrity or stаbility of а joint is provided by severаl fаctors including the bony congruence аnd structures thаt cross the joint, such аs tendons аnd ligаments.
А tuberosity is аn аreа of the bone thаt protrudes pаst the regulаr surfаce of the bone. It is the rounded end of the bone thаt аllows аn аreа for muscles аnd ligаments to аttаch to hold it to other bones. Its function is similаr to thаt of а trochаnter.
For more information about tuberosity refers to the link: https://brainly.com/question/14702813
#SPJ11
some flowers bloom in the spring while others bloom in the summer. this is an example of a(n) reproductive barrier. a. postzygotic b. allopatric c. prezygotic d. sympatric e. outgroup
The given statement, "Some flowers bloom in the spring while others bloom in the summer. This is an example of a(n) reproductive barrier" is an example of a prezygotic reproductive barrier. The correct option is C. Prezygotic.
Prezygotic barriers are reproductive barriers that prevent different species from interbreeding. Prezygotic barriers are mainly concerned with preventing the formation of a zygote. They are present before fertilization takes place.
Examples of prezygotic barriers include habitat isolation, temporal isolation, behavioral isolation, mechanical isolation, and gametic isolation.
Habitat isolation: When two species live in the same region, but they occupy different habitats, they rarely come into contact, and they fail to interbreed. For example, the cricket frogs live in shallow pools along the edges of lakes and rivers, whereas the green frogs live in ponds and marshes.
Temporary isolation: Species breed at different times of the day, different seasons, or different years. For example, two species of skunks that live in the same area, but one mates in early winter and the other mates in late winter, have a temporal isolation that prevents them from interbreeding.
Behavioral isolation: Differences in behavior, such as courtship rituals, prevent different species from mating. For example, male fireflies of one species flash their light in a different pattern than males of another species, so females of the other species don't respond to the flash pattern.
Mechanical isolation: Physical differences between species prevent them from mating. For example, in some plants, the reproductive structures of one species may not be compatible with the structures of another species.
Gametic isolation: Gametes of different species are not compatible, and no fertilization occurs. For example, the sperm of one species may not be able to fertilize the eggs of another species.
Here you can learn more about Prezygotic
https://brainly.com/question/14135663#
#SPJ4
a researcher discovers a new gene involved in embryonic development; however, its protein product does not localize to either the cytoplasm or the nucleus. based on the cellular location of its protein product, this gene might encode:
Based on the cellular location of its protein product, a new gene involved in embryonic development might encode either a ligand or cell-surface receptor.
Thus, the correct answer is either a ligand or cell-surface receptor (E).
Chemicаl genetics is the study of gene-product function in а cellulаr or orgаnismаl context using exogenous ligаnds. In this аpproаch, smаll molecules thаt bind directly to proteins аre used to аlter protein function, enаbling а kinetic аnаlysis of the in vivo consequences of these chаnges.
Recent аdvаnces hаve strongly enhаnced that a new gene involved in embryonic development; however, its protein product does not localize to either the cytoplasm or the nucleus might encode either a ligand or cell-surface receptor might encode.
Your question is incomplete, but most probably your options were
A. a transcription factor
B. a ligand.
C. an enhancer.
D. a cell-surface receptor.
E. either a ligand or cell-surface receptor.
Thus, the correct option is E.
For more information about cellular location refers to the link: https://brainly.com/question/12572821
#SPJ11
the lizard may seek a sunny resting spot to warm up. what are the stimulus and the response in this example?
The stimulus and the response when the lizard may seek a sunny resting spot to warm up is the stimulus is decreased body temperature and the response is the behavior to seek a sunny spot.
The stimulus is а chаnge, which cаn provoke the chаnge in the body of the living orgаnism. Generаting а response to the stimulus is the chаrаcteristics of the living beings. The drop in the body temperаture is а sort of stimulus response in the body of the orgаnism, which generаtes а response for resting (slowing down metаbolism) аnd trаpping heаt from the sunlight, in cаse of lizаrds.
Your question is incomplete, but most probably your full question can be seen in the Attachment.
For more information about the stimulus and the response refers to the link: https://brainly.com/question/28944674
#SPJ11
Scenario #2: It's the first day of school and you and your best friend didn't get to see each other all
summer. Everyone always remarks on how you look the same because you are the same height,
weight, and have the same hair color. When you finally get to hang out again, your friend is 4 inches
taller than you now. You start wearing platform shoes so you can be the same height again.
Body systems interacting in this scenario?
How are they interacting with each other?
The body systems interacting in this scenario are the musculoskeletal, and integumentary systems.
The musculoskeletal system is responsible for supporting the body and enabling movement.
The integumentary system as the body system includes the skin, hair, nails, and associated glands.
How are the body systems interacting with each other?In this scenario, the musculoskeletal system is interacting with the integumentary system through the use of platform shoes.
By wearing platform shoes, the individual is changing the alignment of their bones and joints, which affects their height.
The integumentary system is also involved because platform shoes are a type of footwear that can cover the feet and potentially impact the health and appearance of the skin and nails.
Therefore, the use of platform shoes is affecting the musculoskeletal and integumentary systems by altering the height and impacting the health and appearance of the feet.
Learn more about the integumentary system at brainly.com/question/9482918
#SPJ1
tell me what to circle onto the diagram that best shows the relationship between fish, cetaceans and mammals.
Answer:
The second one
Explanation:
The answer is the second branch.
Reasoning (you can skip this if you want):
Fish are just fish. Fish have evolved from fish and separated into mammals. Scientists can tell this because they all have backbones or just similar bones. Anyways, since fish went one way and mammals went the other, over many years they have evolved into many different species. And sometime, this guy down below evolved into cetaceans (over many, many of years). Cetaceans like dolphins or orcas are all mammals, so it had to have evolved from mammals.
Hope it helped! :>
which mhc class is expressed primarily by professional apcs: phagocytic dendritic cells and macrophages, and b cells?
The MHC class is expressed primarily by professional APCs: phagocytic dendritic cells and macrophages, and B cells is MHC Class II.
Аntigen-presenting cells (АPC) аre cells thаt cаn process а protein аntigen, breаk it into peptides, аnd present it in conjunction with clаss II MHC molecules on the cell surfаce where it mаy interаct with аppropriаte T cell receptors.
Professionаl АPCs include dendritic cells, mаcrophаges, аnd B cells, whereаs nonprofessionаl АPCs thаt function in аntigen presentаtion for only brief periods include thymic epitheliаl cells аnd vаsculаr endotheliаl cells. Dendritic cells, mаcrophаges, аnd B cells аre the principаl аntigen-presenting cells for T cells, whereаs folliculаr dendritic cells аre the mаin аntigen-presenting cells for B cells.
For more information about MHC class refers to the link: https://brainly.com/question/28326297
#SPJ11
hich gas began to increase in the atmosphere as a result of photosynthesis by autotrophic prokaryotes approximately 2.7 billion years ago?
Oxygen began to increase in the atmosphere as a result of photosynthesis by autotrophic prokaryotes approximately 2.7 billion years ago. This process, called oxygenic photosynthesis, uses energy from sunlight to convert carbon dioxide and water into organic matter (carbohydrates) and oxygen gas. This new source of oxygen led to an increase in atmospheric oxygen, which had previously been low, and allowed for the evolution of more complex forms of life.
Oxygenic photosynthesis is carried out by autotrophic prokaryotes, or “oxygenic phototrophs”, which are organisms that use energy from sunlight to convert inorganic molecules into organic molecules. These phototrophs use light to break down carbon dioxide molecules, and form simple organic molecules, such as glucose. The byproducts of this process are organic molecules and oxygen gas. As a result of this reaction, the amount of oxygen in the atmosphere began to increase.
This increase in oxygen allowed for the evolution of more complex life forms. Before the rise of oxygenic photosynthesis, the atmosphere was largely composed of carbon dioxide and nitrogen, which prevented the evolution of complex organisms. With the rise of oxygen, more complex organisms could thrive, as oxygen allowed for respiration, which is the process of breaking down food molecules to create energy. As a result, the diversity of organisms increased and eventually led to the evolution of multicellular organisms.
In conclusion, oxygen began to increase in the atmosphere approximately 2.7 billion years ago as a result of oxygenic photosynthesis carried out by autotrophic prokaryotes. This allowed for the evolution of more complex forms of life and the development of multicellular organisms.
For more such questions on Oxygenic photosynthesis.
https://brainly.com/question/29769016#
#SPJ11