Where in your body do you think cell division is occurring?

Answers

Answer 1

Answer:

Everywhere except in gonad cells

Explanation:

Cell division by mitosis occurs in all human body cells except the gonads (sex cells). During mitosis, the DNA is exactly copied and a new daughter cell created with the same number of chromosomes as the parent cell, ie 46. In the sex cells, meiosis occurs where the DNA is halved and the daughter cell has only 23 chromosomes.

Hope this helps :}

Pls mark brainliest :P

And have an amazing day <3

Answer 2

Answer: in shoot and root tips


Related Questions

Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –

Answers

Answer:

b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Explanation:

Answer:

b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

Explanation:

c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Which of the following elements is not a metalloid?

Answers

Answer:

gallium

Explanation:

which muscle group relates best with the term midline?

Answers

The oblique is the muscle group that best relates with the term midline.

The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:

The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.

It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.

The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.

Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.

Learn more here: https://brainly.com/question/19486604

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?

Answers

Yes, reducing poaching will help increase the elephant population


Please help




I don't know which one is the answer :(​

Answers

Answer:

I believe that your answer is C.

Explanation:

Keep in mind that Steve is working with crops (wheat specifically) and Devan has helped him repair his machinery so that Steve can harvest the wheat properly.

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

These types of consumer relationships can affect the size of prey and plant populations in a community and determine the places these prey and plant species live. For example, certain plants only grow in steep hillside in a habitat because they are eaten near the stream in the valley, or deer live in the forest to better hide from wolves in the open fields.
a. Parasitism and Commensalism
b. Mutualism and Herbivory
c. Predation and Parasitism
d. Predation and Herbivory

Answers

I think the answer is b because the plant would grow on the side of the land because of mulualiam and that is the spreading of seeds in a plant that was left behind

which statement about food production since 1960 is true?

Answers

Answer:

During this time our food production has grown even faster than our population

Explanation:

hope this helps you if it does please mark brainiest

Interpreto la imagen: 1. ¿Qué sensaciones te transmite la
fotografía? 2. ¿en dónde se encuentra el fósil del ser vivo
que se observa en la fotografía? 3. ¿A qué reino de la
naturaleza pertenecía el ser vivo de la fotografía? ¿Por qué?
4. ¿Cómo explicarías a una persona que es la evolución a
partir de esta fotografía? 5. La fotografía muestra un fósil
de cocodrilo de la especie C.Robustus, evidencia
paleontológica que demuestra la existencia de estos
animales desde el triásico y el jurásico en el planeta tierra.
¿Por qué crees que, a una institución como el laboratorio
de Ciencias de la Tierra de Lyon, en Francia, le puede
interesar estudiar un espécimen como este?.

Answers

Answer:

what image

Explanation:

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

Help this is due in an hour….

Answers

Answer:

I'm sure it's A

Explanation:

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology

Answers

Answer:

guess we were in the same boat I have

Explanation:

Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

what are the two major anatomical subdivisions of the nervous system?

Answers

Answer: The nervous system has two main parts:

The central nervous system is made up of the brain and spinal cord.

The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Explanation:

in an otherwise normal cell, what happens if one mistake is made during dna replication?

Answers

Answer:

Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.

Explanation:

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

match the pairs-rhizobium-
a)nitrogen fixation
b) bakery products
c) food poisoning​

Answers

Answer:

A

Explanation:

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

plants use the ____________ to make organic molecules.

Answers

The answer is light-independent reactions.

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?

Answers

Answer:

This spacecraft can travel

[tex]72000km[/tex]

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

Other Questions
Do IF YOU WANT TO TURN LEFT FROM A DRIVEWAY ONTO A ROAD WITH ALANE MARKED AS SHOWN BELOW, YOU:A. May turn into this lane before merging into regular trafficB. Must use this lane before merging into regular trafficC. May not turn into this lane while making your left turn a man earned $180 for working 14 hours. How many hours must he work to earn 300 2.5. Five friends went out to dinner. They each paid $13.75 for the meal, including a 7% sales tax. What was the total cost of the meal before the tax was added?A.$61.75 B. $63.94 C. $64.25 D. $73.92NO LINKS Which of the following is an example of a buoyant force acting on an object?A. The object remains still despite an applied force.B. The object travels with straight-line horizontal acceleration.C. The object floats on top of a fluid.D. The object travels in uniform circular motion. How did Brians attempts to read the tracks in the sand end in an important discovery? pg.the story hatchet What does mRNA do?1. carrycarry coded message from the genes to the ribosomes where proteins are built2. carry amino acids to the ribosomes3. make up ribosomes4. help with RNA splicing during world war ii, women and minorities made economic gains mainly because A drilling machine can drill 12 holes in 6 minutes. If the machine drills holes at a constant speed, it can drill holes in 25 minutes. HELPPP Help Please!! Ill Give Brainliest!On a coordinate grid, point A is located in the first quadrant. Point B is located at (negative 1 over 2, 2).Point C is a reflection of point B across the y-axis. Which graph shows these three points? A coordinate grid from negative 3 to positive 3 on both axes is drawn in increments of 1 over 2. Point A is plotted 4 grid lines to the right of the y-axis and 1 grid line above the axis. Point B is plotted at 1 grid line to the left of the y-axis and 4 grid lines above the x-axis. Point C is plotted at 1 grid line to the left of the y-axis and 4 grid lines below the x-axis. A coordinate grid from negative 3 to positive 3 on both axes is drawn in increments of 1 over 2. Point A is plotted 4 grid lines to the right of the y-axis and 1 grid line above the x-axis. Point B is plotted at 1 grid line to the left of the y-axis and 4 grid lines above the x-axis. Point C is plotted at 1 grid line to the right of the y-axis and 4 grid lines above the x-axis. A coordinate grid from negative 3 to positive 3 on both axes is drawn in increments of 1 over 2. Point A is plotted 2 grid lines to the left of the y-axis and 4 grid lines above the axis. Point B is plotted at 1 grid line to the right of the y-axis and 4 grid lines above the x-axis. Point C is plotted at 1 grid line to the left of the y-axis and 4 grid lines below the x-axis. A coordinate grid from negative 3 to positive 3 on both axes is drawn in increments of 1 over 2. Point A is plotted 2 grid lines to the left of the y-axis and 4 grid lines above the axis. Point B is plotted at 1 grid line to the right of the y-axis and 4 grid lines above the x-axis. Point C is plotted at 1 grid line to the right of the y-axis and 4 grid lines below the x-axis. Which of these inventions is the first microscope? Pls help will give brainiest!!! Grandpa has a barrel of apples. 2/5 of the apple are rotten. 24 of the apples are good. How many apples are there in total? can someone help me with these:2: 30210^-8. 3:6.810^3 . 4 : 9.110^-7. 5: 2.3 10^4 please need this by 12:10 pm Write=1\frac{5}{7}[as an improper fraction. Find the x-intercept and y-intercept of the line and then graph the equation-4x+2y=-4 Is this sentence written correctly?The teacher warned us, "that a suprise quiz was coming." name three things mexican do to celebrate day of the dead When converted to a household measurement, 9 kilograms is approximately equal to a please please please answer ill pay you First one to answer will be marked brainliest