when the net filtration pressure is negative, what process is occurring?

Answers

Answer 1
When the net filtration pressure is negative, what process is occurring? Fluid is moving back into the capillary. Which brain region contains the cardiovascular centers? When muscle cells contract, they release substances that cause nearby precapillary sphincters to relax.

Related Questions

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

True or false
processing maintains quality control .​

Answers

Answer:

True

(I am not 100% sure because the question is very short with no context, but I believe it to be true)

Use the images below to answer the question. 2. What makes all of the samples different from each other?​

Answers

Answer:

Shape and structure.

Explanation:

The difference in shape and structure of these pictures is responsible for the difference from each other. The organisms present in these pictures are different in their size, shape and composition of their body. Some are small and some are large, some are living while the others are non-living, some are very hard whereas the others are soft and fleshy. So the organisms present in these samples are different from each other in a variety of ways i.e. size, shape and body structure.

I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2

Answers

Answer: 1. ??? 2. I cannot read it

Answer:

What does it say?

Explanation:


BRAINIEST ANSWER!

HELP :))

Answers

Answer:

True

Explanation:

Don't know tell me if I'm wrong

Answer:

True

Explanation:

Actually it destroyed a LOT more than that...

Why are archaea in a different domain from bacteria?
A. They are multicellular, but bacteria are unicellular.
B. They are thought to have separate paths of evolutionary
development
C. They are able to perform endosymbiosis, but bacteria are not.
D. They have no similar characteristics.

Answers

Answer:B

Explanation:

Archaea is in a different domain from bacteria because they are thought to have separate paths of evolutionary development. Therefore, the correct statement is option B.

What are the differences between archaea and bacteria domains?

Archaea and bacteria are both prokaryotic organisms, but archaea are more closely related to eukaryotes than bacteria. Archaea have unique  lipid membrane and cell wall components that are different in composition than those found in bacteria.

These differences suggest that archaea and bacteria evolved to have separate paths of evolutionary development early in the history of life on Earth and then classified into Archaea and Bacteria domains.

Based on the phylogenetic tree constructed by researchers, the tree has classified life into three domains which are Archaea, Bacteria, and Eukarya These domains are based on their fundamental genetic and biochemical differences.

Therefore, archaea and bacteria are in a different domain because they followed separate paths of evolutionary development.

Learn more about the archaea domain here:

https://brainly.com/question/31089143

#SPJ5

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

5. What does Grover give Percy?

Answers

Answer:

Explanation:

Grover gives Percy a present in a shoebox and  it's the horn that Percy snapped off of the head of the Minotaur.

Answered by the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

HOPE THIS HELPED!!

where does mold come from?​

Answers

Mold is found everyone and can grow on almost any substance when moisture is presented. Mold could grow on non cellulose materials (plastic,metal, etc)

Help plzzzz!!!!!!!???!!!!!

Answers

The answer is A.
As the population increases, so will deforestation. With deforestation, habitats will be destroyed leading to a decrease.

If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same

Answers

Answer:

The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.

Hope my answer helps !

Answer:

i believe the answer is c) remain the same

Explanation:

i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)

and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)

good luck :)

i hope this helps

**please let me know if this was incorrect**

have a nice day!

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

Please help with this I’m being timed

Answers

Answer:

cell inhibitors

Explanation:

edge

If your cells couldn't go through meiosis- how could this affect you?

Answers

Answer:

An organism would not be able to reproduce without meiosis.

Explanation:

Between meiosis and mitosis, meiosis is by far not as important. If you are a asexual organism, this would be NOT IMPORTANT whatsoever. If you are a sexual organism, this would LARGLY effect you. But on a world scale, this is NOT AS IMPORTANT.

This is because, without mitosis, you could not heal and would die much much younger since your cells could not be replaced. On the other hand, without meiosis, any organism that reproduces sexually would be unable to do so, which could lead to extinction in many, many species. This would not be harmful, however, to species that can also or mainly reporuduce asexually through budding, fragmenting, or sporing. So overall:

Organisms that produce sexually would go extinct.

This is the only real affect I can think of. Since meiosis does not  produce any cells aside from reproductive cells. And asexual organisms produce reproductive cells through other means.

Ti⊂k∫∈s ω∅∅p

In a sample of double stranded dna if 27% of the nitrogenous bases are thymine what percentage of nitrogenous bases are cytosine?

Answers

Answer:

73%

Explanation:

Given: 27%

To find: Percentage of nitrogenous bases are cytosine

Solve: [tex]\frac{27}{100}[/tex] × [tex]\frac{100}{1}[/tex]

Firstly, divide 100% by thymine and cytosine

[tex]\frac{100}{2}[/tex] = 50

Now, If it is 50 / 50, but thymine has 27 then subtract 27 from 100

100 - 27 = 73

So, the percentage of nitrogenous bases are cytosine 73%

Which type of bleed would typically be more urgent to treat—venous or arterial?

Answers

Answer:

Arterial bleeding is more dangerous than venous bleeding. The arteries carry blood from the body and back into the heart. If the arteries become damaged and start to bleed out, an individual can suffer loss of life within five minutes if the bleeding is severe and if no medical attention is received.


PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2

Answers

Answer:

109kg? would hit the ground with more force

Explanation:

Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess

What helps meteorologists to forecast the weather?

Answers

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

Answer:

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.

Volume of the large cube is 7.506 x 10 mm. The volume of each small cube is 2.78 X 104 mm'. How many small cubes make up the large cube?

Answers

Answer:

27

Explanation:

Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be

Answers

Answer: Gg

Explanation:

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?

Answers

Answer:

Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.

Explanation:

hope this helps:)

how do radiation, conduction, and convection affect the atmosphere?​

Answers

Answer:

Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.

Explanation:

#KEEP LEARNING

WILL GIVE BRAINLIEST TO BEST ANSWER NO LINKS Select the correct answer.
In 2002, Colorado was suffering from extreme drought. Which technology will help Colorado reduce the effects of future droughts?
A.
building sea walls
B.
building levees
C.
building dams
D.
building storm shelters

Answers

Answer:

Building dams is the technology that will help Colorado reduce the effects of future droughts.

Explanation:

i dont know why people are putting links up insted of awnsers. Have a nice day :)

Answer:

C. Building dams

Explanation:

dams can store and reserve water for future use (resevoirs)

Help Me pls?!?!??? Plsssss

Answers

Answer:

its b

Explanation:

I remember I did this

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:

Other Questions
please help!!!!!!!!! Plz help I keep getting links and have now wasted 55 points because of it. Can you guys just plz help with this assignment plz, I don't understand it. I am willing to offer brainliest just plz help u will get a thanx and 5 stars just plz. Can someone help me with this pls? I think that this is the BEST instrumental song EVER (opinion)Song name: Wasting No Time By: FlyinYou can find it on Apple Music and Spotify What do you guys think? What is the y-coordinate of the plotted point? what is contemporary art? 1. Cold cheese feels healthier than hot cheese.2. Some people have to grow old to realize how beautiful they were when they were young.3. Mosquitoes would get a lot more blood if their bite didnt itch.4. People don't always do things because it "looks cool", they often do it because it makes them "feel" cool. It doesn't matter how other people actually perceive it.5. There's gonna be a lot people dressing up as Squid Game workers for Halloween, isn't there?6. Rick rolls have probably protected people from risky URLS than cybersecurity trainings in schools/camps/etc7. Thinking of doing an action distracts you from that action Read the fable closely and observe how the story reveals the theme. Think of an example from a TV show, book, or movie in which a character learns the same lesson communicated through this fable. Write a complete paragraph of at least five original sentences that explains how the fable and your story reveal the same theme. Use specific details from each story in your paragraph. Explain how your story choice makes the theme in the fable more modern or new. The fable is below:The Fox and the CraneA Fox invited a Crane to supper and provided only soup poured into a wide flat bowl. The soup fell out of the long bill of the Crane at every mouthful, and the Fox found this very funny. The Crane, in his turn, asked the Fox to dine with him, and set before her a bowl with a long narrow mouth. The Crane could easily insert his neck and enjoy its contents, but the Fox was unable to eat, because she did not have a long beak to reach the soup. The Crane thought this a fitting punishment for the way the Fox had treated him.Theme: Treat others as you would like to be treated. Help me!! im stuck and please help me with range please just help mee Find the change below as a percentage. Then choose whether it is a percent of increase or a percent of decrease.Change from 32 miles to 24 miles.GPercentage change: 196This is a percent of increase.This is a percent of decrease.Need help with this question? Which best describes the purpose of a close reading?A. To analyze a piece of writing and learn how it achieves its effectsB. To determine whether the writing is based on real people andeventsC. To focus specifically on creating tension in your own writingD. To record experiences that may be used later in a piece of writing Describe the strategy used by Chandragupta to conquer Magadha. how to measure the density of air Look at screen shot. 3. Select the three main regions of eastern North America.Appalachian MountainsWhite Top MountainAtlantic Coastal PlainPiedmontIsthmus of Panama addison and kelsey are running on a path modeled by x^2+y^2-10x-18y-378=0, where the distance is in meters. what is the maximum distance between the runners at any given time before making a covalent bond, where do the atom's electrons spend most of their time? Find the sum of the first eight terms of the geometric sequence whose first term is -2.5 and ratio is 2. help asap!! :(the organ in many nonflowering plants which produces an egg cell is the___