When curare, a South American arrow poison, is placed on a nerve-muscle preparation, the muscle though a neurotransmitter is still being released from the nerve. Give a possible explanation for the action of curare (be sure to include specific details explaining does not contract when the nerve is stimulated, even how and why).

Answers

Answer 1

Answer:

In a muscle contraction,neurotransmitter acetycholine stimulate the post synaptic membrane of the neuron or the sarcolemma  of the muscles cells at the motor end plate .This neurotransmission effect  leads to the opening of ligand gated sodium channels.

Therefore action potential(Endplate potential) is transmitted across the synaptic juction to to the muscles to  bring  about contraction of muscles(effector) .Therefore Acetycholine is refereed to as excitatory hormone.

Curare works as competitive inhibitor of acetycholine at the motor end plate. It prevents the binding of Acetycholine with the endplate.Therefore, ligand gated Na+channels can not open, thus End potential can not be  generated due to lack of depolarization, thus contraction of muscles is inhibited.

Thus,despite the fact that the neurotransmitter is produced, the curare has blocked the end plate.So, no muscles contraction will occur because ,no place for the the excitatory acetylcholine to bind with.Hence the the muscle cells are in the permanent state of  relaxation (resting membrane potential).

Animals poisoned with this substance usually asphyxiate because of paralysis of the diaphragm, external and internal inter-coastal muscles and  collapse of the lungs and therefore failure of the entire respiration  muscles and system.Thus lack of oxygen from failed breathing.

Explanation:s

In a


Related Questions

Which sphere does the frog belong to? atmosphere biosphere geosphere hydrosphere

Answers

Answer:

biosphere

Explanation:

The frog belongs to the biosphere -the vicinity of the planet wherein organisms live, inclusive of the floor and the air. An example of the biosphere is in which existence happens on, above, and beneath the floor of Earth.

Define the term biosphere in short?

The biosphere is made of the components of Earth wherein life exists—all ecosystems. The biosphere extends from the private root structures of bushes to the darkish environments of ocean trenches, to lush rain forests, high mountaintops, and transition zones like this one, in which ocean and terrestrial ecosystems meet.

What is the role of the biosphere?

The biosphere presents important environmental situations for survival. living organisms are required to adapt to the environment of the biosphere. The biosphere is home to biodiversity within ecosystems while imparting a reliable source of meals on the earth.

Learn more about the biosphere here:  https://brainly.com/question/25750450

#SPJ2

Match the following respiratory conditions to the
1. Emphysema
a. A condition in which an attack can trigger constri
2. Pneumonia
b. The inflammation of bronchioles in the lungs
3. Bronchitis
c. The buildup of fluid in the alveoli of the lungs
4. Asthma
d. A condition often caused by smoking, featuring d

Answers

Answer:

D

C

B

A

Alveoli

larynx

mucus

nitrogen

diaphragm

Air enters the body through the mouth or nose and passes through the pharynx and larynx. Then it travels down the trachea and branches through the bronchi into the two lungs. In the lungs, small alveoli are the site of gas exchange where carbon dioxide diffuses into the lungs for exhalation, while oxygen from the air diffuses into the capillaries surrounding the alveoli to be pumped throughout the body.

Explanation:

Emphysema is caused by smoking. Pneumonia is buildup of fluid in the alveoli of the lungs, bronchitis is inflammation of bronchioles in the lungs, and asthma is condition in which an attack can trigger constrict air passage. The correct match is 1-d, 2-c, 3-b, and 4-a.

What is respiration?

The process by which cells shatter down sugar and obtain energy by using oxygen.

There are several conditions that can affect the respiratory conditions. Some can be listed as:

Smoking causes emphysema. Pneumonia is the accumulation of fluid in the alveoli of the lungs.Bronchitis is the inflammation of the bronchioles in the lungs.Asthma is a condition in which an attack can cause constrictions in the airways.

Thus, the correct match is 1-d, 2-c, 3-b, and 4-a.

For more details regarding respiration, visit:

https://brainly.com/question/12605249

#SPJ5

The Coriolis effect contributes to ________.
a. an increase in eutrophication
b. increased acidic deposition
c. a reduction in eutrophication
d. global warming
e. global wind patterns

Answers

the answer is e. global wind patterns

Michael, a new lab analyst, receives an email notifying him that his expected samples from a recent outbreak should be arriving soon. To prepare for his analysis, he decides to look into what type of diseases could be spread between animals and humans, as this is a new field for him. Michael has received limited information about the details of the outbreak from the epidemiologists that traveled to the site, but he does know that both animals and humans were infected by some type of virus. Michael looks through some of the lab manuals on how the samples will be handled once in the lab. While reading through these guidelines, he realizes that there are some terms he is not quite sure of. Below are sentences that reflect the terms that Michael had to acquaint himself with while reading through the published guidelines from his laboratory.
Please review the sentences below and fill in the blanks with the correct word(s).
A. arthropods
B. togaviruses
C. encephalitis
D. flaviviruses
E. zoonosis
1. A virus that is able to be transmitted via________ like ticks, flies, and mosquitoes is considered a(n)_______
2. Some arboviruses are able to move through the bloodstream and infect the brains of humans and arbovirus animals. This disease manifestation is called_________
3. A________ is a disease that can be transmitted from animals to humans.
4. Several encephalopathies, such as Eastern equine encephalitis and West Nile virus encephalitis, are caused by the_______ animals such as horses and birds. These viruses can infect humans and animals

Answers

1.A arthropods

2.C encephalitis

3.E zoonosis

4.C togaviruses

Describe the flow of energy from a glucose molecule to ATP during respiration, and compare this to the flow of energy from glucose to acids and alcohols during fermentation. Specifically, what carries the energy from glucose to ATP - what energy conversions must occur during the process. Compare the ATP production during respiration with ATP production during fermentation.

Answers

Answer:

Glycolysis is the first step of the cellular respiration in an organism which is metabolic pathway that is completed in the cytosol of the cell that leads to the converting glucose to the pyruvate in order to produce energy in form of ATP:

1. Glucose-6-phosphate is ---> fructose-6-phosphate

2. fructose-6-phosphate ---> fructose-1,6-biphosphate

3. fructose-1,6-biphosphate ---> glyceraldehyde-3-phosphate(GAP) and dihydroxyacetone phosphate (DHAP).

4. GAP is oxidised ----> 3-bisphosphoglycerate + NADH

5.  3-bisphosphoglycerate  ----> 1,3-bisphophoglycerat

6. 1,3-bisphophoglycerate   ----> 3-phosphoglycerate

7. 3-phosphoglycerate ----> 2-phosphoglycerate

8.  2-phosphoglycerate  ----> phosphoenolpyruvate (PEP)

9. phosphoenolpyruvate to ADP  ----> pyruvic acid + ATP

Formation of ATP occurs in both pathways or process that are respiration and fermentation. Fermentation is a catabolic pathway leads to the degradation of sugars (partial) that result in the gain of energy and this energy are absorbed in ATP.  There are difference of the amount of energy or ATP produce in these process in respiration 38 ATP are produced whereas during fermentation only 2 ATP are produced.

Heart rate, stroke volume, and cardiac output are dependent on one another, these relationships can
provide many clues as to why Jean fainted during her workout session. Which of the following events
could lead to a decrease in cardiac output that could increase Jean's risk of fainting?
Jean did not like the idea of having an echo transducer in her esophagus, but the explanation of what could happen afterward was even more frightening. If Dr. Gardner saw no evidence of blood clots in the echocardiogram, she would then attempt to electrically shock Jean's atria back into a normal sinus rhythm. Direct current cardioversion (DCC) is a procedure that uses electrical current supplied by electrodes applied to the chest and back. Electrical current interrupts the abnormal rhythm, atrial fibrillation in Jean's case, by forcing cardiac muscle cells to contract simultaneously, and hopefully restores normal sinus rhythm. Jean would need to give her consent to proceed with this course of action.
Dr. Gardner discussed alternatives that included using medications to control Jean's heart rate. The main concern for using these medications is that they inherently lower blood pressure. Jean's blood pressure had been in the low normal range, which made this option a concern. Chemical cardioversion, using medication instead of electrical current, was also an option, but Dr. Gardner would still need to know that Jean's heart was free of blood clots. She did not like to use these medications, such as amiodarone, because they had a number of side effects that damaged the thyroid gland and lungs over time. Unfortunately, anticoagulation therapy with blood-thinning medication would be unavoidable if a blood
clot, or thrombus, was detected by echo. Thrombi form in nonfunctional atria, which explains how A Fib and CVA are related. The risk of CVA is greatly increased when normal sinus rhythm is restored, as thrombi can move into the left ventricle and then into the systemic circulation. Thrombi could occlude, or block, small blood vessels that would deprive the brain of blood flow, resulting in a CVA Anticoagulation therapy reduces the risk of blood clot formation and CVA in patients with AFib, Dr. Gardner explained Jean had a relatively low risk for developing CVA based on the medical history she shared with Dr. Gardner. It was possible that she might go home with just instructions to take a baby aspirin once per day for stroke prevention. The doctor did think that Jean should maintain a close relationship with her primary

Answers

Answer:

hmm this is confusing

Explanation:

Observations of organisms include descriptions of why the organism has certain traits. descriptions of the number, size, and arrangement of parts of the organism. conclusions made about the characteristics of an organism. conclusions made based on an organism’s DNA.

Answers

Answer:

The correct statement is descriptions of the size, number and arrangement of parts of the organism.

Explanation:

The act of obtaining information from a suitable primary source is termed as an observation. It is the very initial step in the array of steps that comprises a scientific method and it incorporates the recording of data regarding an observed natural process.  

Observation permits the researchers to inquire regarding the apposite scientific questions, to produce an applicable hypothesis, and to set up significant experiments, which will provide suitable answers to the queries asked earlier.  

Answer:

B. descriptions of the number, size, and arrangement of parts of the organism.

Explanation:

took the test, hope this helps.

g The pH of the space between the inner and outer mitochondrial membrane is ______________ the pH of the mitochondrial matrix.

Answers

Answer:

lower than

Explanation:

The protons obtained from the spit of  hydrogen atoms, to protons and electrons, (which was transported to the Matrix of the mitochondria by NADH and FADH2 ) are pumped by PMF into the intramembrane space.

The constant pumps by the PMF,due to the electron transport chains set up high concentration of Hydrogen ions in the intramembrane space.If pH is -log[H+] then the high the number of H+/protons,the stronger  the acidity,and lower the pH  of the medium.

This set up higher electrochemical gradient compare to the matrix.Thus H+ diffuses down the gradients into the matrix.

This generate energy needed for the synthesis of ATPs by ATPase synthase in the matrix

g 1 molecule of glucose is catabolized to pyruvate and then acetyl-coA. All the acetyl-coA enters the citric acid cycle. How many molecules of NADH are produced from the citric acid cycle only (do not include NADH from glycolysis or the pyruvate dehydrogenase complex in your calculation.) You must answer as a number i.e if you think the answer is 12, you must enter 12, not twelve.

Answers

Answer:

6NADH

Explanation:

In the kreb's cycle NAD is  reduced during the reduction of 6-carbon citrate to 5 carbon Alpha-Ketoglularate.

The second is produced during the conversion of 5carbon alpha ketoglutarate to succinate. Lastly in  the conversion of fumirate  to oxoloacetate;another NADH  is formed.

However, since two pyruvate enters the Kreb's cycle therefore 6NADH(three NADH per cycle of Citric)  are produced for each molecule of glucose that is broken down from glycolysis.

Remember,each glucose molecule goes through 2 cycles of Kreb.

Futhermore co-enzyme FADH2 are also produced,with 2 molecules per 1 glucose.

These Co-ezymes transfer hydrogen ions,into the matrix of the mitochondria,where is is splits to protons and  electrons.

The electrons formed the ETC,which produce PMF  for transporting protons into the intramembranes for electrochemical gradients needed to generate energy for ATP s synthesis,by ATP synthase.

.

A cellular structure that is visible with an electron microscope but not with a light microscope is:____________.
1. a mitochondrion.
2. a ribosome.
3. a chloroplast.
4. a nucleus.

Answers

Answer:

The ribosome will not be visible with a light microscope

explain test for reducing sugar

Answers

Answer:

A food sample is dissolved in boiling water.

Explanation:

A small amount of Benedict's reagent is added and the solution begins to cool. In the next 10 minutes, the solution changes colour. if it turns blue, there is no glucose present in it.

As it is heated, it turns yellow. The hotter the colour of the reagent, the higher the concentration of reducing sugar. E.T.C.

There is more,e.t.c.

Hope this few helps.

The process of DNA replication is described. Identify the enzyme that participates in each part of the replication process. DNA partially unwinds as the hydrogen bonds between complementary bases are broken. This process is catalyzed by the enzyme

Answers

Answer:

Helicase

Explanation:

DNA replication is the process in which DNA makes copies of itself.

The process of DNA  replication is supported by several enzymes.

The initial step of DNA replication is unwinding of double stranded DNA which is catalyzed by helicase enzyme. Helicase enzymes breaks the hydrogen bond between the  DNA strands and prepare them for replication process.

Hence, the correct asnwer is "Helicase".

Every few years, Shelley takes her dog in for injection with a rabies vaccine, which contains the heat-killed virus. Is the dog receiving active or passive immunity from the injection? Explain.

Answers

Answer:

Passive immunity

Explanation:

Active immunity occurs when the immune system of an individual encounters a disease and produces antibodies to fight against it. This type of immunity is usually slow but when achieved the effect lasts for a lifetime.

Passive immunity involves the introduction of antibodies into the body of individuals. The effect is usually instant but it lasts for a short period of time. This explains why every few years, Shelley took her dog in for injection with a rabies vaccine which contained the heat-killed virus.

Complete the following vocabulary exercise related to DNA replication.Match the words in the left-hand column with the appropriate blank in the sentences in the right-hand column.
1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a_______ .
2. After replication is complete, the new DNAs, called_______ , are identical to each other.
3. The enzyme that can replicate DNA is called_______ .
4. _________are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.
5. The new DNA strand that grows continuously in the 5' to 3' direction is called the________.
leading strand
okazaki fragments
replication fork
DNA polymerase
daughter DNA

Answers

Answer:

1. During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a replication fork.

2. After replication is complete, the new DNAs, called daughter DNA , are identical to each other.

3. The enzyme that can replicate DNA is called DNA polymerase.

4. Okazaki fragments are the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.

5. The new DNA strand that grows continuously in the 5' to 3' direction is called the leading strand.

Explanation:

Hope it helps.

DNA replication is the process by which a cell makes an exact copy of its DNA.

It is a fundamental process in all living organisms that allows for the accurate transmission of genetic information from one generation to the next. During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual strands.

Each of the original strands serves as a template for the synthesis of new DNA occurs. This replication process follows a semi-conservative mechanism.

The correct options are:

Replication forkDaughter DNADNA polymeraseOkazaki fragmentsLeading strand

Learn more about DNA replication, here:

https://brainly.com/question/30111562

#SPJ6

Which molecules are used to form cell membranes

Answers

Answer:

membranes and internal membranes — are made of glycerophospholipids, molecules composed of glycerol, a phosphate group, and two fatty acid chains. Glycerol is a three-carbon molecule that functions as the backbone of these membrane lipids.

Explanation:

PlZzzzz follow me

The following models show one large cell (A) and four small cells (B).
O
O
olo
O
00
ОО,
O
A
B.
Which of the following states why one of the models is better for moving
more nutrients in and out of the cell?
O A. A is better because it has more surface area.

Answers

The question is incomplete and the diagram is also not given. So the diagram is attached below and the complete question is as follows:

The following models show one large cell (A) and four small cells (B).

Which of the following states why one of the models is better for moving more nutrients in and out of the cell?  

A. B is better because it has more surface area.

B. A is better because it has less surface area.

C. A is better because it has more volume.

D. B is better because it has more volume

Answer:

A. B is better because it has more surface area.

Explanation:

The movement of nutrients in a cell depends on the surface to volume ratio. More is the surface to volume ratio, better will be the movement of nutrients in and out of the cell.

In the given model, small cells (B) has more surface to volume ratio as surface area of B is larger, so, the model B is better for moving more nutrients in and out of the cell.

Hence, the correct option is "A".

Answer:

B has smaller cells but more surface area than A

Explanation:

B

Yellow dung flies (Scathophaga stercoraria) are diploid organisms with 12 chromosomes in their diploid cells. Without taking into account recombination, how many different genetic gametes can this fly generate based on the arrangement of its chromosomes in the metaphase plate during meiosis

Answers

In the given case, the sum of the number of gametes possible in the fruit fly is 2¹² or 4096.  

Determination of the number of genetic gametes:

At metaphase I, the arrangement of chromosomes takes place at the equatorial plate and at the equator, the orientation of homologous pairs takes place randomly. This orientation helps in finding the genes found within a gamete as each of the gametes will get only one chromatid of a chromosome.  

Now by independent assortment, the variation occurs within the gametes, which suggests that the alleles of distinct genes separate independently from one another at the time of cell differentiation. Due to independent assortment, the number of different kinds of gametes possible within the chromosomes can be determined by using the formula, 2ⁿ, where n is the number of chromosomes present within a set.  

Thus, based on the given information, the number of chromosomes present in a fruit fly is 12. Thus, the sum of the number of gametes possible in the mentioned fruit fly is 2¹² or 4096.  

Find out more information about determination of gametes here:

https://brainly.com/question/6760841

Environmental engineers minimize the impact of land development on the environment.
Please select the best answer from the choices provided
t or f​

Answers

The correct answer is True

Explanation:

The focus of environmental engineering is to create technologies and solutions to prevent environmental pollution and destruction, and in this way protect human societies, as well as, natural ecosystems. This includes solutions to reduce the impact of land development that involves altering natural ecosystems to build houses and other human constructions. In this area, environmental engineers make the use of land for humans efficient and create models that are more friendly to the environment. Thus, the statement is true.

Answer:

T R U E

Explanation:

just took the test on and got it right

new insecticide is advertised to kill more than 95% roaches upon contact. In a laboratory test, the insecticide was applied to 400 roaches and 384 died immediately after contact. Is this sufficient evidence to support the advertised claim?

Answers

Answer:

Yes! The Commercial is telling the truth that the product kills a good amount, but they are lying when they say it kills 95%. Because it kills 96%!

Explanation:

This is a great question to be asking!

With is experiment, instead of killing 95% of the roaches in the laboratory, it killed 96%. But, it is strange that the commercial did not say 96%. But, to me, maybe that because 95% looks more appealing to the broad audience, instead of a higher number?

Anyways! Hahaha, sorry for getting off topic, but all you need to do to figure this out is to set up a division equation!

Because only 384/400 died, that would be the equation. And when plugging that into a calculator you get 96%.

Fun fact! If the product had killed only 380/400 roaches, then the commercial would be telling the truth.

is lactase exergonic

Answers

Answer:

The correct answer is - yes lactase action is exergonic.

Explanation:

Lactase is an enzyme located in the small intestine of mammals including humans, however it is produced by many organisms in their body. Lactase is an essential enzyme as it helps in the digestion of the whole milk by breaking down the lactose, sugar present in milk.

Exergonic reactions are the reaction that releases energy by the breaking of molecules in any reaction. Generally, catabolic reactions are exergonic lie lactase catabolizes the lactose present in milk and release energy.

Thus, the correct answer is - yes lactase action is exergonic.

2.Exocrine glands such as sweat glands secrete fluids through ducts.
3.the blank gland plays an important role in puberty and growth.
4. Epinephrine triggering the fight or flight response is produced by the blank glands which sit top of the kidneys
5.most glands that secrete hormones operate using feedback mechanisms.when hormone concentrations are high the gland will produce blank of th e hormone.

Answers

Answer:

The pituitary gland plays an important role in puberty and growth.

Epinephrine triggering the fight or flight response is produced by the adrenal glands which sit on top of the kidneys.

When hormone concentrations are high, the gland will produce negative feedback of the hormone.

Hope that helps.

Answer:

Per James Madison HS

Explanation:

Hormones

endocrine

pituitary

adrenal

less

prostaglandins

thyroid

Steroidal hormones enter the cell directly and interact with DNA inside the nucleus. These hormones change gene expression, affecting the RNA that is produced and the proteins that are translated in a cell. Nonsteroid hormones do not enter the cell. Instead, they bind to specific receptors on the outside of the cell membrane. This triggers molecules called secondary messengers, such as cAMP, to begin their work of relaying information in the cell, where other chemicals, messengers, and proteins are involved to create a cellular response.

Which joint performs adduction, abduction, horizontal adduction and abduction, medial and lateral rotation, and circumduction?

Answers

Answer:

The ball and socket joint is the one that can perform all those movements.

Explanation:

Ball and socket joint, also know as spheroid joint are types of joints where the part of the bone that articulates with the other bone has a spheroidal shape or ball shape that fits in the depression of the other bone, which means that they are a synovial enarthrosis joint. It has a wide range of movements because it can move in the transverse, vertical, and sagittal axes. An example of this joint is the shoulder, between the scapula and the humerus.

Answer: Sholder and hip

Explanation:

The cardiac tissue has fewer T tubules and store less calcium than skeletal muscle. What is the outcome of these two traits

Answers

Answer:

The slow arrival of contraction or the slow onset of contraction.

Explanation:

The T tubules function in the transformation of the action potential from the sarcolemma to the sarcopasm reticulum.

In the skeletal muscles, it is located at the junction of the A and I bands but in the cardiac muscles, it is located only at the z discs thus giving rise to to T tubules.

The cardiac muscles also do not possess as much calcium as the skeletal muscles thus, its calcium ion must come from outside producing the slow arrival of contraction or the slow onset of contraction.

The cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.

The sarcolemma is the plasma (excitable) membrane of muscle cells, which are surrounded by endomysial connective tissue.

The T-tubules are invaginations of the sarcolemma that enter into the muscle cell in order to form interconnected networks.

These tubules (T tubules) store intracellular calcium ions under the supervision of membrane depolarization through a voltage sensor channel (i.e., DHPR).

In conclusion, the cardiac tissue has fewer T tubules and stores less calcium than skeletal muscle, thereby the onset for muscle contraction is SLOWER in the heart than in skeletal muscle.

Learn more in:

https://brainly.com/question/6763078

Which of the following statements best summarizes Plato's views regarding the athletics
and health programs he would implement in his perfectly "just city?"

Answers

Answer:

See below

Explanation:

A perfectly ideal and just city, as imagined by Plato, comprises of three main categories:

The guardiansThe auxiliariesThe producers

These 3 categories correspond to the categories of the soul. Guardians are to govern the just city, followed by soldiers responsible to keep the city safe and producers are on the lowest tier and provide support via farming, being artisans etc.

In the diagram, how many angles are alternate exterior angles with angle 5?

Answers

Answer:

One.

Explanation:

The attached figure shows the diagram of the given question.

We need to find how many angles are alternate exterior angles with angle 5?

Exterior angle = Angle that is made outside of the shape

Alternate angle = an angle opposite of a transversal line of another angle.

From the figure, 8, 7, 9, 10, 12, and 11 are the angles that are on the same transversal. 8, 7, 9, 10, and 12 are just exterior. It means that 11 is the alternate exterior of angle 5. So, only one angle is alternate exterior angles with angle 5.

Transcribe and translate the following strand.
CGTACGGGCAGGATCGGCGAACTGGA
Transcription: 1
(The answer for transcription must be in all caps; example: AAAAAAA)
Translation:
(The answer for translation must be in the following format: first letter capitalized and each amino
acid separated by a hyphen; example: Met-Met-Met-Met)
Second Base of mRNA Codon
С
A
G
UUU Phe
UUC Phe
UUA Leu
UUG Leu
UCU Ser
UCC Ser
UCA Ser
UCG Ser
UAU Tyr UGU Cys
UAC Тут UGC Cys
С
UAA STOPUGA STOPA
UAG STOP UGG Trp
CUU LCI
CUC Leu
CỦA LcU
CƯ Leu
CCU Pro
CCC Pro
CCA Pro
CCG Pro
CAU His
CAC His
CAA Gln
CAG Gln
CGU Ang
CGC Arg
CGA Arg
CGG Arg
First Base of mRNA Codon
Third Base of mRNA Codon
AUU Te
AUC le
AUA Ile
AUG Met
ACU Thr
ACC Thr
ACA Thr
ACG Thr
AAU Asn
AAC Asn
AAA Lys
AAG Lys
AGU Ser
AGC Ser
AGA Arg
AGG Arg
G
GUU Val
GUC Val
GUA Val
GUG Val
GCU Ala
GCC Ala
GCA Ala
GCG Ala
GAU Asp
GAC Asp
GAA Glu
GAG Glu
GGU Gly
GGC Gly
GGA Gly
GGG Gly
Pon-90A​

Answers

Answer:

AAC Asn

AAA Lys

AAG Lys

AGU Ser

AGC Ser

AGA Arg

AGG Arg

G

GUU Val

GUC Val

GUA Val

GUG Val

GCU Ala

G

How can protists exhibit both animal-like and plant-like characteristics?

Answers

A heterotrophic and chlorophyll protist

Food is ingested by protists in three forms. We produce, eat and digest their own organic molecules. Meat ingestion or english bacteria ingests protists. The cell wall and cell membrane are stretched to create an alimentary vacuolum around the foodstuff. Enzymes extract the food inside the food vacuole. At the other side, absorbent protists consume food molecules through their cell membrane by diffusion. In decomposition, absorbent protists play a crucial role. They are assumed to be essential decomponents. Light energy is used to make your own food by big farmers including photosynthetic protists.

----------------------

Hope this helps!

Brainliest would be great!

----------------------

With all care,

07x12!

The citric acid is a stage of catabolism that oxidizes acetate into carbon dioxide and generates energy. There are eight enzymes involved in the citric acid cycle.
1. Which enzymes produce NADH as a product?
a. alpha-ketoglutarate dehydrogenase
b. succinate dehydrogenase
c. malate dehydrogenase
d. isocitrate dehydrogenase
2. Which enzymes produce carbon dioxide as a product? Select all that apply.
a. malate dehydrogenase
b. isocitrate dehydrogenase
c. succinate dehydrogenase
d. alpha-ketoglutarate dehydrogenase
3. Which enzymes produce coenzyme A as a product? Select all that apply.
a. fumarase
b. citrate synthase
c. succinyl-CoA synthesase
d. citraste synthase
4. Which enzymes have an alpha-keto acid substrate? Select all that apply.
a. fumarase
b. alpha-ketoglutarate dehydrogenase
c. citrate synthase
d. malate dehydrogenase
5. Which enzyme catalyzes a hydration reaction?
a. aconitase
b. fumarase
c. citrate synthase

Answers

Answer:

1.(a ) alpha-ketoglutarate dehydrogenase

(c) malate dehydrogenase

(d) isocitrate dehydrogenase

2. b. isocitrate dehydrogenase  d. alpha-ketoglutarate dehydrogenase

3. b. citrate synthase  (c) succinyl-CoA synthesase

4. b. alpha-ketoglutarate dehydrogenase  c. citrate synthase  d. malate dehydrogenase

5. a. aconitase

Explanation:

The citric acid cycle is responsible for the oxidation of acetyl-CoA produced from pyruvate from glycolysis. The citric acid cycle has eight steps requiring nine enzymatic reactions involving eight enzymes.

The enzymes in the citric acid cycle are:  citrate synthase , aconitase, isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase ,  succinyl-CoA synthesase, succinate dehydrogenase , fumarase , and malate dehydrogenase .

1. The dehydrogenation reactions of isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase , and malate dehydrogenase  produces NADH from isocitrate, alpha-ketoglutarate and malate respectively.

2. Oxidative decorboxylation (removal of carbon as CO₂) also occurs in the reactions of isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase  to produce alpha-ketoglutarate and succinyl-CoA respectively.

3. Coenzyme-A (CoA-SH) is produced in the reactions of citrate synthase and succinyl-CoA sythetase to produce citrate and succinate respectively.

4. The enzymes alpha-ketoglutarate dehydrogenase has  alpha-ketoglutarate as substrate , whereas citrate synthase  and malate dehydrogenase has  oxaloacetate as substrate. These substrates are alpha-keto acids.

5. Aconitase catalyzes the conversion of citrate to isocitrate by first a dehydration and then a hydration reaction.

What is the relationship between coronary artery disease and a heart attack?

Answers

Answer:

C. Coronary artery disease can reduce blood flow to the heart and cause heart attacks

Explanation:

im pretty sure

Is your prediction supported by the membrane potential chart?

Answers

Answer:

The membrane potential of a resting neuron is primarily determined by the movement of K+start text, K, end text, start superscript, plus, end superscript ions across the membrane. ... Zero voltage across the membrane, as measured by a voltmeter with one electrode inside and one electrode outside the cell.

Answer:

Yes, it is. The chart shows that the initial charge of the neuron is negative. When the neuron is stimulated, sodium ions enter the cell. So, the voltage inside the cell changes to positive. When potassium ions move outward, the voltage decreases until it reaches its previous state.

Explanation:

Other Questions
Negative ions have _____. Please do either 40 or 39 What is the equation for the plane illustrated below? A military spouse has relocated with his wife who is assigned to a duty station in Jacksonville. He has an active real estate license in New York. The spouse may be issue a ________ for 6 months. Calculate the pOH and pH of a solution which contains 0.001 M NaOH. Assume 100% ionization. (Need an in-depth explanation with formulas please) what were the attempts to cure trench foot Angiosperms are flowering plants. The carpal is a reproductive organ within the flower. What part of the carpal becomes the fruit when fertilization occurs? The image shows a flower with 8 different lines pointing to different parts of the flower. The lines are labeled A through H. Part C Part D Part H Part I The range of f(x) = cos(x) is y 0 The tee for the fourth hole on a golf course is 300 yards from the tee. On that hole, Marsha hooked her ball to the left, as sketched below. Find the distance between Marshas ball and the hole to the nearest tenth of a yard.A. 195.4 ydB. 123.7 ydC. 97.5 ydD. 105.1 yd A cylinder with a base diameter of x units has a volumeof x cubic unitsWhich statements about the cylinder are true? Selecttwo optionsThe radius of the cylinder is 2x units.The area of the cylinder's base is wa? square units.The area of the cylinder's base is not square units.The height of the cylinder in 2x umijsThe height of the cylinder is 4x units.Save and ExitNextSubmitC Your parents want to buy a house in another country so the family can spend the summers there. They like to look at a variety of choices, from tall buildings to small detached houses, to ranches. They prefer a vibrant big city.Segn lo que aprendiste en la leccin, based on what you learned from the lesson, qu pas visitan tu pap y mam? Espaa Guinea Ecuatorial Argentina Costa Rica Household production consists of Group of answer choices any commodities which are produced at home and then sold. any commodities which are produced at home and yield utility to the family. any time spent at home by any family member. any commodities purchased for use in the home. Greenbrier Industrial Products' bonds have a 7.60 percent coupon and pay interest annually. The face value is $1,000 and the current market price is $1,062.50 per bond. The bonds mature in 16 years. What is the yield to maturity Which of the following is an example of a quadratic equation? Heather and Jeff live on a farm in Iowa with their three children. They are concerned about the environment because of the high cost of heating their home in winter. Which environmental activism segment best describes Heather and her family What is the vertex of y=-3x^2+6x+15? Help is much appreciated. Solve the System of equations. pseudomonas helps in A. produces biotoxinB. Removing weedsC. Removing oil spill D. kill pest hope anyone can help me with this question, please Process A has fixed costs of $1000 and variable costs of $5 per unit. Process B has fixed costs of $500 and variable costs of $7.50 per unit. What is the crossover point between process A and process B? 50 units 250 units $9,500 $5,000 200 units Which was one of the goals for some advocates of the Progressive movement?A: conservationB: laissez-faire economyC: welfareD: establishment of a national bank