What were the results of Japan's attack on China? How did these actions concern
Americans?

Answers

Answer 1

Answer:

The eight-year Japanese invasion caused tremendous damage to China in terms of civilian and military casualties and property losses. More importantly, even seven decades after the end of the war, the two countries have not reached any reconciliation.The United States responded to this growing threat by temporarily halting negotiations with Japanese diplomats, instituting a full embargo on exports to Japan, freezing Japanese assets in U.S. banks, and sending supplies into China along the Burma Road.


Related Questions

Write a short Note on TIPU SULTAN'S LEGENDARY SWORD

Answers

Answer: Tipu sultan's sword is considered to be one of the world's rare artifacts!! The famous single-edged sword made of fine steel with curved blade belongs to the closing years of the 18th century. Tipu Sultan's sword was very famous for its hardness; the sword could rip through armour. The incredible hardness of the sword came from a special high carbon steel called Wootz steel.

Explanation: Hope that helped :)

Answer:

Tipu Sultan's sword had an incredibly hard edge that could easily rip out opponent's armour. This type of sword was made from Wootz steel which was produced all over south India. The sword made from this steel had small carbon particles embedded in iron.

Hypothetical examples are effective for making a point about something that has already occurred. TRUE/FALSE

Answers

Answer:

True

Explanation:

One of the most powerful means of conveying a message is through a narrative. Stories tell tales that are either real or imaginary.

What were Underground Railroad "stations?​

Answers

Answer:

They were where slaves escaped and hid at

Answer :

If you were an escaped slave before the Civil War the best way to travel was along the Underground Railroad. This wasn't a real railroad but a secret system located throughout the Northern states. The system helped escaped slaves from the South reach places of safety in the North or in Canada, often called the "Promised Land," because U.S. slave laws could not be enforced there. The slaves often wore disguises and traveled in darkness on the "railroad." Railway terms were used in the secret system: Routes were called "lines," stopping places were called "stations," and people who helped escaped slaves along the way were "conductors." One of the most famous "conductors" on the Underground Railroad was Harriet Tubman (an "Amazing American"), a former slave who escaped from Maryland.

What assumption is Roosevelt making in this paragraph the US is under threat?

Answers

Roosevelt's assumption in the paragraph was that "the United States is under threat of espionage and sabotage." This assumption was made against the Japanese Americans who lived there, and he said that espionage was already taking place.

Roosevelt's 1941 State of the Union Address, known colloquially as the "Four Freedoms" speech. In it, he presented a strong vision of a future in which everyone has freedom of expression and religion, as well as freedom from lack and fear. It was delivered on January 6, 1941, and it contributed to influence the course of history.

Roosevelt's economic policies were attacked, particularly the shift in tone from individualism to collectivism with the enormous expansion of the welfare state and economic regulation.

Learn more about to Roosevelt's

https://brainly.com/question/28692206

#SPJ4

PLEASE HELP ME!!! IT'S THE LAST DAY AND I HAVE A D IN THIS CLASS!!! PLZZZ HELP

What was the main reason the Soviet Union crumbled in the 1980s?
A. Glasnost led to rebellion against communist rule around the world.
B. The Soviet economy could not match U.S. military spending while meeting citizens’ demand for consumer goods.
C. Policies introduced by Mikhail Gorbachev resulted in the Soviet Union losing its main source of income.
D. The United States convinced Soviet leaders to abandon communist economic policies.

Answers

Answer:

b

Explanation:

Answer:

The correct one would be B, in this case!

Explanation:

- 英辞郎 <3

How did the Federalists manage to get the Massachusetts and New York legislatures to ratify, respectively (different reasons)

Answers

In order to get the Massachusetts and New York legislatures to ratify, the Federalists promised to add amendments specifically protecting individual liberties.

Legislatures play an important role in ratifying laws and regulations. In this process, the legislature is responsible for assessing a proposed bill, determining whether it is in line with the state or country's values, and ultimately voting on whether to approve or reject it.

This step is essential in creating laws that will protect citizens and preserve order within a society. As such, it is important that legislators thoroughly examine the implications of any proposed bill before voting to ratify it. It is important to get bills ratified in order to convert them into a law.

To know more about ratify, click here.

https://brainly.com/question/11969466

#SPJ4

Military discipline is vital to the combat readiness of any military force. What does discipline stand for

Answers

Discipline is an essential part of any military force and refers to the  norms of  geste that are anticipated of its members.

It's the art of administering obedience, order and  concinnity among the members of an association. Discipline is essential in order for a military force to operate effectively and efficiently. It's the foundation of success in any military association.   Discipline is grounded on the conception of obedience. Every dogface must  observe the orders given to him or her without question. This requires a high  position of respect for authority and for the orders of their  elders. In addition, dogfaces must be physically and mentally fit, and ready to take on any task that's assigned to them.

To know more about military force visit:

https://brainly.com/question/17895707?referrer=searchResults

#SPJ4

Select all that apply. Macy had a big project due in another class, so she only has a few hours left to finish her quiz. However, when she attempts to access the quiz, her internet stops working. What should Macy do

Answers

Macy had a big project due in another class, so she only has a few hours left to finish the quiz. So, when she tends to attempt to access the quiz, her internet stops working. So, Macy should immediately call the UF helpdesk in order to obtain a ticket number.

When Macy's internet stops working while she tries attempting the quiz then Macy should immediately call the UF helpdesk so that she can obtain a ticket number, and then also contact the course coordinator in order to explain the situation which is seen to be prior to the deadline's close.

However, Macy had a big project due in another class. So if any problem arised she should thus contact the UF helpdesk. Thus, the UF Computing Help Desk tends to provide self-help, in-person.

Hence, UF helpdesk are quite important in the process.

To learn more about the coordinator here:

https://brainly.com/question/17548249

#SPJ4

During the Yuan Dynasty

we see

after

it had been thrown out by

the Tang Dynasty.

A. Judaism reintroduced

B. Hinduism reintroduced

C. Christianity reintroduced

Some One PLEASE HELP IVE BEEN ASKING THE SAME QUESTION OVER AND OVER AND NO ONE WILL HELP PLEASE

Answers

Option (a), Judaism is reinstated under the Yuan Dynasty, having been expelled by the Tang Dynasty.

What form of religion experienced a resurgence during the Tang Dynasty?

Buddhism in China reached its apex during the Tang period. Although they favoured Buddhism, which had become fairly popular, the Tang emperors often practiced Daoism personally.

In the Yuan Dynasty, what was returned?

It wasn't until Toghon Temür's rule that the Yuan dynasty administration attempted to restore copper coins for use in commerce.

After the Yuan Dynasty was overthrown, what happened?

In 1367, Zhu Yuanzhang formally began an onslaught that would prove deadly to the dishonest and corrupt Yuan administration. A year later, Zhu's forces captured the Yuan capital of Dadu (now Beijing). The Yuan Dynasty was quickly succeeded by the Ming Dynasty (1368–1644).

Learn more about Yuan Dynasty: https://brainly.com/question/29774513

#SPJ4

PLEASE HELP ME ASAP (REPOST)
What is meant by the term bystander effect?

A. People can find that a group may be too large to have any cohesiveness.
B. Individuals tend to take more responsibility for reporting crimes than do groups of people.
C. Individuals may have more difficulty describing a person who committed a crime.
D. People tend to have more fun when they are in groups instead of being alone.

AP_EX - SOCIOLOGY

Answers

Answer:

B- individuals tend to take more responsibility for reporting crimes than do groups of people

Explanation:

crowds of people make it easier for individuals to ignore crimes, since an individual would think it's okay to ignore crimes if others are ignoring it.

Learning is strengthened each time a response is followed by a satisfying state of affairs, according to the law of

Answers

Learning is strengthened each time a response is followed by a satisfying state of affairs, according to the law of Operant Conditioning

Operant conditioning, often known as instrumental conditioning, is a type of learning that use incentives and penalties to alter behaviour. Reward-based conduct is more likely to be repeated through operant training, whereas punishment-based behaviour is less likely to happen.Positive Reinforcement, Positive Punishment, Negative Reinforcement, and Negative Punishment are the four basic quadrants of Operant Conditioning Theory.By rewarding their kids when they behave well, parents can teach their kids through operant conditioning. giving them a piece of candy after they tidy their room. allowing kids to play computer games after finishing their assignments.

To know more about Operant Conditioning here

https://brainly.com/question/25877954

#SPJ4

What i the Matthew Effect? Explain how Gladwell ue the Matthew Effect to explain athletic ucce ociologically rather than individually? You may want to think about the concept of accumulative advantage when reponding to thi quetion

Answers

The Matthew Effect is a concept from the Bible, which states that "to those who have, more will be given, and they will have an abundance. But from those who have nothing, even what they have will be taken away."

In the context of sociology, the Matthew Effect refers to the idea that small initial advantages or disadvantages can accumulate over time, leading to larger and larger disparities between individuals or groups. This concept is often applied to explain success or failure in various domains, such as education, income, or athletics.

In his book "Outliers: The Story of Success," Malcolm Gladwell uses the Matthew Effect to explain how small initial advantages or disadvantages can accumulate over time to create large disparities in athletic success. For example, Gladwell argues that the birthdate of an athlete can have a significant impact on their success. Athletes born in the first few months of the year in a given sport's age-class system have a physical advantage over those born later in the year, due to their size and maturity. This advantage can accumulate over time, leading to more opportunities for practice, coaching, and competition, which can ultimately lead to greater success.

To learn more about Matthew Effect visit: https://brainly.com/question/14241467

#SPJ4

Your question seems to be missing, but I assume the complete question was:

"What is the Matthew Effect? Explain how Gladwell uses the Matthew Effect to explain athletic success sociologically rather than individually? You may want to think about the concept of accumulative advantage when responding to this question."

What was the main reason the Maya sacrificed humans?

Answers

they think sacrificing humans nourished the gods

Explanation:

it was the ritual offering of nouresment to the gods

The ancient Maya civilization practiced human sacrifice as part of their religious beliefs, to appease the gods and maintain the balance of the universe. It was also seen as a way to demonstrate the power of the rulers and to display the devotion of the subjects.

what is the significance of the Gospels in our Christian life at present? ​

Answers

Answer:

Christians get knowledge and understanding of Jesus from the Gospels. Christians regard the Gospels as the Word of God and often treat them with more awe and reverence than other parts of the Bible. Gospel means 'good news'.

Explanation:

The Gospels are Matthew, Mark, Luke, and John. They all go into the life accordance of Christ and have different views.

What two creatures does Edward compare sinners to?

Answers

The two creatures to which the Edward compare sinners to are to the a snake and a spider.

Jonathan Edwards's Sinners in the Hands of an Angry God, which is said to be preached on July 8, 1741 in Enfield, Connecticut, is said to be an appeal to 'sinners' for them to recognize that they will be judged by God and so this kind of judgment will be more fearful and painful than they could even comprehend.

However, the two creatures to which Edward compare sinners to in his sermon are a snake and a spider. Thus, he chose the spider as like humans when put over a fire both will do anything to get away from it before dying.

Hence, Edward tends to compare the God's wrath to likeliness of a bow and arrow.

To learn more about a sermon here:

https://brainly.com/question/29461383

#SPJ4

What is the mean weight of the sampling distribution of the means for a random sample of 50 players?

Answers

The sampling distribution for size 50 player will be approximately normal, and the mean for both will be 26.8.

A sampling distribution in statistics is the probability distribution of a specific statistic based on a random sample. The sampling distribution is the probability distribution of the values that the statistic takes on if an arbitrarily large number of samples, each comprising multiple observations, were utilised independently to compute one value of the statistic for each sample. Although only one sample is frequently observed, the theoretical sampling distribution can be determined.

The use of sampling distributions in statistics is crucial because they significantly simplify the process of drawing conclusions from statistical data. More particular, they make it possible for analytical considerations to be focused on a statistic's probability distribution rather of the combined probability distribution of all the sample values.

Visit here to learn more about sampling distribution: https://brainly.com/question/29451043

#SPJ4

Please help me 100 points!!!

Answers

Answer:

David Conner Treen Sr. was an American politician and attorney from Louisiana. A member of the Republican Party, Treen served as U.S. Representative for Louisiana's 3rd congressional district from 1973 to 1980 and Governor of Louisiana from 1980 to 1984. Treen was the first Republican elected to both offices since Reconstruction.

David Conner Treen Sr. (July 16, 1928 – October 29, 2009) was an American politician and attorney from Louisiana. A member of the Republican Party, Treen served as U.S. Representative for Louisiana's 3rd congressional district from 1973 to 1980 and Governor of Louisiana from 1980 to 1984. Treen was the first Republican elected to both offices since Reconstruction. Born in Baton Rouge, Louisiana, Timeline

1972:  

For the general election against Edwards held on February 1, 1972, Treen campaigned vigorously with billboards which said, "Make a Real Change", and television spots, but he lost.

1978:  

Because he faced no opposition in the primary, no votes were tabulated for his district in the general election on November 7, 1978, and Treen won reelection by default.

1979:  

Foster became only the second Republican to be elected governor of Louisiana in the 20th century, following Treen's historic election in 1979.

1980:  

At a fundraiser in Thibodaux to celebrate his 55th birthday, Treen said that Edwards in 1980 "left a pile of unpaid bills and a stinking surplus of hazardous waste dumps."

1994:  

On June 30, 1994, Treen announced a comeback candidacy for governor of Louisiana.

2009:  

After leaving the governor's office, Treen continued to be politically involved in Louisiana, running for Congress and endorsing gubernatorial candidates as recently as 2008

I think the guy above me did a good job

What is the term for words that sound the same but have different meanings and/or spellings? antonym homonym opposites synonym

Answers

Answer:

The term is:

B. homonym

Explanation:

A homonym is a word that is pronounced and spelled the same way as another word. However, the meanings are different. You can see that this definition is a bit different from the one given in the question. It's because that one actually refers to a homophone, which has the same sound but different spellings. But, since we do not have the option "homophone" to choose, the best one is "homonym". In any case, homonyms are also homophones, but homophones are not necessarily homonyms.

Take a look at the examples below.

Homonyms: pen (to write) - pen (to place animals in); tire (of a car) - tire (verb)

Homophones: here - hear; hair - hare; break - brake

did the treaty become activated as soon as he signed it? _________ why or why not?

Answers

No, the pact was not made into US policy when President Wilson signed it. The Senate did not approve the agreement. The Constitution also addresses this in Article II, Section 2, which gives the Senate the authority to approve treaties that the President has negotiated.

What was the Treaty of Versailles?

The most well-known idea of US President Woodrow Wilson was the League of Nations. He provided 14 recommendations for maintaining and restoring peace following the Great War (World War I). The League of Nations was founded as a result of the Treaty of Versailles, which supported the idea of establishing such a worldwide organization.

There was, however, little support for the US joining any alliance that may restrict its authority over its own affairs or involve it once more in conflicts unrelated to its own domestic national security. Due to its resistance to the United States being a member of the League of Nations, the US Senate decided not to ratify the Treaty of Versailles.

Learn more about the Treaty of Versailles, here:

https://brainly.com/question/1800157

#SPJ1

What effects did the British Raj have on India?

Answers

India's economy suffered greatly under the British Raj. Because they needed inexpensive raw materials to support British industries in England, the British initially seized India.

What was British Raj?

The Indian subcontinent was ruled by the British Crown from 1858 to 1947, and this period is referred to as the British Raj, sometimes known as Crown rule or Direct rule in India. Contemporarily, the region governed by the British was referred to as India and contained areas directly handled by the UK, collectively known as British India, and areas ruled by indigenous leaders but subject to British paramountcy, known as the princely states. This system of governance was established on June 28, 1858, when the British East India Company's company authority in India was passed to the Crown in the person of Queen Victoria following the Indian Rebellion of 1857.

To learn about leaders, visit:

https://brainly.com/question/13565845

#SPJ4

to be characterized as a "good" under the ucc, an item of property must be movable. true or false

Answers

True. To be characterized as a "good" under the ucc, an item of property must be movable.

The Uniform Commercial Code (UCC) is a set of commercial laws governing financial contracts and transactions valid interstate.

The UCC Code consists of nine separate clauses, each covering different aspects of banking and credit.

Companies operating outside their home country must comply with the Uniform Commercial Code (UCC).

The UCC code has been fully adopted in most states and slightly adapted in others.

The Uniform Commercial Code (UCC) was introduced by a private organization, not Congress.

To know more about UCC, here:

https://brainly.com/question/8476938

#SPJ4

______ leadership helps employees pursue organizational goals over self-interests.
1.Transactional
2.Shared

Answers

The transformational leadership helps the employees pursue organizational goals over self-interests.

What is meant by transformational leadership?

Transformational leadership is a leadership style that affects both individual and societal change. In its ideal form, it influences followers significantly and favorably with the aim of transforming them from followers into leaders. Transformational leadership is characterized by four elements: idealistic influence, inspirational motivation, mental stimulation, and individual consideration.

To assist managers in implementing this strategy at work, each aspect will be covered. To help one another and the organization as whole, transformational leaders concentrate on "transforming" others. In response, followers of a transformative leader experience trust, adoration, loyalty, and respect for the leader and are more motivated to put in more effort than they had anticipated.

To learn more about transformational leadership, visit:

https://brainly.com/question/11210892

#SPJ4

The complete question is:

______ leadership helps employees pursue organizational goals over self-interests.

1.Transactional.

2.Shared.

3.Laissez-faire.

4.Transformational.

Large, impersonal groups with minimal emotional and intimate ties are referred to as ______.
a. secondary groups
b. principal groups
c. reference groups
d. remandiary groups

Answers

I’m pretty sure the answer is A

15) The method of development in this document is A) cause and effect. B) sequence of events C) order of importance. D) chronological order.

Answers

There are four methods of development that is A) cause and effect. B) sequence of events C) order of importance. D) chronological order are importants methods to develop and organizing the ideas and content in the documents.

Development can be defined as the writers choose to elaborate their main ideas. We associate development with some specifics help that make the main thoughts or ideas or claim or more concrete.

Some examples of developments in the of areas for employees like collaboration, conflict resolution, organization, communication, adaptability, listening skills and setting a goals.

Learn more about method of development click on the link here:

https://brainly.com/question/1202509

#SPJ4

38) When the colony of Georgia was founded, colonists received land from the Yamacraw Indians. Who was the leader of the Yamacraw

Answers

Tomochichi was the mico, or chief, of the Yamacraw Indians. The Yamacraw were a small band of Lower Creek Indians that lived in coastal Georgia when Oglethorpe arrived with the colonists.

Who acted as interpreter between the new colony of Georgia and the Yamacraw Indians?

He died the subsequent yr and, eventually, Mary Musgrove moved the buying and selling post, know as Cowpens, to Yamacraw Bluff. It became one of the most necessary trading posts in the area. She served as Oglethorpe's fundamental interpreter from 1733 until 1743.

What took place to the Yamacraw Indians?

They have been made up of Lower Creek and Yamasee, and remained impartial for about 20 years earlier than integrating again with the primary section of the Lower Creek people. This region was later developed as the town of Savannah.

Learn more about Yamacraw Indians here:

https://brainly.com/question/3184409#SPJ4

3.) What is a representative governor?
a.) A government which represents England
.) A government
which represents officials
) A government
with officials that represent the people
) A government which is unfair to the people

Answers

Answer:

A government with officials that represent the people

neisser’s challenge to cognitive psychologists included all of the following except...

Answers

Neisser’s challenge to cognitive psychologists included all of the following except d)cognitive psychologists have not made any firm conclusions regarding how memory works.So,correct option is d.

Cognitive psychology research includes the investigation of interior mental cycles — every one of the operations inside your mind, including discernment, thinking, memory, consideration, language, critical thinking, and learning.

Cognitive psychologists investigate a wide assortment of points connected with thinking processes. A portion of these include:

Consideration - our capacity to handle data in the climate while blocking out unimportant subtletiesDecision based conduct - activities driven by a decision among different potential outcomesIndependent directionNeglectingData handlingLanguage procurement - how we figure out how to peruse, compose, and communicate our thoughtsMemoryCritical thinkingDiscourse discernment how we process what others are talking aboutVisual discernment - how we see the actual world around us.

Hence,correct option is d.

To know more about  cognitive psychologists,visit here:

https://brainly.com/question/28167182

#SPJ4

(Complete question) is:

Neisser's challenge to cognitive psychologists included all of the following except

a) cognitive psychology research on memory has tended to be boring and trivial

b) cognitive psychologists have demonstrated little more than a child would be able to intuit

c) cognitive psychologists do not study important or relevant aspects of memory

d) cognitive psychologists have not made any firm conclusions regarding how memory works

(PLEASE ANSWER IN SHORT ESSAY FORMAT)

Eastern and Western cultures are fundamentally different and enjoy different types of quality of life. Identify
and describe the differences between Eastern and Western cultures. Include at least two key differences for
each culture.

Answers

People from the east are more conservative than people in the west.  In the east, priority is given to family and elders while the western culture gives emphasis to individuals.

What are the key differences between eastern and western cultures?Asia and the Middle East are referred to as the "Eastern world." When it comes to rituals, customs, clothes, etc., eastern people are more conventional than western people.People from the East have inflexible views and beliefs, and they are frequently hesitant to examine or criticize long-standing traditions and practices.Elders are revered and obeyed by youngsters in eastern countries because they are seen as the head of the household. Elders typically make the crucial decisions about the destiny of children. Children are supposed to care for their parents as they get older.In eastern nations, arranged marriages are a widespread occurrence. Typically, elders or parents arrange them.North America and Europe are the two primary parts of the Western World. The west is home to a more tolerant population than the east. Westerns are more honest and open-minded.Additionally, people in the west are more honest about their emotions. They might vent their anger if they are. But out of courtesy and diplomacy, individuals in the east might hide it. Westerners are likewise free to publicly express their feelings and emotions.A person also has more flexibility and authority to make choices on his own than those in the east because the individual is prioritized over the family. As a result, ideas like arranged weddings are unusual in the west.

To know more about Western culture, check out:

brainly.com/question/29391216

#SPJ1

what did gold miners face in the 1900

Answers

Some miners were injured in explosions or electrocuted. Others fell off ladders, slipped on rocks, inhaled silica dust, or suffered from mercury, lead or arsenic poisoning. Many got sick from drinking dirty water and living too close together.

Answer:
miners were exposed to loneliness and homesickness, isolation and physical danger, bad food and illness, death, and flooding.


Explanation:

All living organisms, including animals, plants, fungi, bacteria, and protists, must perform certain processes in order to survive. For example, all living organisms must be able to obtain energy so they can use that energy to perform their life functions. In what part of a living organism do these life functions occur?

Answers

Answer:

tissues

Explanation:

its when our cells helps us maintain and do it

Other Questions
How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove A nurse is caring for a patient with SIADH. What severe complication should the nurse assess for?a.Strokeb.Diabetes insipidusc.Neurologic damaged.Renal failure Find the measure of angle A, Find the error with subject-verb agreement. Select the incorrect verb and type it correctly.In Chile's arid Atacama Desert there is areas where any rainfall has yet to berecorded Una onda sonora se produce durante 1,5 s. Posee una longitud de onda de 2,4 m y una velocidad de 340 m/s. a) Cul es la frecuencia de la onda?, Ezra has a hard time sticking with exercise routines. He does well for a few weeks, but then tends to slack off a bit. What would be the BEST way for Ezra to motivate himself to stay on the program that he creates for himself? Read the excerpt from "This World is not Conclusion by Emily Dickinson.This World is not Conclusion.A Species stands beyond -Invisible, as Music -But positive, as Sound -It beckons, and it baffles -Philosophy, dont know -And through a Riddle, at the last -Sagacity*, must go.*the quality of being perceptiveWhich statement best describes how capital letters add to the poems overall meaning?They emphasize ideas that cannot easily be understood.They highlight things the speaker would like to do.They suggest that the speaker often overthinks problems.They explain why the world will continue forever.