What were Percy problem in chapter3

Answers

Answer 1
Paragraph 6 I believe

Related Questions

another word of (hello) ?

Answers

Answer:

Greetings, Hi, Howdy, Yo

Explanation:

Hi, Hey, Welcome, Greetings,

1. I am seven letters long.
2. My 1, 2, and 3 will keep you warm.
3. Without 1, 2, and 4, it really hurts.
4. My 1, 5, and 7 are a positive verb.
5. Put all my letters together and I give
the orders.
What am I?

Answers

Answer:

Captain

Explanation:

1) Captain= 7 letters long

2) 1,2,3 = Cap, keeps you warm

3) Without 1,2,4= pain

4) 1,5,7= Can

5) Captain=gives orders

THUS you're a Captain

Hope this helped you- have a good day bro cya)

Answer:

The answer is a postbox/mailbox because if you remove a physical letter from it, it remains a mailbox; its meaning is still to hold letters. You can remove all the letters, but it will still be a mailbox.

Explanation:

What does Morris say photojournalists do and think is important?

Answers

The passage was not posted here. However, in his writing, GET THE PICTURE : A Personal History of Photojournalism , John G. Morris thinks that;

Photojournalists tell stories through their work. They were in the same capacity as Journalists who report stories and this is important.

John G. Morris is a photojournalist who believes that pictures tell stories. He thinks that the abundance of pictures makes people incognizant of the importance of stories.

Photojournalists make pictures that have meaning. Their pictures reveal the truth. This is an important factor that must remain primary than making a lot of money.

Learn more here:

https://brainly.com/question/19312193

In animal farm, chapter 2.
the pigs begin to slowly take more control than others. give examples that shows this.

Answers

Answer:

The 'bit and spur' and 'whips' are used to cruelly keep the animals under control. The animals fight back against the men and take control of the farm. The pigs take charge and begin to control the other animals. Napoleon uses Squealer and the dogs to stop the animals' questions about the windmill.

Explanation:

hope this helps you sorry if it does not

Write a paragraph about the plot of Toy Story. Use proper and common nouns

Answers

Answer:

Woody (Tom Hanks), a good-hearted cowboy doll who belongs to a young boy named Andy (John Morris), sees his position as Andy's favorite toy jeopardized when his parents buy him a Buzz Lightyear (Tim Allen) action figure. Even worse, the arrogant Buzz thinks he's a real spaceman on a mission to return to his home planet. When Andy's family moves to a new house, Woody and Buzz must escape the clutches of maladjusted neighbor Sid Phillips (Erik von Detten) and reunite with their boy.

Explanation:

How do i know whats the numer of the paragraph in this article this is confusing

Answers

Answer:

I can only see two.

Explanation:

Answer:

count each paragraph from begining to end

Explanation:

1 + 1 +4+4-8+8-2
I bet u​

Answers

Answer:

8

Explanation:

1+1+4+4-2= 10-2= 8

lol

Which answer best summarizes “The Wife”?

When a young couple faces a financial crisis, they learn an important lesson about the value of love over material wealth.

A newlywed couple squander their fortune and are forced to move from their fancy home in town to a cottage in the country.

Leslie and Mary are a perfectly matched couple who are admired by friends and respected by affluent members of the community.

After Leslie suffers financial ruin, a good friend first helps him tell his wife what happens and then helps him recover his losses.

Answers

The answer is A) When a young couple faces a financial crisis, they learn an important lesson about the value of love over material wealth.

When a young couple faces a financial crisis, they learn an important lesson about the value of love over material wealth is best summarizes “The Wife”. Hence, option A is correct.

What is financial crisis?

Any of a wide range of situations where some financial assets unexpectedly lose a sizable amount of their nominal value constitutes a financial crisis. In the late 19th and early 20th centuries, there were numerous financial crises and banking panics, which were followed by numerous recessions.

The housing bubble, which was fueled by cheap credit and lax lending standards, was the primary factor in the financial crisis of 2008. After the bubble burst, the banks were left holding worthless investments in subprime mortgages worth trillions of dollars.

According to the conventional definition, which calls for two consecutive quarters of negative gross domestic product, the United States had a recession.

Thus, option A is correct.

For more details about financial crisis, click here:

https://brainly.com/question/13082160

#SPJ2

Everyone (has/have) done his or her homework.

Answers

Everyone (has) done his or her homework because 'everyone' means plural so there is plural already so don't need to put 'have'.

strong storms caused extensive damage to the new bank.

What's the noun and adjective?

Answers

noun. noun. /ˈdæmɪdʒ/ 1[uncountable] damage (to something) physical harm caused to something that makes it less attractive, useful, or valuable serious/severe/extensive/permanent/minor damage brain/liver, etc.

Carlos saw the first installment of his favorite movie series when he was in fourth
has watched each new film in the series on the night it opened in his local theate
liked the movies' fast-paced action and special effects. When the scheduled rele
installment was announced, Carlos marked his calendar and planned to see the
night. But when he and his dad tried to purchase tickets online, every show was
Which sentence provides an objective summary of the paragraph?
O A. Carlos is a movie enthusiast who wants to buy tickets for the latest install
action movie series.
O
B. Carlos follows an action movie series for years and plans to see the final
opening night, but it sells out before he can buy tickets.
O C. Carlos enjoys going to the theater to see action movies, but he is disapp
no tickets available for his favorite film.
O D. Carlos has been a dedicated fan of a series of action movies ever since
and plans to go to the theater to watch the finale.

Answers

Answer:

B

Explanation:

This summary includes his following the series for years and the tickets selling out before he can get them. This summary includes the two most important facts.

the first answer doesn't say anything about the tickets selling out, which is one of the most important facts.

C doesn't say anything about him following the series for years, which is an important fact to include.

D doesn't say anything about going to get tickets and them being sold out. That is an important fact to include.

Hope this helps!

Commonlit

1. PART A: Which of the following identifies the central idea of the text?

A. The Lovings' challenge of their unjust conviction resulted in the right of other
interracial couples to marry.

B. The Lovings took their conviction to the Supreme Court because they wanted
every interracial couple to be allowed to marry.

C. The Loving Decision has eliminated long-held prejudices concerning the
marriage of interracial couples.

D. The Lovings returned to Virginia to make a political statement on the state's
unconstitutional laws regarding interracial marriage.

Answers

The central theme of the text is to show how the Lovings' challenge and the wrongful conviction they had resulted in the right of other interracial couples to marry.

We can arrive at this answer because:

The text tells the story of Robert and Mildred Loving, an interracial couple who were convicted and imprisoned in Caroline County.That's because they got married in Washington, where interracial marriage was allowed, and when they returned to Caroline County, their home region, they were arrested, because there, marriage was considered illegal.They had to move to Washington to be able to live in freedom, but that was not a good situation as their family and friends live in Caroline County, which they couldn't enter.For this reason, they had to fight in court for the right to have their marriage recognized throughout the country.

The Lovings didn't aim to make this challenge national, they just wanted to have the right to be a normal couple, but the legal fight they got involved in resulted in the right of other interracial couples to marry. This is the central idea of ​​the text.

This question is related to the text "Living Decision: 40 years of legal interracial union."

More information:

https://brainly.com/question/15666633?referrer=searchResults

How does the author explain that aboriginal tribes in Australia share some of the same beliefs?


They all have sets of sisters who are gods and give names to animals and plants.

They all tell of a Dreamtime in which the spirits created the earth.

They all have stories about how floods destroyed the world.

They all have stories of a sun goddess who lights the world with a torch.

Answers

Answer:

They all have stories of a sun goddess who lights the world with a torch.

Explanation:

The author explains that aboriginal tribes in Australia share some of the same beliefs because:

D. They all have stories of a sun goddess who lights the world with a torch.

According to the given question, we are meant to show the shared beliefs which the aboriginal tribes in Australia has and how their cultures seem to intertwine.

As a result of this, we can see that based on the descriptions of the author about the aboriginal tribes in Australia and their shared beliefs, the conclusion we can come to is that they all have stories of a sun goddess who lights up the world with a torch.

Therefore, the correct answer is option D

Read more here:

https://brainly.com/question/20238005

oh no! everyone has a nasty cold around you! write a silly poem about how you try to avoid catching their germs!

Answers

Answer:

la la la la

la la la la

la la la la

sorry bro I don't know how to write even a silly poem. Actually I cannot even understand the question because I am not good at English

take a look at this picture. what can you say about it?​

Answers

Answer:

You can say that people are always connected to the internet somehow, and from anywhere in the world. And it can have negative effects

Explanation:

what does article 1 of the U.S constitution establish?

Answers

Answer:

Article One of the United States Constitution establishes the legislative branch of the federal government, the United States Congress. ... Article One's Vesting Clause grants all federal legislative power to Congress and establishes that Congress consists of the House of Representatives and the Senate.

Explanation:

please mark me as the brainliest

have a beautiful day

Answer:

Article One of the United States Constitution establishes the legislative branch of the federal government, the United States Congress.

Explanation: PLS MARK BRAINLIEST

I live in a/an ____ with my parents and my elder sister in the coastal area.

A. extended family B. nuclear family

C. extended house D. nuclear house

Answers

Answer:

extended house

Explanation:

because we live in house

I need to write a 120 word essay for school regarding our class work

Answers

Okay what’s it about?
Well, that does not seem too bad. It depends on what grade you’re in, and if you can, try looking on different websites for inspiration on that topic (NO PLAGIARISM) Always give credits! But i think you can do it and i believe in you

a speaker uses logos to persuade the audience when

Answers

Answer:

showing how evidence and ideas are linked together.

i hope (help) orther people with their work chia động từ trong ngoặc

Answers

Answer:

ooh reolli help me mark brainliest

What is the theme of "The Horse and the Loaded Donkey"

Answers

Long journeys are difficult. Friends are willing to help each other. Selfishness is not rewarded. Moral: You get nothing from being selfish.

(credits to tah internet)

1. John ............................... tennis once or twice a week.A. is playing usuallyB. is usually playing C. usually plays D. plays usually2. Jim is away on holiday. He ........................ to Spain.A. is gone B. have been C. has been D. was3. Everything is going well. We ....................... any problems so far.A. didn’t haveB. don’t haveC. haven’t had D. hadn’t had4. Timson ...................... 13 films and I think her latest is the best.A. made B. had made C. has made D. was making5. ................................. Robert lately ?A. Did you seeB. Have you seen C. Do you seeD. Are you seeing

Answers

Answer:

Explanation:

1.  C

2. C

3.  C

4.  c

5.  B

To complete the sentences, the options required for sentences 1 - 5 are options C, C, C , C, and B respectively.

What are sentences?

Sentences are groups of words which contain a subject and a predicate and which are completely meaningful.

To complete, the given sentences the following are used to fill the gaps:

usually plays; option Chad been; option Chaven't had; option Chas made; option CHave you seen ; option B

Therefore, the correct options will make the sentences complete.

Learn more about sentences at: https://brainly.com/question/11352260

#SPJ2

Select the time transition that best fits the sentence.

Although Edie had thought about quitting _________, now she felt that she would stay forever.

in the future
immediately
in the past
the day after tomorrow

Answers

Answer:

C. In the past

Explanation:

"had thought" meaning past tense.

Hope this helps :)

1. The --------- in my constituency worry about their financial predicament.

Answers

Answer:

poor

Explanation:

only the poor in society worry of their economic and financial spending

If a church has a small congregation, do many people belong to it?

Answers

Answer:

They might have a small group/crowd of people.

Explanation:

“On the whole” is this type of transition:

Answers

What do you mean by that?

please give valid points . How does illegal mining affect cocoa farms or agriculture​

Answers

Answer:At least 30 cocoa farmers in the village have sold their land to miners who quickly excavated, pumped in water and chemicals, and abandoned their pits when the work was done or when soldiers chased them away. ... These often illegal operations can result in contaminated water, deforestation, and a rise in violent crime..

Read the excerpt from "The New Marvel in Photography" by H. J. W. Dam.

In all the history of scientific discovery there has never been, perhaps, so general, rapid, and dramatic an effect wrought on the scientific centres of Europe as has followed, in the past four weeks, upon an announcement made to the Würzburg Physico-Medical Society, at their December meeting, by Professor William Konrad Röntgen, professor of physics at the Royal University of Würzburg. The first news which reached London was by telegraph from Vienna to the effect that a Professor Röntgen, until then the possessor of only a local fame in the town mentioned, had discovered a new kind of light, which penetrated and photographed through everything. This news was received with a mild interest, some amusement, and much incredulity; and a week passed. Then, by mail and telegraph, came daily clear indications of the stir which the discovery was making in all the great line of universities between Vienna and Berlin. Then Röntgen's own report arrived, so cool, so business-like, and so truly scientific in character, that it left no doubt either of the truth or of the great importance of the preceding reports. . . .

Exactly what kind of a force Professor Röntgen has discovered he does not know. As will be seen below, he declines to call it a new kind of light, or a new form of electricity. He has given it the name of the X rays.

The central idea of this excerpt is developed through
scientific proof.
cautious excitement.
medical facts.
stated disbelief.

Answers

The central idea of this "The New Marvel in Photography" by H. J. W. Dam is developed through cautious excitement. Thus, option (b) is correct.

What is the central idea?

The central idea refers to the text's fundamental objective, which is to correct the theme and statement. Most of the time, the main idea can be communicated in a single sentence. The primary concept is to correct the story's message based on its topic. The primary idea is the topic's main words highlighted.

According to the poem was the  "The New Marvel in Photography" by H. J. W. Dam. The central idea of the poem  "The New Marvel in Photography" is the cautious excitement. The avoiding the danger zone or risk. The cautious is the behavior of the person.

As a result, the central idea of this "The New Marvel in Photography" by H. J. W. Dam is developed through cautious excitement. Therefore, option (b) is correct.

Learn more about on central idea, here:

https://brainly.com/question/8282081

#SPJ6

Answer:

The central idea of this "The New Marvel in Photography" by H. J. W. Dam is developed through cautious excitement. Thus, option (b) is correct.

Explanation:

the use of perfect tenses of the verb is important because _____​

Answers

Answer:

Perfect verb forms also apply to past and future tenses, where an event took place before another or will be completed in the future before another action.

Explanation:

Communicating events with indiscrete times can be tricky in English. The present perfect tense is supposed to make this easier. If you want to explain an event that happened at an indefinite time in the past or that began in the past and continues into the present.

In "The Pardoner's Tale" of Chaucer's The Canterbury Tales, what is one characteristic of an allegory?
O A. a story that occurs within the story
O B. rhyming of every two lines
O C. a tale that is told as a long prose poem
O D. the use of characters to stand for ideas

Answers

Answer:

D

Explanation:

the use of characters to stand for ideas

Answer:

D. the use of characters to stand for ideas

Other Questions
HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death. Why the allied powers pinpointed Germany at the person guilty for starting world war 1 How did the mandates after World War I create conflict in Southwest Asia? A. Jews and Arabs were given their own separate mandates. B. Mandates were forced to adopt French or English as an official language. C. Mandates were required to adopt democratic forms of government. D. The borders of mandates often ignored ethnic and religious divisions. I have of an hour to finish 6 homework assignments. How much time can I spend on each assignment? Mention the ways of safe abortion(like what should the woman do??)need help fast