what was the main goal of the proposed equal rights amendment?

Answers

Answer 1

Answer: The main purpose is to propose a constitutional amendment to ensure equal legal rights for all Americans regardless of gender.

Explanation:


Related Questions

7) steven needs to write a will. his best resource is (a) group of answer choices a) mediator. b) small claims court. c) attorney. d) arbitrator e) class action lawsuit.

Answers

Steven's best resource for writing will would be a qualified attorney.

What is an attorney?

An attorney, also known as a lawyer or counsel, is a professional who is trained and licensed to practice law. Attorneys provide legal advice and represent clients in legal proceedings, such as negotiations, mediation, arbitration, and court trials. They can work in a variety of settings, including private law firms, government agencies, non-profit organizations, and corporations. Attorneys must have a thorough understanding of the law and legal procedures and be able to apply them effectively to the specific needs of their clients. They must also possess strong analytical and communication skills, as well as the ability to think critically and creatively to resolve complex legal issues. The legal services provided by attorneys are essential to ensuring justice and upholding the rule of law in society.

To learn more about attorney, visit:

https://brainly.com/question/30837954

#SPJ1



In a theocracy like Malaysia, what is a dual system of law?

Answers

In Malaysia, the legal system operates on a dual system of law, which consists of civil law and sharia law.

Civil law is based on the English common law system and is applicable to all Malaysians regardless of their religion. Sharia law, on the other hand, is based on Islamic law and is applicable only to Muslims. Sharia law governs various aspects of a Muslim's life, including marriage, divorce, inheritance, and certain criminal offenses. Sharia courts in Malaysia are responsible for enforcing and interpreting sharia law, and their decisions are binding on Muslims. The civil courts, on the other hand, have jurisdiction over all matters, including civil and criminal cases involving non-Muslims and civil cases involving Muslims. However, civil courts are not authorized to decide on matters that fall under sharia law. While the dual system of law in Malaysia is intended to accommodate the country's multi-religious and multi-ethnic population, it has also been criticized for creating inconsistencies and conflicts between the two legal systems. In some cases, there have been disputes between the civil courts and sharia courts regarding their respective jurisdictions and legal interpretations.

To know more about Sharia law:

https://brainly.com/question/14788507

#SPJ4

is it illegal to video record someone without their permission

Answers

It is not illegal to record somebody without their assent in a public spot on the off chance that they are noticeable and perceptible, particularly if they don't have sensible assumptions for protection.

The punishment for this offense is given under Area 354 (C) of the Indian Punitive Code. Any individual who is found blameworthy under Segment 354 (C) will be rebuffed with the detainment of at least 1 year which might be stretched out to 3 years and will likewise be obligated for a fine.

Assuming that somebody records you without your consent such that oversteps government or state regulation, you can contact a lawful expert, sue them, and inspire them to pay harm.

Learn more about illegal:

https://brainly.com/question/15681663

#SPJ4

what new york governor resigned due to a prostitution scandal?

Answers

New York governor Eliot Spitzer resigned due to a prostitution scandal.

The New York Times revealed on March 10, 2008, that Eliot Spitzer, the governor of New York, had supported a prostitution ring run by the escort company known as Emperors Club VIP. Eliot Laurence Spitzer, an American politician and attorney, was born on June 10, 1959. He was a Democrat and served as New York's 54th governor from 2007 until his resignation in 2008.

Spitzer won the election for governor of New York in 2006 with the largest margin of victory of any candidate, but his term was short-lived after it came to light that he supported a prostitution ring. Following the scandal, he resigned right away, and David Paterson, his lieutenant governor, completed the remainder of his term.

Learn more about lieutenant governor at:

brainly.com/question/30907826

#SPJ4

Tamsin is 16 years old and the daughter of Tommy and Teesha. Tamsin falls pregnant and wants to get married to Terrence who is 25 years old and the father of the child.
As a general rule, who must consent to the marriage?

Answers

Answer:

As a general rule, Tamsin's parents or legal guardians would need to consent to the marriage since she is under 18 years old and considered a minor. The laws regarding marriage and consent may vary depending on the jurisdiction, so it is important to check the specific laws in the relevant area. In some cases, there may be exceptions or special circumstances that allow minors to marry without parental consent, such as if they have a court order or if they are legally emancipated.

Explanation:

Police work involves the threat of violence such as gunfire, stabbing, or assault
against officers. Provide two examples of other dangers (aside from outright
violence) associated with police work that an officer might face

Answers

Answer:

Law enforcement officers face many hazards in the line of duty. Though injuries from assaults and vehicular accidents are the most obvious, stress, cardiovascular disease, depression, and sulcide are also serious job-related risks.

what is the presidential cabinet member called who does not attend the state of the union address and instead remains in a secure location?

Answers

The presidential cabinet member who does not attend the state of the union address and instead remains in a secure location is called the designated survivor.

What is the state of the union address?

The State of the Union address is a yearly speech delivered by the president of the United States to a joint session of Congress. It is given in late January or early February and is intended to brief Congress and the country about the president's agenda and priorities for the upcoming year.

The designated survivor: The designated survivor is a member of the presidential cabinet who is chosen to remain in a secure and undisclosed location during the State of the Union address.

The designated survivor is chosen to ensure continuity of government in the event of a catastrophic event that kills or incapacitates the president and other top officials who are present at the address.

The designated survivor's responsibilities include, among other things, ensuring that the line of presidential succession remains unbroken and that the government continues to function in the event of an emergency.

The designated survivor is usually a member of the cabinet who is relatively low in the line of succession, so as to minimize the impact of their absence on the government's day-to-day operations.

To know more about presidential cabinet refer here: https://brainly.com/question/12037370#
#SPJ11

what dollar amount must you sue for to be entitled to a jury trial in the state of montana ( in a civil lawsuit)

Answers

$7000 amount must you sue for to be entitled to a jury trial in the state of montana ( in a civil lawsuit).

Action on Small Claims. For your information, the steps to initiate or respond to a small claims action are listed below in brief: 1. The Defendant must be reachable within the county issuing the complaint, and the amount demanded in the complaint cannot exceed $7,000 excluding costs.

Within 60 days of the filing of the affidavit for publication, the summons must be published for the first time or personally served on the defendant outside of Montana. If not, any party who was intended to be served by the publication will have the action dismissed.

Learn more about affidavit at:

brainly.com/question/30833464

#SPJ4

What is the federal definition of underserved communities?

Answers

The federal definition of underserved communities can vary depending on the agency or program in question, but generally refers to areas or populations that have limited access to essential services or resources, such as healthcare, education, or financial services.

For example, the U.S. Department of Health and Human Services defines underserved communities as "populations experiencing health disparities; geographic areas with a shortage of primary care, dental or mental health providers; and/or populations with limited access to healthcare services."

The U.S. Department of Agriculture's definition of underserved communities includes "rural areas and populations, and areas and populations experiencing poverty and persistent poverty."

The Small Business Administration's definition of underserved communities includes "areas with low-income populations or high unemployment rates, and communities that have experienced a natural disaster or a significant economic disruption."

Overall, the federal definition of underserved communities is focused on identifying areas or populations that face barriers to accessing essential services or resources, and may need targeted support to overcome these challenges.

4. CHAPTER 7 (15 points)
Will it ever be realistic to have a world of "electronic lawyers?' How do you see the legal
profession in the twenty-first century? What is it that motivates most lawyers who practice
law today? Will this change?

Answers

Answer:

1.) no one can see the future. but from now we have Ai doing most of our work and even day to day activities, there's a high chance that this well programmed Ai will one day be able or try at least to take the job of lawyers

2.) j see the legal profession as a high well standard profession in which should be respected because of how delicate it is

3.) I think what motivates most lawyers is their strive and hope for justice and how much being a lawyer is a well respected and sometimes well paying job

4.) I think the strive for justice in lawyers will never change because this enters emotional category but that the pay or people doing it may slightly decrease or mostly increase the coming years .

Which of following do you think are sources of authority for security officers?

• Site post orders
• Company's rules and regulations
• Client requirements
• State and/or local laws
• The United States Constitution
• US Department of Homeland Security

Answers

I believe that a security officer's authority comes from the company's rules and regulations.

What is a security officer's primary duty?

Security professionals are responsible for keeping the area safe for both visitors and employees. To do this, they must patrol the area, keep an eye on surveillance tools, examine buildings, protect entryways, and check visitors.

How does access control include the security officer?

collaborates with vendors and internal departments to update and debug software, escalates issues as necessary, and assists in detecting and resolving access control software-related issues. Determines problems and takes action in response to equipment breakdowns, outages, and other incidents.

To know more about security officers visit:-

https://brainly.com/question/12505716

#SPJ1

Steps involved in undertaking temporary management of a financial services entity

Answers

Undertaking temporary management of a financial services entity involves several steps, which are as follows:

Initial Assessment: The first step is to conduct a thorough assessment of the financial services entity to understand its current financial situation, operational processes, and legal obligations. This assessment will help in identifying the underlying problems and the areas that require immediate attention.

Identifying Key Personnel: After the initial assessment, the next step is to identify the key personnel who will be responsible for managing the financial services entity during the temporary management period. The temporary management team should include experienced professionals who can address the identified problems and implement the necessary changes.

Developing a Plan of Action: Based on the initial assessment, the temporary management team should develop a detailed plan of action that outlines the specific steps that need to be taken to address the identified problems. This plan should include timelines, goals, and specific action items.

Implementing the Plan: Once the plan of action has been developed, the temporary management team should begin implementing the plan. This may involve restructuring the organization, changing processes and procedures, and implementing new systems and controls.

Monitoring Progress: During the temporary management period, it is important to monitor progress regularly to ensure that the plan of action is being implemented effectively. Regular progress reports should be prepared, and adjustments should be made as necessary.

Communicating with Stakeholders: It is important to keep stakeholders informed about the progress of the temporary management process. Regular communication with employees, customers, investors, and regulators will help to build trust and maintain confidence in the financial services entity.

Handing over to Permanent Management: Once the temporary management period is complete, the temporary management team should work with the permanent management team to ensure a smooth handover. This may involve providing training and support to the permanent management team and ensuring that all necessary documentation is in place.

A body is found at 9:30 pm. The temperature of the liver registers 84.6F. What is the approximate TOD of the victim?

Answers

Answer: Less than 6 hours.

an inmate who has never received a degree or practiced law, but has become well versed in legal matters while in prison is known as .

Answers

An inmate who has never received a degree or practiced law, but has become well versed in legal matters while in prison is known as jailhouse lawyer.

What is a Jailhouse Lawyer?

A jailhouse lawyer is a term that refers to a prisoner who has received no formal legal training or education but who is well-versed in legal matters due to their time spent in prison. They have a significant amount of knowledge about the legal system and the rules and regulations that govern it. They can aid other inmates with filing legal papers, providing legal advice, and even representing them in court proceedings.

Despite their lack of formal legal education, jailhouse lawyers have proven to be helpful to other inmates who cannot afford legal counsel. However, they are not authorized to practice law, and their assistance is often limited to a specific prison population.

Learn more about law here: https://brainly.com/question/25368237

#SPJ11

in louisiana, what can incur a $500 fine for harassment?

Answers

Sending a surprise gift…

what is stated by the laws of segregation and independent assortment

Answers

Every person has two alleles, and only one of them gets passed down to the next generation, according to the law of segregation. A pair of genes can be inherited independently of another pair, according to the law of independent assortment.

What is the definition of the law of segregation with an example?A single gene copy, chosen at random, is given to each gamete when an organism produces gametes. The law of segregation is responsible for this. In order to forecast the genotypes (combinations of alleles) and phenotypes (observable traits) of offspring from genetic crossings, a Punnett square can be utilized.According to Mendel's law of segregation, each gene separates from the others during gamete production, resulting in each gamete having just one copy of each gene. The second inheritance law is the separation legislation.The alleles for each gene segregate from one another during gamtee production, according to the law of segregation, leaving only one allele per gene in each gamete.

To learn more about law of segregation, refer to:

https://brainly.com/question/25710344

What types of crimes rely on alteration and erasure evidence?

Answers

Answer:  What types of crimes rely on alteration and erasure evidence?

Crimes that rely on alteration and erasure evidence are counterfeiting lottery tickets , counterfeiting checks , and counterfeiting contracts

Explanation:

Answer:

Crimes that involve alteration and erasure of documents or evidence include:

1. Fraud: Altering or erasing documents such as checks, receipts, contracts, or financial statements to deceive someone or gain an unlawful advantage.

2. Forgery: Creating false documents or modifying existing ones to deceive someone, such as forging a signature on a check or altering a will.

3. Tampering with evidence: Altering or erasing evidence with the intention of concealing, destroying, or falsifying it, such as cleaning a weapon to remove fingerprints or deleting files from a computer.

4. Perjury: Altering or modifying written statements or testimony with the intent to mislead or deceive during a legal proceeding.

5. Identity theft: Altering or erasing documents and information to impersonate someone else and steal their identity or commit fraud.

After a lawmaker introduces a bill, what is the next step in the process of that bill becoming law?
a. The bill goes to a committee for review and approval.
b. The bill goes to the governor for signing.
c. The bill is returned to the people for citizen approval.
d. The bill is voted on by the full legislature.

Answers

After a lawmaker introduces a bill, the next step in the process of that bill becoming law is usually for the bill to go to a committee for review and approval.

The committee may hold hearings to gather input from interested parties and may make changes to the bill before sending it back to the full legislature for a vote. If the bill passes both chambers of the legislature, it goes to the governor for signing or veto. If the governor signs the bill, it becomes law. If the governor vetoes the bill, the legislature may attempt to override the veto with a two-thirds vote.

To know more about lawmaker click here:

brainly.com/question/18321409

#SPJ4

QUESTION 4 Read the section on "litigation in a court of law" (Study Unit 4 of your Study Guide) and then differentiate between (i) examination-in-chief and (ii) cross-examination". Give practical examples. ​

Answers

There is a major difference between examination in chief and cross examination according to "litigation in a court of law".

In Examination in chief  the witness is free to provide their perspective during the examination in chief.

You do not want the witness to share their tale during cross-examination. You make a note of the argument you want to make and then present it to the witness. So, in cross-examination, leading questions are employed.

For instance,  In examination-in-chief the testimony is strictly confined to the facts relevant to the issues only, and not to the law.

No leading question is permitted to be asked unless the court allows it.

Whereas in Cross- examination ,The other side has the right to question the witness in cross-examination in order to bring up any pertinent information that was either omitted or was withheld during the main examination.

It is "one of the most beneficial and effective methods of learning the truth."

When the co-respondents' interests are directly at odds with one another, they are permitted to utilize their right to cross-examine.

To know more about Cross Examination visit:

https://brainly.com/question/4710125

#SPJ1

which was the first environmental law that required the u.s. government to consider environmental issues before approving policies? comprehensive environmental response, compensation, and liability act (cercla) toxic substances control act (tosca) clean water act (cwa) national environmental policy act (nepa) clean air act (caa)

Answers

The National Environmental Policy Act (NEPA) was the first major environmental law passed in the United States. It was enacted in 1970 and requires the federal government to consider the environmental impacts of their actions before they are taken.

The law requires that any federal agency or action that may affect the environment must first be evaluated by a thorough environmental assessment.

The assessment must consider any potential impacts on air quality, water resources, wildlife, and more. After the assessment is complete, the agency must then produce an Environmental Impact Statement (EIS) outlining the proposed action and its impacts.


The purpose of the EIS is to provide the public with the information needed to make an informed decision about the proposed action. It is also intended to allow the public to have input into the decision-making process.

This ensures that environmental protection is taken into account when considering government policy.

NEPA is considered the cornerstone of U.S. environmental protection. It has served as a model for environmental policy worldwide, and is often referred to as the "Magna Carta" of environmental law.

Other laws, such as the Clean Water Act (CWA), the Clean Air Act (CAA), the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), and the Toxic Substances Control Act (TSCA) all build upon the foundation established by NEPA.

In conclusion, NEPA was the first major environmental law passed in the United States, and it has served as a cornerstone of environmental protection since its enactment in 1970.

It requires the federal government to consider environmental impacts before any action is taken, and allows for public input into the decision-making process. This ensures that environmental protection is taken into account when formulating government policies.

To know more about National Environmental Policy Act (NEPA) here

https://brainly.com/question/28564221

#SPJ11

which school of jurisprudential thought emphasizes using law as a tool for market efficiency while solving legal disputes?

Answers

The school of jurisprudential thought that emphasizes using law as a tool for market efficiency while solving legal disputes is the Law and Economics School. The Law and Economics School approach to jurisprudence uses economic principles to determine the legal rules, and policies that would most effectively improve social welfare.

The Law and Economics School is a school of jurisprudential thought that emphasizes using law as a tool for market efficiency while solving legal disputes. It has been said that this approach emerged from the work of neo-classical economists such as Ronald Coase and Richard Posner. The Law and Economics School argues that the efficiency of the market can be used as a tool to solve legal disputes. This approach assumes that people are rational actors who make decisions based on self-interest.

Therefore, the Law and Economics School argues that the law should be designed to promote the efficient allocation of resources and to minimize the costs of legal disputes.In conclusion, the Law and Economics School is a school of jurisprudential thought that emphasizes using law as a tool for market efficiency while solving legal disputes. The Law and Economics School argues that the efficiency of the market can be used as a tool to solve legal disputes. This approach assumes that people are rational actors who make decisions based on self-interest.

Therefore, the Law and Economics School argues that the law should be designed to promote the efficient allocation of resources and to minimize the costs of legal disputes.

To know more about jurisprudential refer here:

https://brainly.com/question/14254828#

#SPJ11

What is Section 811 Illinois?

Answers

Rental Support Program under Section 811 (PRA): With the provision of inexpensive housing coupled with voluntary services and support, the program helps the lowest-income individuals with disabilities live independently in the community.

What has made Illinois renowned?The 13th Amendment to the Constitution, which outlawed slavery, was first ratified in Illinois in 1865. President Ulysses S. Grant was born in Illinois; his house is still standing in Galena. The only structures to escape the Great Chicago Fire of 1871 were the Chicago Water Tower and Pumping Station.Illinois is not only a great state to live in, but it has also been named the 21st best location to live in the nation. Illinois, which has a population of more than 12.67 million, continues to draw tens of thousands of young professionals, families, and retirees each year. The most visited city in the state is Chicago, which attracts tourists from all over the country and the globe.

To learn more about Illinois, refer to:

https://brainly.com/question/29558259

Example of how south African courts decides whether a custom would be regarded as indigenous, legal rule or not?

Answers

In South Africa, the courts may consider various factors when determining whether a custom is regarded as an indigenous legal rule or not.

One such factor is the degree to which the custom is accepted and practiced within the relevant community. The courts may also consider whether the custom has a long-standing history within the community and whether it is consistent with other customary practices and values of the community. Additionally, the courts may consider whether the custom is consistent with the values and principles enshrined in the South African Constitution. For example, in the case of Bhe v Magistrate, Khayelitsha, the South African Constitutional Court considered the customary law rule of primogeniture, which held that only male heirs could inherit property. The Court held that this custom was inconsistent with the equality provisions of the Constitution and could not be regarded as a valid customary law rule. Therefore, in deciding whether a custom would be regarded as an indigenous legal rule or not, the South African courts would consider a range of factors, including the degree of acceptance and practice within the relevant community, the historical and cultural context of the custom, and its consistency with constitutional values and principles.

To know more about South African Constitution:

https://brainly.com/question/31081202

#SPJ4

What is ACE-V and how it is used in fingerprint analysis?

Answers

ACE-V is an acronym that stands for Analysis, Comparison, Evaluation, and Verification. It is a systematic method used in fingerprint analysis to examine and compare fingerprints from crime scenes with those of individuals who may have been involved in the crime.

The ACE-V process involves several steps:

1. Analysis: The first step involves analyzing the evidence collected from the crime scene, which in this case is a fingerprint, to identify any distinguishing features or characteristics.

2. Comparison: The second step involves comparing the fingerprint evidence with known fingerprints, such as those from a suspect or a database, to determine whether there is a match.

3. Evaluation: The third step involves evaluating the results of the comparison to determine the strength of the evidence and the likelihood of a match.

4. Verification: The final step involves verifying the results of the analysis and comparison through independent review and confirmation by another examiner.

The ACE-V process is a crucial part of fingerprint analysis and is used to ensure that the evidence is reliable and accurate. It is an important tool in criminal investigations and can help to identify suspects and link them to a crime.

paul owned two vacant parcels of land; he sold the front parcel of land to alice but reserved an easement across her property for road access. paul did not use the easement for a period of 15 years. when paul returned to build on his lot, alice claimed the easement was now null and void. a court would find that the easement was:

Answers

The court would likely find that the easement is still valid and enforceable. An easement is a right given to a person to use another person’s land for a particular purpose, such as for a road. In this situation, Paul has an easement across Alice’s property for road access.

For an easement to be extinguished or null and void, it must have been abandoned. In order for an easement to be considered abandoned, there must be an intention to give it up and the owner must have acted upon that intention.

In this case, Paul did not use the easement for 15 years, but there is no evidence that he intended to give up his right to use it. Without proof of such intention, a court would find that the easement is still valid and enforceable.



Under certain conditions, an easement may be extinguished due to non-use. The law sets out a minimum period of non-use, which varies by jurisdiction.

In this case, however, the 15 year period of non-use is insufficient to meet the requirements of the law. Furthermore, Paul’s possession of the land for the purposes of a road does not constitute abandonment, as it does not prove an intention to give up the easement.

In conclusion, the court would likely find that the easement is still valid and enforceable. Paul did not use the easement for 15 years, but this does not constitute abandonment.

Furthermore, he has not taken any action to indicate an intention to give up the easement, and the period of non-use does not meet the minimum requirements for abandonment under the law.

To know more about easement here

https://brainly.com/question/13059197

#SPJ11

how did supreme court justice ginsburg indicate a dissenting opinion?

Answers

Supreme Court Justice Ruth Bader Ginsburg indicated a dissenting opinion by reading a summary of the dissent from the bench.

This practice, known as a "bench dissent," is not required or customary, but it is a way for justices to publicly express their disagreement with the majority opinion. Ginsburg believed that a bench dissent was important because it would draw attention to the issues she believed were being overlooked by the majority opinion. Additionally, reading a bench dissent is a way for a justice to signal to future courts or legislatures that they disagree with the precedent set by the majority opinion and that they believe it should be overturned or changed.

To know more about dissent click here:

brainly.com/question/5865308

#SPJ4

which court decision held that the basic elements of procedural due process must be present when decisions are made concerning the disciplining of an inmate?

Answers

The court decision that held that the basic elements of procedural due process must be present when decisions are made concerning the disciplining of an inmate is the landmark case of Wolff v. McDonnell.

In this 1974 decision, the United States Supreme Court held that prisoners are entitled to certain procedural protections when facing disciplinary sanctions, including advance written notice of the charges, an opportunity to present evidence and call witnesses, and a written statement explaining the reasons for the disciplinary action taken. This decision established that prisoners are entitled to due process protections, even though they are in a custodial environment and have limited rights compared to the general public. The ruling in Wolff v. McDonnell has had a significant impact on the administration of justice in prisons and has helped to ensure that prisoners are treated fairly and justly.

To know more about court click here:

brainly.com/question/15147174

#SPJ4

Who was at the Seneca Falls woman's rights convention?

Answers

Answer: In 1848, Lucretia Mott, Elizabeth Cady Stanton, and several other women decided to call a women's rights meeting in Seneca Falls, New york

chicago held its mayoral election this week, with nine candidates on the ballot. how did lori lightfoot, the current mayor, do?

Answers

Chicago held its mayoral election this week, with nine candidates on the ballot. the mayor Lori lightfoot took steps towards public safety.

Since 2019, Lori Elaine Lightfoot has been Chicago's 56th mayor. She was born in the United States on August 4, 1962. She is a Democratic Party supporter. Before being elected mayor, Ms. Lightfoot, an Ohio native, had never held an elective office.

There are now only two candidates left in the race for mayor, and their stances on policing and education are radically dissimilar. Under Ms. Lightfoot's direction, Mr. Vallas has portrayed Chicago as being in a state of chaos. He has run an aggressive campaign, claiming that he can make the city safer, calling for increasing the size of the police force, increasing the percentage of serious crimes that are apprehended, and growing charter schools. He has the support of the local Fraternal Order of Police.

Learn more about mayoral election at:

brainly.com/question/12633379

#SPJ4

The action by which workers vote on whether to accept or reject the terms of the contract negotiated by the union after collective bargainingMediationArbitrationRatification

Answers

Vote taken by employees to approve or reject the conditions of the union-negotiated contract after collective ratification.

How do employers minimize the possibility of bias during job interviews?

The Society for Human Resources Management (SHRM) advises adopting structured interviews, in which applicants are asked the same set of predetermined questions that concentrate on factors that directly affect job performance. By removing arbitrary elements like ability or appearance, this framework helps reduce bias.

What action is collective bargaining?

Collective bargaining is the process of negotiations between employers and groups of employees with the goal of reaching a settlement to control working conditions, wages, and benefits.

To know more about negotiated  visit:-

https://brainly.com/question/14974117

#SPJ1

Other Questions
The number of miles driven by Bo is directly proportional to the number of gallons he used.Number of Gallons UsedNumber of Gallons UsedNumber of Miles DrivenNumber of Miles Driven881881883434799799444410341034How many miles would he drive on 38 gallons? I need help with this please 6c+4d-c-7d simplified in chronological order, what are the countries where prokofiev lived? which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover PLEASE HELP WILL MARK BRAINLIEST!A portion of the quadratic formula proof is shown. Fill in the missing statement. James is a new project manager and is struggling to meet deadlines. He approaches his director and begins to complain to him about all the problems with the project. James is obviously stressed and not thinking clearly. His director calmly slows James down and has him start from the beginning and asks him to focus on one question or problem at a time. Soon, James is speaking clearly and each question and problem is addressed.What problem solving method did James director use to improve the situation? For the function p = 2 - 3q. what is the instantaneous rate of change function? A piece of property contains 1,758.1066 sq. yards. How many yards are on each side of the square? How did the passage of Jim Crow laws in the South affect Black Americans?A. Jim Crow laws forced Black Americans to move North.B. Jim Crow laws forced Black Americans to move to Africa.C. Jim Crow laws took away rights from Black Americans.D. Jim Crow laws encouraged the development of the sharecroppingsystem. PLEASE HELP ME MATH. I WILL GIVE BRAINLISEST mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply. true or false? two proofs are required to establish the provable equivalence of two sentences of tfl. Why was the National Association of REALTORS Code of Ethics created? One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference?