The plasma membrane of a muscle fiber is called the sarcolemma.
The sarcolemma is the plasma membrane that surrounds the muscle fiber, also known as the muscle cell. It is a specialized membrane that is responsible for maintaining the integrity of the cell and regulating the flow of molecules in and out of the cell. The sarcolemma is a phospholipid bilayer that contains various proteins, including ion channels, transporters, receptors, and enzymes.
These proteins allow the sarcolemma to perform various functions, such as controlling muscle contraction and relaxation, transmitting nerve impulses, and facilitating the exchange of nutrients and waste products. The sarcolemma is an essential component of the muscle fibre, and any damage or dysfunction can affect the muscle's function and performance.
To know more about sarcolemma, visit the link given below:
https://brainly.com/question/13649771
#SPJ4
Need help asap please :(
Answer:
picture quality is low
Explanation:
write your question
Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices
Answer: c. isotopes
Explanation:
maybe sorry if wrong
What is transport in humans and plants and what is the difference?
Answer:
In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.
Explanation:
Question 6
Skeletal muscles work with bones to give your body:
Strength
The ability to move
Strength and the ability to move
O None of the above
What body part do humans have that is closely related to their membership in the chordate phylum?
brain stem
spinal chord
O
vocal chord
spleen
Answer:
The spinal cord
Explanation:
The nerve cord found in most chordate embryos develops into the brain and spinal cord, which compose the central nervous system.
the spinal column Most chordate embryos contain a nerve cord, which develops into the brain as well as the spinal cord, which together make the components of the central nervous system..
What the heck is an embryo?Early stages of human and other animal or plant development. This stage in creatures with a vertebrae or spinal column lasts from immediately after fertilization to the emergence of all main body parts.
Eggs alone or embryos as well?During embryo frozen, the eggs undergo fertilization with IVF before being flash frozen. During the course of many days, the fertilized eggs mature into embryos, and then they are flash frozen. Once more, when embryos are preserved at that low temperature, the health of the young, healthy eggs from which they were conceived is preserved.
To know more about Embryos visit:
https://brainly.com/question/28301178
#SPJ1
A human starts as ______ cell(s) and by the time they are an adult, they have ______ cell(s).
A. 1, 50 trillion
B. 50 trillion, 50 trillion
C. 2, 10 million
D. 10,000, 50 trillion
A person has 1 cell at birth and 50 trillion cells by the time they reach adulthood.
A single cell called a zygote is created when a sperm fertilizes an egg at the commencement of human development. The human body starts to grow and evolve from this one cell.
Organs and tissues start to form as a result of cell division and differentiation into distinct cell types. A person's body is thought to contain 50 trillion cells by the time they reach maturity.
So a person is born as a single cell (zygote), and by the time they reach adulthood, their body contains 50 trillion cells.
To improve our health and well-being and advance medical studies and treatments, it is crucial to comprehend the biology of the human body and the process of human development.
learn more about cells here
https://brainly.com/question/13920046
#SPJ1
Which Leu codon can be converted to either Ser, Val, or Met by a single nucleotide substitution?
CUA
CUU
CUC
CUG
The Leu codons are CUA, CUU, CUC, and CUG. Of these, the CUA codon can be converted to either Ser, Val, or Met by a single nucleotide substitution.
Specifically, a CUA to UCA (Ser), CUA to GUA (Val), or CUA to AUG (Met) substitution would result in a different amino acid being incorporated into the protein sequence.
The other Leu codons (CUU, CUC, and CUG) have different nucleotide sequences and would require multiple nucleotide substitutions to be converted to Ser, Val, or Met codons.
The ability of the CUA codon to be converted to multiple different amino acids by a single nucleotide substitution is an example of genetic code degeneracy or redundancy.
This is because there are more codons (64) than there are amino acids (20), so some amino acids are coded for by multiple different codons. In the case of Leu.
To learn more about Leu codons here:
https://brainly.com/question/30367265
#SPJ11
Stomates are small openings on the leaves of plants. The following data was recorded for the stomates of a particular plant under various conditions of moisture in the air as measured by relative humidity.
Time Relative Humidity Stomates Condition
06:00 15% Closed
09:00 27% Closed
12:00 58% Open
15:00 82% Open
18:00 26% Closed
The data in the table could be used to support which explanation of a function of stomates? Stomates are responsible for–
A
preventing the loss of moisture from the plant to the environment.
B
regulating the flow of water from one cell to another in the plant.
C
ridding the plant of excess water vapor in dry conditions.
D
allowing the plant to absorb water from the soil after it rains.
a limiting the plant's ability to lose moisture to the environment.
Several plant species that thrive under the same circumstances in various settings have their roots measured.
This example demonstrates how negative feedback keeps homeostasis in check: a. where the face is subjected to friction, the epidermis thickens to produce a callus. The control of blood calcium levels is another illustration of negative feedback. The hormone parathyroid is secreted by the parathyroid glands, and it controls the amount of calcium in the body. The parathyroid glands detect a drop in calcium and release more parathyroid hormone as a result. Cell counting, pcv, cell fresh weight, and cell dry weight are methods for gauging growth in suspension culture.
Learn more about plant
https://brainly.com/question/31220793
#SPJ1
Homo floresiensis is remarkable due to the species' O skull features similar to Denisovans O skull features similar to Neanderthals O small stature and cranial capacityO large stature and cranial capacity
Homo floresiensis is remarkable due to the species' small stature and cranial capacity, which are similar to both Denisovans and Neanderthals. The skull features of this species are more similar to those of Neanderthals than Denisovans.
Homo floresiensis is an extinct hominin species that lived on the island of Flores in Indonesia. H. floresiensis, sometimes known as "Hobbits" due to their small stature, is a hominin species that lived around 100,000 to 50,000 years ago in what is now Indonesia. Homo floresiensis is significant since it provides significant insight into human evolution. Because of the diminutive size of their bodies and brains, scientists believe that H. floresiensis may have evolved from much larger ancestors and adapted to island life over time. Their tiny bodies and brains show that evolutionary forces can produce a variety of hominins under various circumstances.
More on Homo floresiensis: https://brainly.com/question/28103868
#SPJ11
which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover
Crossover is the process based on DNA recombination.
The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.
Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.
Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.
Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.
Learn more about DNA: https://brainly.com/question/16099437
#SPJ11
The trachea is part of the ______ respiratory system.
A) Upper
B) Lowe
The trachea is the part of Upper respiratory system.
What respiratory system component is the trachea?The windpipe is another name for the trachea. It is a crucial part of the respiratory system in your body. As you breathe in, air enters your lungs through your larynx. It then travels to your bronchi through your trachea.
What do the bronchi and trachea in the respiratory system do?Your trachea is where your left and right bronchi leave. The bronchi are the air passages to your lungs. The little sacs in your lungs called alveoli receive air through the bronchioles at the end of the bronchi. Alveoli in your body exchange gases.
To know more about respiratory system visit:-
https://brainly.com/question/19306828
#SPJ1
mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.
Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance
What is inheritance?
Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.
Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.
To know more about inheritance of traits refer here:
https://brainly.com/question/22686199#
#SPJ11
if a cell with 4 chromosomes undergoes mitosis how many daughter cells are made and how many chromosomes will each daughter have
If a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes. Hence, if a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes.
What is Mitosis?
Mitosis is a biological method that results in the replication of cells. This means that, as a result of mitosis, the number of cells in an organism increases. The whole process happens in four different phases: prophase, metaphase, anaphase, and telophase.
Cell division is a crucial aspect of human growth, and it is controlled by genes within the cell. It is important for the survival and growth of living organisms. It ensures that the genetic material in each cell is divided equally and that the daughter cells inherit the same genetic material as the parent cell.
Mitosis is a part of the cell cycle, in which a single parent cell divides into two daughter cells with identical genetic information. Each daughter cell produced during mitosis is identical to the parent cell in terms of its DNA content, meaning that the two daughter cells will each have the same number of chromosomes as the parent cell.
To learn more about chromosomes here:
https://brainly.com/question/30993611
#SPJ11
which atomic particles are in a unique cloud outside of the nucleus of the atom?
The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.
The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.
Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.
To know more about electrons click here:
https://brainly.com/question/1255220
#SPJ4
There is evidence that the increasing carbon dioxide levels in the atmosphere are causing oceans to become more acidic. Ocean acidification may negatively impact species of phytoplankton, which are microscopic photosynthetic organisms that live in surface waters. Explain how the carbon cycle might be affected, if phytoplankton populations were to decrease.
Phytoplankton play a significant role in the carbon cycle. They are responsible for a large portion of the photosynthesis that takes place in the ocean, taking up carbon dioxide from the atmosphere and converting it into organic matter through photosynthesis.
If phytoplankton populations were to decrease due to ocean acidification, the amount of carbon dioxide that is absorbed from the atmosphere through photosynthesis would also decrease. This would result in an increase in atmospheric carbon dioxide levels, which would exacerbate the problem of global warming and climate change.
Furthermore, when phytoplankton die, they sink to the ocean floor, taking carbon with them. This is called the biological pump, which is an important mechanism for transferring carbon from the surface ocean to the deep ocean. If phytoplankton populations decrease, the biological pump would be weakened, leading to less carbon being transferred to the deep ocean. This would further exacerbate the problem of increasing atmospheric carbon dioxide levels, as less carbon would be removed from the atmosphere.
In summary, a decrease in phytoplankton populations due to ocean acidification could have significant effects on the carbon cycle, leading to increased atmospheric carbon dioxide levels and a weakening of the biological pump.
the body compartments that participate in the immune system, after the formation of immune cells, are the . multiple select question. extracellular fluid mononuclear phagocyte system ciliary escalator bloodstream gastrointestinal lumen bone marrow cerebrospinal fluid lymphatic system
The body compartments that participate in the immune system, after the formation of immune cells, are the lymphatic system, extracellular fluid, mononuclear phagocyte system, and bloodstream.
What is the specific role of the immune system?The specific role of the immune system refers to the finish with pathogenic agents such as microorganisms or viruses, which depend on the presence of specialized cells and organs.
Therefore, with this data, we can see that the specific role of the immune system is to fight against bacteria and viruses to maintain a health state.
Learn more about the immune system here:
https://brainly.com/question/15595309
#SPJ1
help! (WILL GIVE BRAINLIEST)
(MAKE SURE TO PROVIDE WEBSITE LINK TO THE STUDY.)
2. Conduct an internet search and locate a scientific study. Identify the steps of the scientific method, as well as recognize which steps may have been skipped. Place your link to this site in your answer.
Here is a link to a scientific study:
Title: "The effects of caffeine on athletic performance"
Scientific Method Steps:
The researchers made the observation that caffeine is a regularly ingested drug that is thought to improve athletic performance.
The researchers' hypothesis was that eating caffeine before to physical activity would improve athletic performance.
Prediction: According to the researchers, people who drank caffeine before exercising would fare better than those who did not.
Experiment: To verify their idea, the researchers devised an experiment.
Analysis: To ascertain whether there was a statistically significant difference in athletic performance between the caffeine group and the placebo group, the researchers examined the data gathered during the trial.
The experiment's findings led the researchers to the conclusion that ingesting caffeine before to exercise can improve athletic performance.
learn more about scientific study here
https://brainly.com/question/17216882
#SPJ1
discuss why it is important which of the two dna strands serves as a template during transcription.
How is a helper T cell activated by an antigen?
When an armed helper T cell comes into touch with an antigen-binding B cell, it becomes polarized and secretes IL-4 and other cytokines. Antigen binding on the B cell via its T-cell receptor.
What are T cell ?T cells are an important type of white blood cell in the immune system that play a key part in the adaptive immune response. The presence of a T-cell receptor (TCR) on the cell surface distinguishes T cells from other lymphocytes.
T cells develop from hematopoietic stem cells, which are located in bone marrow. T cells that are developing travel to the thymus gland to mature. (or mature). The thymus is where T cells get their name. After migrating to the thymus, the precursor cells differentiate into many types of T lymphocytes. T cell differentiation continues even after they leave the thymus. T cell subtype groups play a number of key roles in directing and shaping the immune system.
What are Antigen ?Any chemical that induces the body to produce an immunological response to it. Toxins, chemicals, germs, viruses, and other things from outside the body are examples of antigens. Antigens on body tissues and cells, including cancer cells, can trigger an immune response. These antigens can also be used to identify tissues or cells in laboratory investigations.
To know more about Antigen , visit ;
brainly.com/question/24384193
#SPJ1
extreme drought, heat, or cold can all cause cavitation of the xylem, which is when a bubble forms in the xylem, breaking the chain of cohesion. how do you think this will effect the plant?
Extreme drought, heat, or cold can cause cavitation of the xylem, which is when a bubble forms in the xylem, breaking the chain of cohesion. This can have a variety of effects on the plant, such as reducing the amount of water that can be drawn up by the xylem, leading to wilting, desiccation, and death in extreme cases.
Extreme drought, heat or cold can all cause cavitation of the xylem, which is when a bubble forms in the xylem, breaking the chain of cohesion. This will affect the plant in a number of ways.
The main function of the xylem is to transport water and dissolved minerals from the roots to the shoots and leaves of a plant. When the xylem experiences cavitation, it is unable to perform this function effectively. As a result, the plant may experience water stress and wilting. If the cavitation is severe, it can lead to the death of the plant.
Excessive heat or cold can also damage plant tissue, causing necrosis or cell death. This can lead to a reduction in plant growth and yield. In addition, extreme temperatures can also disrupt photosynthesis, the process by which plants convert sunlight into energy. Without sufficient energy, the plant will be unable to grow and develop properly.
Furthermore, cavitation can also lead to the formation of embolisms, which are air bubbles that can block the flow of water through the xylem. This can further exacerbate water stress and other negative effects on the plant. Overall, cavitation of the xylem can have significant negative effects on the growth, development, and survival of plants in extreme environmental conditions.
For more such questions on Xylem.
https://brainly.com/question/15918718#
#SPJ11
Which section of the brain helps regulate heartbeat and respiration? A. Cerebellum B. Diencephalon C. Brain Stem D. Cerebrum
The section of the brain that helps regulate heartbeat and respiration is the Brain Stem. Option (c)
The brain stem is a crucial part of the brain that connects the cerebrum and cerebellum to the spinal cord. It plays a crucial role in controlling some of the most basic life-sustaining functions of the body, such as heartbeat, respiration, and blood pressure regulation.
Specifically, the medulla oblongata, which is part of the brain stem, controls the autonomic functions of the heart and lungs, as well as various reflexes, such as coughing and sneezing. Damage to this area of the brain can result in serious and potentially life-threatening disruptions to these vital bodily functions.
Learn more about Brain Stem.
https://brainly.com/question/3666013
#SPJ4
several subsets of innate lymphoid cells (ilcs) have been identified that share their patterns of cytokine production with the known subsets of t cells. the combined activity of related ilc and t cell subsets is effective in eradicating pathogenic infections because:
The combined activity of related ILC and T cell subsets is effective in eradicating pathogenic infections because, the immune system can respond to pathogens through two principal means: the innate immune response and the adaptive immune response.
The innate immune response is the body's first line of defense against invading pathogens. Cells of the innate immune system, including neutrophils, macrophages, dendritic cells, and natural killer cells, recognize and destroy pathogenic microbes.
On the other hand, the adaptive immune response is a second line of defense that begins to form when the innate immune response is inadequate or is unable to eliminate the invading microorganisms. This reaction is also characterized by the specific recognition of antigens and the establishment of immune memory after the first infection.
The adaptive immune response is made up of B lymphocytes and T lymphocytes, which together have the potential to target a wide range of pathogens, including bacteria, fungi, viruses, and parasites.
Lymphocytes T are characterized into various subsets, including CD4+ T helper (Th) cells, CD8+ cytotoxic T lymphocytes (CTLs), and regulatory T (Treg) cells, which play important roles in regulating immune responses.
To know more about immune response refer here:
https://brainly.com/question/9026269#
#SPJ11
Why are the ddNTPs fluorescently labeled?
what does cellular respiration release into the air?
1. The steps of the carbon cycle are described below.
Place the steps in the correct order.
a. Animals and plants release carbon dioxide and
water as a result of cellular respiration.
b. Carbon dioxide is released by plants and animals
and moves into the biosphere.
c. Plants use water and carbon dioxide from the
atmosphere to make sugar and oxygen through
the process of photosynthesis.
d. Animals and plants use sugar and oxygen for the
process of cellular respiration.
e. Cellular respiration transforms sugar and oxygen
into carbon dioxide and water.
Answer:
1. Plants use water and carbon dioxide from the atmosphere to make glucose and oxygen through photosynthesis.
2. Animals and plants use glucose and oxygen for cellular respiration
3. Cellular respiration transforms glucose and oxygen into carbon dioxide and water.
4. Animals and plants release carbon dioxide and water as a result of cellular respiration.
5. Carbon Dioxide is released by plants and animals and moves in the biosphere
Explanation: CO2 + H2O with energy (sun) = C6 H12 O6 + O2
TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA
What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?
The significance of crossing over is the creation of new combinations of genetic material in offspring.
Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.
It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.
To learn more about Crossing over, here
https://brainly.com/question/19671756
#SPJ4
the sequence of amino acids determines the __ protien which determines the protiens__
Answer:
The sequence of amino acids determines the primary structure of a protein, which determines the protein's higher-order structure, function, and properties.
The primary structure is the linear sequence of amino acids in a protein, which is stabilized by peptide bonds. The specific sequence of amino acids determines the protein's overall shape and how it interacts with other molecules.
The higher-order structure of a protein includes its secondary, tertiary, and quaternary structures, which are determined by various interactions between amino acids such as hydrogen bonds, disulfide bonds, and hydrophobic interactions.
The protein's function and properties are determined by its structure, and this can include enzymatic activity, transport of molecules, signaling, and structural support. Therefore, the sequence of amino acids is critical to the overall function and properties of a protein.
The amino acid sequence of a polypeptide chain defines the protein's ultimate 3D shape. Protein structure is classified into four levels: primary structure, secondary structure, tertiary structure, and quaternary structure. Furthermore, there are two types of 3D protein structures: spherical proteins and filamentous proteins. The information contained in the cellular genetic code determines the amino acid structure of a protein. The sequence of amino acids in a polypeptide chain is distinctive to each protein. A single amino acid change produces a DNA mutation, which usually results in a non-functioning protein. The "R" group changes between amino acids and dictates how these protein monomers vary. The information contained in the cellular genetic code determines the amino acid structure of a protein. The pattern of nucleotide bases in nucleic acids (DNA and RNA) that codes for amino acids is known as the genetic code. Proteins are made up of molecules called amino acids. A protein is composed of one or more straight strings of amino acids, each of which is referred to as a polypeptide. There are several types of amino acids that are frequently present in proteins.
16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?
Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.
What causes Blue Andalusian birds to exist?The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.
What kind of hens are Blue Andalusian?According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.
To know more about heterozygous visit:
https://brainly.com/question/30622664
#SPJ1
the term for a specific molecule on which an enzyme acts is the
The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.
Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction. The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.
Learn more about substrate: https://brainly.com/question/4047091
#SPJ11