What is the total mass in grams of 0.75 mole of SO2?a. 16 gb. 24 gc. 32 gd. 48 g

Answers

Answer 1

To calculate the total mass of 0.75 moles of SO2  is  D. 48g .we need to use the molecular mass of SO2.

What is molecular mass?

The sum of the atomic masses of all the atoms present in a molecule is known as its molecular mass. The molecular mass of SO2 is calculated by adding the atomic masses of sulfur and oxygen. Sulfur has an atomic mass of 32 g/mol, and oxygen has an atomic mass of 16 g/mol. Therefore, the molecular mass of SO2 can be calculated as follows:1 sulfur atom + 2 oxygen atoms = (1 × 32 g/mol) + (2 × 16 g/mol) = 32 g/mol + 32 g/mol = 64 g/mol Now that we have calculated the molecular mass of SO2, we can use the following formula to calculate the total mass of 0.75 moles of SO2:Total mass of SO2 = Number of moles × Molecular mass Total mass of SO2 = 0.75 mol × 64 g/mol Total mass of SO2 = 48 g Therefore, the total mass of 0.75 moles of SO2 is 48 g Therefore the correct option is  D

The complete question is :

What is the total mass in grams of 0.75 mole of SO2?

a. 16 g

b. 24 g

c. 32 g

d. 48 g

Know more about molecular mass here :

https://brainly.com/question/24191825

#SPJ11


Related Questions

2 identical metal spheres having equal and similar charges repel each other with a force of 103 N when they are placed 10 cm in a medium of dielectric constant 5. Determine the charge on each sphere

Answers

The charge on each sphere would be 5.89 × 10^-8 C.

Electrostatic forces

The electrostatic force between two charged spheres is given by Coulomb's law:

F = (1/4πε) * (q1*q2)/r^2

where F is the electrostatic force, q1 and q2 are the charges on the two spheres, r is the distance between them, and ε is the permittivity of the medium.

In this case, the spheres have equal and opposite charges, so we can write:

F = (1/4πε) * (q^2)/r^2

where q is the charge on each sphere.

We are given that the force between the spheres is 103 N, the distance between them is 10 cm (0.1 m), and the dielectric constant of the medium is 5.

Substituting these values into the equation above, we get:

103 = (1/4π58.85*10^-12) * (q^2)/(0.1)^2

Solving for q, we get:

q = ± 5.89 × 10^-8 C

Since the spheres have equal and opposite charges, we take the absolute value of q to get the charge on each sphere:

q = 5.89 × 10^-8 C

Therefore, each sphere has a charge of 5.89 × 10^-8 C.

More on electrostatic force can be found here: https://brainly.com/question/9774180

#SPJ1

which sentence most accurately describes electrically charged objects? (2 points) group of answer choices they are attracted to one other without coming into contact. they are negatively charged objects that are attracted to each other. they attract or repel other charged objects without touching them. they attract other objects after they have been in contact with them.

Answers

Electrically charged objects attract or repel other charged objects without touching them. This is due to the force of attraction or repulsion between charged objects, which depends on their charges and the distance between them.

Electrically charged objects attract or repel other charged objects without touching them accurately describes electrically charged objects.

Electrically charged objects are those that have an imbalance of positive or negative charge.

These objects are either positively charged, meaning they have lost electrons, or negatively charged, meaning they have gained electrons. These charged objects can attract or repel other charged objects without touching them.

The force of attraction or repulsion between two charged objects is known as electric force.

The direction and strength of this force depend on the charges of the objects and the distance between them. Like charges (positive-positive or negative-negative) repel each other, while opposite charges (positive-negative) attract each other.

Electrically charged objects play an important role in many scientific and technological applications.

For example, the principles of electric charge are used in electrostatic precipitators to remove pollutants from the air, in the design of particle accelerators, and in the function of batteries and electrical circuits.

For similar question on electric force.

https://brainly.com/question/30236242

#SPJ11

3. Calculate the electric force that exists between two objects that are 5. 0 x

10-2 m apart and carry charges of 2. 5 x 10-6 C and −3. 2 × 10¯6 C. Is this force

attractive or repulsive?. (1 point)

-6

Answers

The electric force between the two objects with charges of 2.5 × 10⁻⁶ C and -3.2 x 10⁻⁶ C and a distance of 5.0 × 10⁻² m is calculated to be -4.608 N, indicating an attractive force between them.

The electric force between two charged objects is given by Coulomb's Law, which states that:

F = kq₁q₂ / r²

where F is the electric force, q₁ and q₂ are the charges of the two objects, r is the distance between them, and k is Coulomb's constant, which has a value of approximately 9.0 × 10⁹ N·m²/C².

Plugging in the given values, we get:

F = (9.0 × 10⁹ N·m²/C²) * (2.5 × 10⁻⁶ C) * (-3.2 × 10⁻⁶ C) / (5.0 × 10⁻² m)²

F = -4.608 N

The negative sign indicates that the force is attractive, meaning that the two objects will be pulled towards each other.

Therefore, the electric force between the two objects is 4.608 N and it is attractive.

Learn more about electric force here: brainly.com/question/2526815

#SPJ4

Comlpete question:

Calculate the electric force that exists between two objects that are 5.0 × 10⁻² m apart and carry charges of 2.5 × 10⁻⁶ C and -3.2 x 10⁻⁶ C. Is this force attractive or repulsive?

what are someone of the sources of errors in the ohm's law experiment​

Answers

Common sources of error include instrumental, environmental, procedural, and human. All of these errors can be either random or systematic depending on how they affect the results.

Which is the answer to this question???

Answers

The student group that built the strongest electromagnet is (option C) Group 4, because the strength of the electromagnet depends directly on the number of loops, current in the circuit and the presence of a core.

What is electromagnet?

An electromagnet is a type of magnet that is created by passing an electric current through a coil or wire. The electric current generates a magnetic field, which can be enhanced by using a magnetic core material, such as iron. Electromagnets can be turned on and off by controlling the flow of electric current through the wire.

They are used in a wide range of applications, from simple devices like doorbells and magnetic locks to more complex technologies like MRI machines and particle accelerators.

Learn about Electromagnets here https://brainly.com/question/13516323

#SPJ1

a flea jumps by exerting a force of straight down on the ground. a breeze blowing on the flea parallel to the ground exerts a force of on the flea while the flea is still in contact with the ground. find the direction and magnitude of the acceleration of the flea if its mass is . do not neglect the gravitational force

Answers

The direction of acceleration of the flea is upward and the magnitude of acceleration is given by: a = [tex]\frac{F_{breeze}  - mg}{m}[/tex] where [tex]F_{breeze}[/tex] is the force exerted by the breeze on the flea, m is the mass of the flea, g is the acceleration due to gravity, and a is the resulting acceleration of the flea.

When the flea jumps, it exerts a force straight down on the ground, which according to Newton's third law, results in an equal and opposite force exerted by the ground on the flea, causing it to move upward. However, the breeze blowing parallel to the ground exerts a force on the flea in the opposite direction to its motion, which reduces the upward force exerted by the ground, and hence the acceleration of the flea.

To calculate the magnitude of acceleration of the flea, we need to find the net force acting on the flea. This is given by the difference between the force exerted by the breeze and the gravitational force acting on the flea, which is given by mg. The direction of the net force is upward since the force exerted by the breeze is in the opposite direction to the motion of the flea.

The magnitude of acceleration can then be calculated using Newton's second law, a =[tex]{F_{net}/m[/tex], where[tex]F_{net}[/tex] is the net force and m is the mass of the flea.

Therefore, the direction of acceleration of the flea is upward and the magnitude of acceleration is given by: a = [tex]\frac{F_{breeze}  - mg}{m}[/tex] where the force exerted by the breeze, F_breeze, and the mass of the flea, m, are given in the problem statement. The acceleration due to gravity, g, is approximately 9.8 m/s².

To know more about direction of acceleration, refer here:

https://brainly.com/question/25415733#

#SPJ11

when dr. hewitt cuts the broom right through the center of gravity, how do the weights of the two sides of the broom compare?

Answers

If Dr. Hewitt cuts the broom exactly through its center of gravity, then the weights of the two sides of the broom will be equal.

This is because the center of gravity is the point at which the weight of the object can be considered to be concentrated, and cutting the object at this point would result in two halves of equal weight.

However, it is important to note that if the broom is not perfectly symmetrical, the location of the center of gravity may not be at the exact physical center of the broom. In this case, Dr. Hewitt would need to locate the actual center of gravity of the broom and cut it at that point to achieve equal weights on each side.

Nonetheless, if the broom is cut exactly at its center of gravity, the weights of the two sides of the broom will be equal regardless of its shape or size.

Therefore, if the broom is cut exactly at its center of gravity, each half will have half the total weight of the broom.

To learn more about center of gravity:

https://brainly.com/question/4208016

#SPJ11

an object is in uniform circular motion. it is traveling at a constant speed. is the net force acting on the object zero? why or why not?

Answers

When an object is in uniform circular motion and traveling at a constant speed, the net force acting on the object is not zero.

It is not zero because an object in uniform circular motion is constantly changing direction, even if its speed remains the same. This change in direction requires a force, which is provided by centripetal force. Centripetal force is the force that keeps an object moving in a circular path by pulling it toward the center of the circle.

This force is always directed toward the center of the circle and is perpendicular to the object's velocity. Without this force, the object would continue moving in a straight line.

Thus, the net force acting on an object in uniform circular motion is not zero, but rather is equal to the centripetal force.

To know more about centripetal force refer here:

https://brainly.com/question/11324711#

#SPJ11

A baseball is dropped from the top of a 85 m tall building. Ignoring air resistance, how fast will it hit the ground?

Answers

Answer:

40.8 m/s

Explanation:

We can use the kinematic equation that relates the final velocity (Vf) of an object dropped from rest to the distance it has fallen (h) and the acceleration due to gravity (g):

Vf^2 = 2gh

where g is the acceleration due to gravity, which is approximately 9.8 m/s^2.

Plugging in the given values, we get:

Vf^2 = 2 * 9.8 m/s^2 * 85 m

Vf^2 = 1666

Vf = sqrt(1666) ≈ 40.8 m/s

Therefore, the baseball will hit the ground with a speed of approximately 40.8 m/s.

A solid cylinder with mass M. radius R, and rotational inertia 1/2MR² rolls without slipping down the inclined plane
shown above. The cylinder starts from rest at a height H. The inclined plane makes an angle with the horizontal.
Express all solutions in terms of M, R, H, theta, and g.

a. Determine the translational speed of the cylinder when it reaches the bottom of the inclined plane.

b. Show that the acceleration of the center of mass of the cylinder while it is rolling down the inclined plane is (2/3)g sin theta.

c. Determine the minimum coefficient of friction between the cylinder and the inclined plane that is required for the cylinder to roll without slipping.

Answers

The acceleration of the center of mass of the cylinder is (2/3)g sinθ, and the minimum coefficient of friction between the cylinder and the inclined plane is μ_min = tanθ.

What is accelaration?

Acceleration is the rate of change of velocity of an object. It measures the rate at which an object's speed and direction changes. It is a vector quantity, meaning it has both magnitude and direction. Acceleration can be positive, negative, or zero. Positive acceleration indicates an object is speeding up, while negative acceleration indicates it is slowing down. Zero acceleration indicates an object is maintaining its current speed and direction.

Determine the translational speed of the cylinder when it reaches the bottom of the inclined plane.

b. Show that the acceleration of the center of mass of the cylinder while it is rolling down the inclined plane is (2/3)g sin theta.

c. Determine the minimum coefficient of friction between the cylinder and the inclined plane that is required for the cylinder to roll without slipping.

Answer:
a. The translational speed of the cylinder when it reaches the bottom of the inclined plane is given by v = (2gh sinθ/3)^1/2.

b. The acceleration of the center of mass of the cylinder is given by a = (2/3)g sinθ. This can be shown as follows: The acceleration due to gravity is g cos θ, so the normal force is Mg cos θ. The rotational inertia of the cylinder is 1/2MR², and its angular acceleration is a/R. By Newton's second law, the resultant force acting on the cylinder is ma = Mg cosθ - 1/2MR² a/R. Therefore, a = (2/3)g sinθ.

c. The minimum coefficient of friction between the cylinder and the inclined plane required for the cylinder to roll without slipping is μ_min = tanθ. This can be shown as follows: The force of friction acting between the cylinder and the inclined plane is given by F_f = μN = μMg cos θ. The force of friction must be equal to the centripetal force acting on the cylinder, which is Mv²/R. Therefore, μ = v²/gR = (2gh sinθ/3)^1/2/gR = tanθ.

In conclusion, we have shown that the translational speed of the cylinder when it reaches the bottom of the inclined plane is given by v = (2gh sinθ/3)^1/2, the acceleration of the center of mass of the cylinder is (2/3)g sinθ, and the minimum coefficient of friction between the cylinder and the inclined plane is μ_min = tanθ.

To know more about acceleration click-
https://brainly.com/question/460763
#SPJ1

What happens to light when it travels from air into water?

Answers

the light is refracted once it enters the water. since the light is passing from air which is less dense into water (more dense), it is bent towards the normal. the beam of light would appear to bend at the surface of the water.

two waves have the same amplitude of 3 meters. they arrive at the same place at the same time exactly in step with each other (the two crests from the two waves overlaps). what is this an example of? what will be the amplitude of the resulting wave?

Answers

The amplitude of this constructive wave, for example, will be 6 metres.

What is amplitude and example?

It refers to the greatest departure from equilibrium that a periodic motion item may exhibit. As an example, consider how a pendulum moves through its equilibrium point (straight down) before expanding to its farthest point.

How can amplitude be measured?

In most cases, amplitude is estimated by looking at a wave graph and determining the height of the wave from rest. The strength and intensity of the wave is gauged by its amplitude. For instance, the amplitude of a sound wave will indicate the volume of the sound.

To know more about Amplitude visit:

https://brainly.com/question/9525052

#SPJ1

brandon is on one side of a river that is 80 m wide and wants to reach a point 300 m downstream on the opposite side as quickly as possible by swimming diagonally across the river and then running the rest of the way. find the minimum amount of time if brandon can swim at 2 m/s and run at 4 m/s.

Answers

The minimum time Brandon can swim at 2 m/s is 144.5 seconds and run at 4 m/s is 55 seconds, with the distance traveled diagonally being 289 m

We have to find the minimum amount of time taken to reach the other side, as Brandon wants to reach a point 300 m downstream on the opposite side as quickly as possible by swimming diagonally across the river and then running the rest of the way.

So, the distance he covers in water = distance diagonally in water

And, the time he takes to cover this distance in water = distance/Speed => t = diagonal distance/speed of swimming

Also, the distance he covers in running = perpendicular distance

And, the time he takes to cover this distance in running = distance/Speed => t = perpendicular distance/speed of running

Given:

Width of river = AB = 80 m

Distance to reach = AC = 300 m

Speed of Swimming = 2 m/s

Speed of Running = 4 m/s

The minimum time taken will be the time taken to cover the total distance i.e. AB + BC

We know that AC = AB² + BC² (by Pythagoras theorem)

We have AC = 300, AB = 80, and speed of swimming = 2 m/s. Let BC = x, then we have:

x² = √(300² - 80²)

x² = √(90.000 - 6400)

x² = √(83.600)

x  = 289 m

So, the time he takes to cover this distance in water is:

t = diagonal distance/speed of swimming

t = BD/Speed of swimming

t = 289/2 = 144.5

Now, he covers the remaining perpendicular distance CD by running which is equal to 220m

The time he takes to cover this distance in running is:

t = perpendicular distance/speed of running

t = CD/Speed of running

t = 220/4 = 55 s

Learn more about the speed of swimming at https://brainly.com/question/29513950

#SPJ11

Calculate the unknown resistance R of the circuit as shown in figure, all resistance are connected in the series. The current is flowing through circuit is 2A and battery is of 20 voltage.
a. 1Ω
b. 2Ω
c. 4Ω
d. 6Ω
e. 12Ω

Answers

None of the given options result in a total resistance of 10Ω. Therefore, there is no correct answer among the options provided.To calculate the unknown resistance R of the circuit connected in series with a current of 2A and a battery voltage of 20V, follow these steps:

1. First, we need to determine the total voltage drop across the circuit. Since the battery voltage is 20V, the total voltage drop across all resistances in the circuit is also 20V.
2. According to Ohm's Law, Voltage (V) = Current (I) × Resistance (R). We are given the current (I) as 2A.



3. Now, we can use Ohm's Law to find the total resistance (R_total) of the circuit: V = IR → 20V = 2A × R_total → R_total = 20V/2A = 10Ω.
4. The problem states that all resistances are connected in series, which means the total resistance is the sum of all individual resistances: R_total = R1 + R2 + R3 + R (unknown resistance).



5. From the given options, we need to find the value of R that, when added to the other resistances, results in a total resistance of 10Ω.
6. By analyzing the options, we can see that the correct answer is:
a. 1Ω: R_total = 1Ω + 2Ω + 4Ω + 6Ω = 13Ω (not equal to 10Ω)
b. 2Ω: R_total = 1Ω + 2Ω + 4Ω + 2Ω = 9Ω (not equal to 10Ω)
c. 4Ω: R_total = 1Ω + 2Ω + 4Ω + 4Ω = 11Ω (not equal to 10Ω)
d. 6Ω: R_total = 1Ω + 2Ω + 4Ω + 6Ω = 13Ω (not equal to 10Ω)
e. 12Ω: R_total = 1Ω + 2Ω + 4Ω + 12Ω = 19Ω (not equal to 10Ω). Therefore none of the given option will be correct.

Here is the complete question link : https://www.toppr.com/ask/question/calculate-the-unknown-resistance-r-of-the-circuit-as-shown-in-figure-all-resistance-are/

To know more about resistance click here

brainly.com/question/30712325

#SPJ11

alpha particles (charge q= qe, mass m=6.6 x 10^6 x 10^27 kg) move at 1.6 x 10^6 m/s. what magnetic field strength would be required to bend them to a circular path of radius r=0.14 m

Answers

The magnetic field strength required to bend alpha particles to a circular path of radius r=0.14 m is 0.1975 T.

Determining the magnetic field strength:

First, we are to calculate the magnetic field required to bend alpha particles to a circular path of radius r = 0.14 m using the equation;r = (mv) / (qB) Where r = 0.14 mm, v = 1.6 × [tex]10^{6}[/tex] m/sq = q, e = 1.6 × [tex]10^{-19}[/tex] C, B = magnetic field Strength (T).

By substituting the values given above into the equation, we have 0.14 = (6.6 × [tex]10^{-27}[/tex] × 1.6 × [tex]10^{6}[/tex])/(1.6 × [tex]10^{-19}[/tex] × B). Simplifying the equation further, we have B = 0.1975 T

Therefore, the magnetic field strength required to bend alpha particles to a circular path of radius r=0.14 m is 0.1975 T.

To know more about alpha particles, visit:

https://brainly.com/question/15087470

#SPJ11

What is the work done on the box from x = 0m to 10m?

Answers

The force applied to the box multiplied by 10m equals the work performed on the box from x = 0m to 10m.

The work done on the box from x = 0m to 10m is the product of the force applied on the box and the displacement of the box. The work done is calculated as:

Work = Force × Displacement

Therefore, the work done on the box from x = 0m to 10m is:

Work = Force Applied × (10m - 0m)

work = Force Applied × 10m

Therefore, the work done on the box from x = 0m to 10m is equal to the force applied on the box multiplied by 10m.

learn more about work done Refer:brainly.com/question/30073908

#SPJ1

There is a 1.5 kg box on the table.
a) Draw the forces acting on the box and the table.
b) Calculate the weight of the box, its weight and the counteraction force of the table.

Answers

Answer:

a) The forces acting on the box and the table are as follows:

Weight of the box acting downwards (due to gravity)

Normal force acting upwards (from the table)

Frictional force (if the box is not moving, the frictional force will be equal and opposite to any force applied to move it)

b) The weight of the box is given by:

Weight = Mass x Acceleration due to gravity

Weight = 1.5 kg x 9.81 m/s^2

Weight = 14.715 N

The weight acts downwards due to gravity.

The counteraction force of the table is equal in magnitude and opposite in direction to the weight of the box, as per Newton's Third Law of Motion.

Therefore, the counteraction force of the table on the box is also 14.715 N, but it acts upwards to balance the weight of the box.

Explanation:

If the skid mark from a crashed vehicle measures approximately 70 ft, and the measured friction coefficient is 0.25, what was the initial vehicle speed prior to braking?

A. 65 mph
B. 40 mph
C. 23 mph
D. 15 mph

Answers

Therefore, the answer is C. 23 mph is the maximum initial speed that would result in a skid mark of 70 ft with a friction coefficient of 0.25.

What is the formula for final velocity?

Initial velocity (u) squared plus two times the acceleration (a) times the displacement equals final velocity (v) squared (s). Final velocity (v) is equal to the square root of initial velocity (u) squared plus two times the acceleration (a) times displacement when v is the variable being solved for (s).

[tex]v^2 = u^2 + 2as[/tex]

Where:

v is the final velocity (0 mph, as the vehicle comes to a stop)

u is the initial velocity we want to find

a is the acceleration due to friction, which is equal to the friction coefficient multiplied by the acceleration due to gravity [tex](a = 0.25 * 32.2 ft/s^2 = 8.05 ft/s^2)[/tex]

s is the distance the vehicle traveled before coming to a stop, which is the length of the skid mark (s = 70 ft)

Substituting the given values into the equation, we get:

[tex]0^2 = u^2 + 2(0.25 * 32.2 ft/s^2)(70 ft)\\[/tex]

Simplifying:

[tex]0 = u^2 + 2(8.05 ft/s^2)(70 ft)\\0 = u^2 + 1134 ft^2/s^2\\u^2 = -1134 ft^2/s^2[/tex]

Since we cannot have a negative value for velocity, we can conclude that the initial velocity must be less than 23 mph.

To know more about speed visit:-

brainly.com/question/28224010

#SPJ1

in one to two sentences explain how electromagnets move a maglev train​

Answers

Electromagnets are used to create a magnetic field which levitates the train above the track, and then by varying the current in the electromagnets, the train can be propelled forward or slowed down or stopped.

How does magnetic train levitate?

Maglev trains use the principle of electromagnetic suspension to levitate and propel the train. Electromagnets are placed on the underside of the train, and these electromagnets are energized with a current that creates a magnetic field.

This magnetic field interacts with the magnetic field of a conductor in the track, which creates an upward force that levitates the train above the track.

Once the train is levitated, the next step is to propel it forward. The same electromagnets that are used for levitation can be used to propel the train forward.

By varying the current in the electromagnets, the magnetic field created can be made to push or pull the train forward or backward. This process is known as magnetic propulsion or maglev propulsion.

Learn more about electromagnets here: https://brainly.com/question/12555869

#SPJ1

you are running around check 5 km an hour and then you increase your speed to 10 km an hour by what factors did you increase your kinetic

Answers

When a student runs at a speed of 5 km/h and then increases his or her speed to 10 km/h, the kinetic energy of the student increases by a factor of four. This is because kinetic energy is proportional to the square of the speed.

The formula for kinetic energy is:

K = 1/2mv²

where K is the kinetic energy, m is the mass of the object and v is the speed.

Since the mass of the student does not change, we can calculate the ratio of kinetic energy at the two speeds as follows:

K₁/K₂ = (1/2)m(v₁²/v₂²)

where v₁ is the initial speed of 5 km/h and v₂ is the final speed of 10 km/h.

K₁/K₂ = (1/2)m(5²/10²) = (1/2)m(1/4) = (1/8)K₂

Therefore, the kinetic energy at the final speed of 10 km/h is four times greater than the kinetic energy at the initial speed of 5 km/h. This means that the student increased their kinetic energy by a factor of four.

Here you can learn more about kinetic energy

https://brainly.com/question/999862#

#SPJ11  

Explain what types of data streams can support and how they handle the data.
What are they?

Answers

Data streams are continuous flows of data that can be used to capture, process, and analyze real-time information.

Types of data streams that can be supported include:

Data streams are typically handled by streaming data processing engines. These engines process and analyze the data as soon as it arrives, allowing for real-time insights and decision-making.

Sensor data streams: This type of data stream captures data from various sensors, such as temperature, humidity, motion, and pressure.Web service data streams: These data streams capture data from web services, such as weather, traffic, and stock market information.Database data streams: These data streams capture data from databases, such as customer data, product information, and financial transactions.Social media data streams: These data streams capture data from social media sites.Machine data streams: These data streams capture data from machines, such as production lines, robots, and industrial equipment.

They are used to capture data from a variety of sources, such as sensors, web services, databases, and other online sources.

Data streams are handled in real-time, meaning that they are processed and analyzed as soon as they arrive.

Learn more about data streams here:

https://brainly.com/question/29850540

#SPJ1

what frequency is detected by a stationary train? the velocity of sound is 343 m/s . answer in units of hz.

Answers

Sοund with frequency f0=492 Hz is emitted frοm a statiοnary sοurce. A big car mοving at a 2 ms-1 speed tοward the sοund sοurce reflects the sοund.

Hοw fast is that, fοr instance?  

The rate οf sοmething mοving in οne directiοn is called its velοcity. As an illustratiοn, think οf the velοcity οf a car driving nοrth οn such a highway οr the speed at which a rοcket takes οff. Because the velοcity vectοr is scalar, it always has the same absοlute value magnitude as the mοtiοn's speed.

Is speed always equal tο velοcity?

Only when a mοving bοdy mοves inside a single uninterrupted path dο the speed and velοcity measurements match in magnitude. Nοnetheless, if a bοdy dοesn't mοve in a single, straight line.

To know more about Velocity visit:

brainly.com/question/30559316

#SPJ1

Complete Question:

What frequency is detected by a stationary train? The velocity of sound is 343 m/s .

Answer in units of Hz.

Convert the following: (a) 1 000 kg into g. (b) 1 000 000 m into km (c) 0.0000037 kg to mg. (d) 0.00000125 m to mm.
how do you do it

Answers

Answer:

a) 1000000 g

b) 1000 km

c) 3,7 mg

d) 0,00125 mm

Explanation:

a) 1kg has 1000g, so we can make a proportion:

1 kg - 1000 g

1000 kg - x g

Use the property of the proportion to find x:

[tex]x = 1000 \times 1000 = 1 \times {10}^{6} \: g = 1000000 \: g[/tex]

b) 1 km has 1000 m, so let's do the same thing as we did earlier:

1 km - 1000 m

x km - 1000000 m

[tex]x = \frac{1000000}{1000} = 1000 \: km[/tex]

c) 1 g has 1000 mg and 1 kg has 1000 g, so 1 kg will have 1000 × 1000 =

[tex] {10}^{ 6} \: mg = 1000000 \: mg[/tex]

1 kg - 1000000 mg

0,0000037 kg - x mg

x = 0,0000037 × 1000000 = 3,7 mg

d) 1 m has 100 cm and 1 cm has 10 mm, so that means 1 m has 100 × 10 = 1000 mm

1 m - 1000 mm

0,00000125 m - x mm

x = 0,00000125 × 1000 = 0,00125 mm

I think I got it right

what would have happened if the cosmological constant of hydrogen were slightly larger? group of answer choices the stars would have burned out too soon for life to be given a chance to form the stars would not have been sufficiently large enough to maintain warm temperatures hydrogen would have been the only element in the universe, and life would not have emerged hydrogen would have been converted to helium, and there would be no enduring formulation of stars

Answers

The consequences if the cosmological constant of hydrogen were slightly larger would be that the stars would have burned out too soon for life to be given a chance to form.

In cosmology, the cosmological constant is a constant term introduced by Albert Einstein into his field equations of general relativity. It represents the energy density of the vacuum of space.

In the theory of general relativity, it is presumed to act as a cosmological repulsive force for accelerating the Universe's expansion. The cosmological constant is widely considered one of the best contenders for dark energy.

According to present observations, dark energy accounts for approximately 68 percent of the total energy in the Universe, while the remaining 27 percent is dark matter, which cannot be detected by electromagnetic radiation. The remaining 5% is standard matter.

Hence, this means that the cosmological constant is essential in sustaining the Universe as it is.

To answer the question, the consequences of a slightly larger cosmological constant of hydrogen would be that the stars would have burned out too soon for life to be given a chance to form.

Know more about cosmological constant here:

https://brainly.com/question/29427155

#SPJ11

a uniform electric field points along the x axis. if a stationary electron is placed in this field, in what direction will it be forced to sstart to move?

Answers

The electron will be forced to move in the direction of the electric field, which in this case is the positive x-axis direction.

The electric field exerts a force on the electron that is equal to the product of the charge of the electron and the magnitude of the electric field. The force will act to accelerate the electron in the direction of the electric field.
An electron that is stationary will be forced to move in the direction opposite to that of the electric field if it is placed in a uniform electric field that points along the x-axis. The direction of the electric field determines the direction of the force felt by the charged particle.A uniform electric field is one in which the electric field is the same at all points in space. The strength of the electric field, in this case, is independent of the position of the point in space. The electric field is a vector quantity that is directed along the direction of the force experienced by the charged particle that is placed in the field.

More on electric charges: https://brainly.com/question/12959984

#SPJ11

What does Neuwirth argue that the people in these communities need?

Answers

In her book "The Power of Community: How Cuba Survived Peak Oil," author and activist, Naomi Klein, describes the work of Lisa Margonelli and her book "Oil on the Brain: Petroleum's Long, Strange Trip to Your Tank."

Margonelli, who toured the US to research her book, discovered that while Americans may have little idea about where their gasoline comes from or how it gets to their tanks, people who live in areas where oil and gas are extracted and refined understand all too well.

Lisa Margonelli wrote, “A lot of communities see the oil industry as either something that gives them jobs, or something that poisons their air, water, and soil. But what I came to see is that what people in those communities really want is not so much jobs or environmental protection. They want respect, democracy, and a say in their future."

Similarly, Neuwirth argues that people in communities such as those he profiled in his book need agency and empowerment. They need to have the ability to shape their own lives and futures, rather than being subject to the whims of outside interests such as developers or government officials.

This agency can take many forms, such as access to education and training, organizing and mobilizing around community issues, and the ability to build and sustain local businesses and economies. By providing these opportunities, these communities can begin to take control of their own destinies and build more sustainable, equitable futures.

To know more about democracy, visit:

https://brainly.com/question/13158670

#SPJ1

A student is planning on making a change to a circut witch changhe will increase the current

Answers

There are several ways to increase the current in an electrical circuit, but it's important to keep in mind that any changes made should be done safely and within the limitations of the circuit components. Here are some possible options:

Decrease resistance: Ohm's Law states that current is directly proportional to voltage and inversely proportional to resistance. Therefore, decreasing resistance in a circuit will increase the current flowing through it. This can be done by replacing a high-resistance component with a lower-resistance one.

Increase voltage: Similarly, increasing the voltage in a circuit will also increase the current, as long as the resistance remains constant. This can be done by connecting a higher voltage power supply or battery to the circuit.

Add parallel branches: Adding more branches to a circuit in parallel can increase the overall current, as each branch provides an additional path for current to flow.

Increase capacitance or inductance: In circuits that contain capacitors or inductors, increasing the capacitance or inductance can increase the amount of current flowing through the circuit.

It's important to note that any changes made to a circuit should be done carefully and with an understanding of the potential risks involved. Seek guidance from a qualified professional if necessary, and always follow proper safety protocols.

To learn more about current refer to:

brainly.com/question/16880541

#SPJ4

object a has a mass m and a speed v , object b has a mass m/2 and a speed 4v , and object c has a mass 3m and a speed v/3 . rank the objects according to the magnitude of their momentum.

Answers

The ranks of the objects according to the magnitude of their momentum is object B > object A > object C.

Object A has a mass of m and a speed of v, Object B has a mass of m/2 and a speed of 4v, and Object C has a mass of 3m and a speed of v/3. To rank the objects according to their magnitude of momentum,

we must use the equation p = mv (momentum = mass x speed).

For Object A, p = mv = mv.
For Object B, p = mv = (m/2)(4v) = 2mv.
For Object C, p = mv = (3m)(v/3) = mv.

From the equation we can see that Object B has the greatest magnitude of momentum as its momentum is twice that of Object A and C. Objects A and C have the same magnitude of momentum, but Object C has a higher mass. Therefore, the order of the objects according to their magnitude of momentum is:

Object BObject AObject C

To know more about momentum refer here:

https://brainly.com/question/30677308#

#SPJ11

what has mobed to produce the charge on the plates

Answers

Charges need to be transferred from one plate to the other to generate a charge on a capacitor's plates. Electrons are usually moved from one plate to the other by attaching the plates to a power source, such as a battery.

The plate attached to the negative terminal of the battery becomes negatively charged and the plate connected to the positive terminal of the battery becomes positively charged when the power source is connected.

Until the potential difference between the plates equals the potential difference between the battery connections, electrons move from the negative plate to the positive plate. The flow of electrons stops at this moment, and the capacitor is fully charged.

In an electric field that is created between the plates of a capacitor, the charges on the plates are retained. The potential differential between the plates is produced by this electric field and is inversely proportional to the charge on the plates and their separation from one another.

learn more about capacitors here

https://brainly.com/question/21851402

#SPJ1

Find the moments of inertia Ix, Iy, I0 for a lamina that occupies the part of the disk x2 y2 ≤ 36 in the first quadrant if the density at any point is proportional to the square of its distance from the origin. (Assume that the coefficient of proportionality is k. )

Answers

To find the moments of inertia Ix, Iy, I0 for the given lamina, we first need to calculate its mass and centroid. The density at any point is proportional to the square of its distance from the origin,

so the mass element dm can be expressed as kr^2dA, where k is the coefficient of proportionality, r is the distance from the origin, and dA is the differential area element. Using polar coordinates, we can express the given region as 0 ≤ r ≤ 6 and 0 ≤ θ ≤ π/2. Integrating dm over this region, we get the total mass of the lamina as: M = ∫∫ kr^2dA = k ∫∫ r^2dA = k ∫θ=0..π/2 ∫r=0..6 r^2r dr d = k ∫θ=0..π/2 [r^4/4]_r=0..6 dθ = (3/5)πk(6^5) To find the centroid of the lamina, we can use the formulae: x_c = (1/M) ∫∫ xdm, y_c = (1/M) ∫∫ ydm Simplifying, we get: x_c = (1/M) k ∫∫ xr^2dA, y_c = (1/M) k ∫∫ yr^2dA.

Learn more about  density here:

https://brainly.com/question/29775886

#SPJ4

Other Questions
the difference between trade barriers and migration barriers. someone help me please and asap Does Kings opening paragraph appeal to the audiences emotions or logic? Picture provided please look at it and don't assume its the I Have A Dream speech because it's not. The initial population of a bacterial culture is 2000, growing at a fixed rate. Table shows the population every hour for six hours.A. Find the equation that models this relation. (round to one decimal place).B. Use the equation to find the population of bacteria after 12 hours after 24 hours. the alpha level for a hypothesis test defines the critical region the alpha level for a hypothesis test defines the critical region true false Question 3 a) What is the theoretical probability of rolling a sum of 8? b) What is your experimental probability of rolling a sum of 8? c) What are the odds of rolling a sum of 8? the unadjusted trial balance columns of a company's work sheet shows the store supplies account with a balance of $580. the adjustments columns shows a credit of $325 for supplies used during the period. the amount shown as store supplies in the balance sheet columns of the work sheet is: What is an angle that is adjacent to DHC? which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin