what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer 1

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons


Related Questions

Helicase is an enzyme responsible for unwinding the double helix of the DNA by breaking apart the hydrogen bonds between each of the base pairs. Which phase of the cell cycle is helicase most likely active?
A) S
B) М
C) G1
D) G

Answers

Helicase is an enzyme responsible for unwinding the double helix of the DNA by breaking apart the hydrogen bonds between each of the base pairs. Helicase is more active in the S phase of the cycle. Option A is the correct answer.

What are the events of the cell cycle?

The cell cycle consists of the interphase and the cell division phase, where the cell division takes a little time in comparison to the interphase. The parent cell spends the majority of its time in the cell cycle's interphase and less time in the cell division phase.

There are three phases in the cell cycle's interphase: G1, S, and G2. The cell grows in both the G1 and G2 phases, while the DNA replicates in the S phase.

 

Hence, helicase is an enzyme that is responsible for unraveling the double helix of DNA by breaking apart the hydrogen bonds between each base pair. Helicase is more active in the S phase of the cell cycle. Option A is the correct answer.

 

Learn more about the cell cycle here.

https://brainly.com/question/25282664

#SPJ6

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

Include at least 3 ways that illegal fishing impacts the environment and descriptions

Answers

Answer:

Goodluck. I hope I helped

Explanation:

Oceans support the livelihoods of an estimated 520 million people who rely on fishing and fishing related activities, and 2.6 billion people who depend on fish as an important part of their diet. But Illegal fishing is threatening the food supply of coastal communities as fish populations decline due to overfishing in areas fishers are not permitted to access. Addressing illegal fishing will positively contribute to the equitable growth and empowerment of the people who rely on oceans for food and income.

Pioneer species such as lichen and moss inhabit an area after a major disturbance such as a volcanic eruption. Over time, other species are found in the disturbed area and the number of pioneer species decreases. Why does the number of pioneer species decrease? The amount of available sunlight is reduced. The pioneer species can no longer thrive. ⊝ The area has more soil to support complex plants. The competition increases between organisms. ⊝ The area is more susceptible to the wind. Seeds are captured in the pioneer plants and germinate at a higher rate. ⊝ The temperature is not as extreme as it was following the disturbance. Fewer of the pioneer species reproduce. ⊝ CLEAR ALL ❮ PREVIOUS ... 3 4 5 6 7 8 9 10 11 12

Answers

Answer:

The competition increases between organisms.

Explanation:

 Primary succession occurs after a disturbance or disaster that leaves open spaces with no living organisms. These new open areas are the case, for instance, of a bare rock exposed due to a retreating glacier, a volcanic activity, or an intense fire. No previous species inhabiting this area are left.

These scenarios allow new species to grow. With time, new species arrive and manage to establish again. The order of the establishment depends on the strategies of each of the species to survive.

First, pioneer species arrive. These are the first inhabitants, mostly lichens or plants with the capability of surviving in such an environment. Only a few pioneers can establish in the open space. Pioneers modify the habitat. They make it more suitable for the posterior establishment of later species, converting rock into fertile soil. As conditions get better, new species arrive like grasses. Grasses and pioneers keep modifying the ground and making it better with time. Competition becomes more frequent between species. The first species are eventually eliminated by competition, while new species keep appearing and competing for resources. Habitat modification keeps on going while new species establish. They produce shadows, alter the temperature, and humidity, fertilizing the soil, competing for resources. Competition becomes more frequent between species. This sequence continues until there is not more facilitation, and the commuting reaches a climax, becoming stable and lasting for hundreds of years until another disturbance occurs.

In a scientific investigation, after the question is defined, the next step is most likely which of
the following statements?
A. Collecting the data
B. Formulating a hypothesis
C. Designing the experiment
D. Identifying materials needed

Answers

The answer is B
Because that’s what you’re supposed to do after

In a scientific investigation, the next step after the question is defined is to formulate a hypothesis. A hypothesis is a testable explanation or a prediction. Therefore, the correct option is B.

What is Hypothesis?

A hypothesis is the proposed explanation for a phenomenon. For a hypothesis to be scientific, the scientific method requires one to test it. Scientists generally form hypothesis on the basis of scientific hypotheses of previous observations that cannot satisfactorily be explained with the available scientific theories.

Types of hypothesis include simple hypothesis, complex hypothesis, and directional hypothesis.

After the question has been defined, the next step taken by a researcher is to form a hypothesis, or testable explanation. It is about making predictions based on the hypothesis and further test the prediction.

Therefore, the correct option is B.

Learn more about Hypothesis here:

https://brainly.com/question/17173491

#SPJ2

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

Find the measure of 3.

Answers

I think 131 but I’m not to sure...

Sound waves move the slowest through which medium? water ice air wood

Answers

Answer: The answer is the following.

the question is: sound waves move through which medium?

a. water

b. ice

c. air

d. wood

the best answer to this question would be c. air. <3

Explanation:

The Speed of Sound: Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids. Air is a gas so therefore, C. AIR IS THE CORRECT ANSWER :)

The sound waves move the slowest through which medium:

C.Air

The sound waves move the slowest through which medium is air. Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids.

Therefore, the correct option is C.

Know more :

https://brainly.com/question/14405871?referrer=searchResults

Mei likes biology and would like to work in a hospital. She wants to attend school for only one or two years beyond high
school. Which could be a possible career choice for her?
O epidemiologist
O geneticist
O sonographer
O pathologist

Answers

Answer:

Sonographer

Explanation:

This is because sonography require four years to study in school and a sonographer is an health care scientists who specializes in using ultrasonic imaging devices to produce scans, videos, diagnostic images, three dimensional images e t.c.

How are the functions of a carbohydrate and a lipid similar?
A. Both are a source of energy.
B. Both are replicated during meiosis.
C. Both lower the activation energy of reactions.
D. Both dissolve nutrients in the digestive system.

Answers

Both are a source of energy. So it will be A. Hope this helps!

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

Which were once eaten as a means of treating tooth aches: A) worms, B) spiders, or C) cockroaches?

Answers

Answer: hi I 4 my broter wa in thi ap

Explanation:

Answer:

I believe it is C

Explanation:

I hope this helps!

The fact that choanoflagellates and collar cells of sponges resemble each other supports the inference that ________. Group of answer choices choanoflagellates are animals choanoflagellates are more closely related to sponges than they are to protists choanoflagellates and sponges evolved similar cell structures through convergent evolution choanoflagellates and sponges are sister groups

Answers

Answer:

choanoflagellates and sponges are sister groups

Explanation:

The choanoflagellates are small unicellular organisms belonging to the Protista kingdom. These microorganisms are collared flagellates morphologically similar to the choanocyte cells of animal sponges, which have a central flagellum surrounded by a collar of microvilli. In consequence, it has been suggested that choanoflagellates may represent the closest living relatives of primitive metazoans (i.e., they are sister groups to sponges). This hypothesis has recently been supported by both molecular phylogenetic and comparative genomic analyses.

3
1 The table gives the content of glucose, urea and
calcium ions in the blood entering the kidney, in
the glomerular filtrate and in the urine of a person.
Values are given in mg per 100 cm'.
Component/mg per 100 cm
Blood Glomerular filtrate
Urine
Component
glucose
100
100
urea
26
26
1820
S
calcium ions
4
4
5
C
a):) Which of the components provides energy for
the body?
ii) Which of the components is a metabolic
waste product?
[1]
b) Explain why the figures for each component are the
same for the blood concentration and
glomerular filtrale.
[3]
c) i) If the
person
drank a large volume of water,
far more than was needed by the body,
predict what would happen to the figures
in the urine column.
[2]
ii) Describe the processes taking place in the
body to support your answer to (c)(i). [3]
3

Answers

Answer:

c

Explanation:

dmvs.dfm

The answer is “C”. Jahgheismbsgehsj

Why do cells need to undergo meiosis

Answers

Answer:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells. This process is required to produce egg and sperm cells for sexual reproduction. ... Meiosis begins following one round of DNA replication in cells in the male or female sex organs.

Which of these is an example of pathogen transfer via indirect contact?
a. kissing
b. handshaking
c. sexual intercourse
d. breathing infected air

Answers

Answer:

Did you read carefullly?

Explanation:

Wait ima help you im eating rn


What type of chart is used to help organize study and predict genetic inheritanc

Answers

Answer -(Pedigree Analysis)
A pedigree is a chart that shows the inheritance of a trait over several generations. A pedigree is commonly created for families, and it outlines the inheritance patterns of genetic disorders and traits. A pedigree can help predict the probability that offspring will inherit a genetic disorder.

Why do scientists carry out experiments?
A.
Because scientific knowledge is based on observations

B.
Because scientific knowledge is full of untested theories

C.
Because scientists like to control variables

D.
Because scientists like to work in labs

Answers

Answer:

A

Explanation:

the scientist always makes a hypothesis

What is the most common type of ocean pollution?

Answers

Cigarette butts are the most common form of marine litter.

GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)



What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?

A) It produces large amounts of spores.
B) It only produces seeds in the summer when it is driest.
C) Its seeds stay dormant until there is enough precipitation for them to grow.
D) It can produce seeds all year round that can grow in dry and wet conditions.

Answers

The answer is c. It hides its seeds until it is wet enough for them to reproduce.

Which of the following is a large artery that pushes oxygenated blood away from the heart to the rest of the
body?
O Pulmonary artery
O Superior Vena cava
Aorta
Pulmonary Vein

Answers

It is the aorta, which is basically the main artery in the body
The aorta, it’s the largest artery in the body

Plant Cell Writing Prompt
Part 2: Using your notes, write a detailed explanation of a plant cell, one of the most complex cells. Please be sure to write at least two paragraphs and highlight all parts used in your writing. Make sure your essay includes all the following parts:
cell membrane, genetic material (DNA), cytoplasm, ribosomes, cell wall, nucleus, rough endoplasmic reticulum, smooth endoplasmic reticulum, Golgi apparatus, a large vacuole, mitochondria, chloroplasts, lysosome.​

Answers

Answer:

Plant cell

Explanation:

Cell wall: cell wall is only found in plant cell . it is made up of cellulose. it's function is to give shape to the cell and protect the delicate inner parts of the cell. this cell is fully permeable. it means it will allow all substance to pass in. cell membrane is made up of protein and lipids. it's function is to control what comes in and out of the cell. this membrane is selectively permeable. it means it allows some substance to pass in and others don't. cytoplasm is large sac like structure. most chemical process occur here. chromoplast are the green pigments.

cell wall is only found in plant cell . it is absent In animal cell . the neucleus in the plant cell contain a pigments haemoglobin, which contain genetic information to the cell .

How does the motion of particles in a gas change as the gas cools? (1 point)
They move more slowly.
b
They move in a more circular pattern.
ос
They move faster.
d
They move more randomly.

Answers

that link it takes all your information help

nutrients are transported to the organs of the bloodstream by which system

Answers

Answer:

The blood circulatory system delivers nutrients and oxygen.

Explanation:

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

All 37 trillion cells in the human body came from?

Answers

Answer:

all 37 trillion cell in the body originates from a single fertilized egg called a zygote. The zygote divides repeatedly to produce an embryo. These embryonic cells continue to divide, differentiating into all the cell types present in the body of all humans (and other mammals), from a new-born baby to an elderly adult.

Examine the graph showing a comparison of transportation and emissions trends in the United States over the years 1980-2015.
Which statement best describes the trend for the six common pollutants, as shown in the graph?
A)
B)
The Clean Water Act addressed the six major pollutants that were
damaging the ecosystems.
The decline in vehicle miles traveled and US population correlates with a
drop in air pollution
The 1990 amendments to the Clean Air Act addressed the sources of acid
rain, smog, and toxic air pollutants.
A conversion to 100% renewable resources for energy harnessing and
electricity production caused a reduction in air pollution.
C)
D)

Answers

The sixth answer seems best

helppppp plzzzzzzzzzzzz​

Answers

Answer:

The answer is A.

Explanation:

The question is asking how the moon phase changes from a new moon to a full moon. You can see on the Picture that when it is a full moon, the order from left to right is Sun, Earth, and Moon.

Which of the following statements about coral reefs is TRUE?
O Coral reefs are generally less than ten years old.
o Coral reefs contain a great diversity of life and species.
O Coral reefs cover most of the world's ocean floor.
O Coral reefs contain very few species other than fish.

Answers

Answer:

The correct answer is "Coral reefs contain a great diversity of life and species." as while they cover 1% of the ocean floor, they are homes to more than 25% of marine life.

Explanation:

The following statements about coral reefs are true: "Coral reefs contain a great diversity of life and species." That is the second option, as the coral reefs are among the most diverse and biologically rich ecosystems on the planet.

What is the importance of coral reefs to the ecosystem?

The coral reef is a type of structure that forms large, interconnected structures, creating a habitat for a wide range of other species, such as fish, crustaceans, and mollusks, and the reef provides shelter and food for a diverse array of organisms. Coral reefs generally occur in warm waters along the coasts of tropical and subtropical areas, so climate change harms them.

Hence, the following statements about coral reefs are true: "Coral reefs contain a great diversity of life and species." That is the second option, as the coral reefs are among the most diverse and biologically rich ecosystems on the planet.

Learn more about the coral reefs here.

https://brainly.com/question/15794949

#SPJ6

The dominant trait for flower color in pea plants is purple (P) and the recessive trait is white flowers (p). What is the phenotype of a plant with the alleles, Pp?​

Answers

the phenotype for Pp would be the color purple
Other Questions
A blade of a windmill completes 1 rotation every 4 seconds. The outer end of the blade travels 600 feet in 1 rotation. What is the speed of the outer end of the blade in feet per minute? I NEED HELP ASAP I WILL GIVE BRAINLIESTSSelect the correct answer from each drop-down menu.Sean is a citizen of Britain. He has joined an international ____ because citizens from any nation can become a member. The ____ is an example of such an organization.1. peacekeeping organization, nongovernmental organization, government agency2. Peace Corps, Red Cross, USAID ILL GIVE BRAINLEST AND 50 PTS!what is the area of this parallelogram?36cm^267cm^277cm^298cm^2 a. The sum of two numbers is 22 and their difference is 14. i. Form the simultaneous equations. ii. Find the two numbers. Why were there so many religious pieces of art during the Medieval time period? Who is potrayed as the soldier with the flag in the cartoon further and deeper by david low How do fishermen take part in the destruction of life in the ocean? How do you know? Question 1 of 7 Which of the following best describes this first scene in the shortstory? Elizabeth planted a garden in a 16 foot by 8 foot area. To calculate the square foot area of the garden, she multiplied 16 by 8 and got a product of 128 square feet Which equation could Elizabeth use to check her answer? A) 16 x 8 = 128 B) 128 - 8 = 16 128 + 8 = 136 D. 128 - 8 = 120 please help What is the exact mean or average number of crabs found per site? Examine the graph.A labeled bar graph. A Steel Production by Country. B, the unlabeled y-axis. C, A key showing England as blue and Germany as orange. D, the x-axis showing years.Which letter corresponds to where the label "Country belongs on the graph?ABCD is this correct please dont randomly answer. but answer if u know Because he was the best writer among the team tasked with writing the Declaration of Independence, who actually wrote most of the Declaration of Independence? A. Thomas Jefferson B. John Adams C. Benjamin Franklin D. Robert Henry Lee the men and women who led the reform movement of the 1800s wanted to extend the... What type of claim is the author making?A. value claimB. fact claimC. policy claimD. cause claim What was one unusual characteristic of the new state of Poland? McGlone Corporation had a 1/1/17 balance in the Allowance for Doubtful Accounts of $40,000. During 2017, it wrote off $28,000 of accounts and collected $8,400 on accounts previously written off. The balance in Accounts Receivable was $800,000 at 1/1 and $960,000 at 12/31. At 12/31/17, McGlone estimates that 5% of accounts receivable will prove to be uncollectible. What should McGlone report as its Allowance for Doubtful Accounts at 12/31/17 Hosting a breakfast brunch for 25 people, you plan to serve scrambled eggs. The grocery sells eggs in cartons, and each carton can feed four people. How many cartons of eggs must you buy to ensure each guest a serving? A. 4c = 25 B. 25c > 4 C. 4c < 25 D. 25 _> 4c E. 4c _> 25 in triangle ABC shown below, L is the midpoint of BC, M is the midpoint of AB, and N is the midpoint of AC. Find the perimeter of trapazoid BMNC. Tambin asegrense de que todosa vanb. vayana visitar los museos.C ponganPlease select the best answer from the choices providedOAOB