Biology High School

what is the relation between weight of the body and weight of the heart​

Answers

Answer 1
300g in males 200g in females

Related Questions

do plant cells have DNA ?

Answers

Answer:

Yes

Explanation:

Plant DNA is found in the plant cells nucleus, mitochondria and chloroplasts!

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.
​

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

4a. Describe two examples of non-living things that have one or more of these characteristics of
life.

Answers

Answer:

Water and Air

Explanation:

Water and air both are missing cells that living things have.

Please Help Assap!!!
Which is a factor that keeps Earth in orbit around the Sun?

the orbital path of the moon

the gravitational pull of the Sun

the continuous motion of the universe

Earth’s changing speed and direction

Answers

Answer:

The gravitational pull of the Sun

Explanation:

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:


Observing Footprints from the Past
detective"O" (observation) or I (inference)

Answers

Answer:

dfvas

Explanation:

sadvadsssssss

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as...  Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

which organ produces egg in female human body?

Answers

Answer:

ovary

Vagina!!

LoL

Explanation:

Mark me the Brainliest

Answer:

Ovary

Explanation:

Hope it helps

:)

please mark as brainliest if you want

I need help for this one

Answers

Answer:

Cl2

Explanation:

Answer: Cl2           Hope this helps!

Explanation:

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

Patients with a specific medical condition have been provided with a new device that helps them manage their condition. The patients will be required to participate in a survey regarding the usefulness of the device. How can the manufacturer be certain that no bias enters into the surveys? Group of answer choices

Answers

Answer:

by providing a toll-free number in case there are questions about the devices.

Explanation:

One of the best ways to make certain that this does not happen is by providing a toll-free number in case there are questions about the devices. Doing so makes sure that the customers are fully aware and understand the device and what it is doing. This prevents the customer from assimilating other benefits that they may experience which have nothing to do with the provided device into the survey and potentially contaminating the data with false feedback.

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

plz help I will mark you brainlist plz ​

Answers

Answer:

1. Acid

2.  Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)  

10. acid

*Anybody correct me if I'm wrong*

Explanation:

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?​

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water

are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it

Answers

Answer:

C. Steroids

Explanation:

Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.

Answer:

steroids

Explanation:

so c

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

PLEASE HURRY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!



What variable is found on the Y-Axis on the HR diagram?

Answers

Temperature increases to the left

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

Viral DNA that is integrated into a bacterial chromosome is a

Answers

Answer:

Hidden virus.

Explanation:

It will sit in the cell's DNA for a while and then attack.

29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x

Answers

Answer:

B is the correct answer

Explanation:

4x10=40

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

Concept 2 Multiple Choice (2pts each)
1. Which of the following tems represents the smallest part of an element that still has the properties of that element?
A. Cell
B. Matter
C. Atom
D. Molecule

Answers

Molecule dddddddddddddd
It is a molecule because you can already cross out cell and matter and atom.

The __________ variable in an experiment is the one that the scientist intentionally changes in an experiment. The _______ variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called _______

Answers

Answer:

idependent#1dependent#2and control variable is #3

Explanation:

The indwpendent variable in an experiment is the one that the scientist intentionally changes in an experiment. The dependent variable in an experiment is the one that the scientist measures / observes. Values that are kept the same in an experiment and NOT changed are called Conttol variable

describes natural selection?

Answers

Simply, natural selection is that the genetically strongest organisms will be the ones that are able to survive and reproduce, which eliminates weak characteristics, and keeps the strong ones. Survival of the fittest.

True or false: the landmass built up by the dropping of till by a glacier is called alluvial

Answers

Answer: False

Explanation:

Other Questions
Why do you possess positive attitude explain ( at least 4 sentences) Considering only functions that have a rate of change less than that represented in the graph, which function has the greatest rate of change?A. y = 7/6x + 2/3B. y = 7/5x + 7/5C. y = 6/5x + 11/5D. y = 5/4x + 15/4 Which graph shows y < x^2 + 1 HELP PLS!!! 50PTS!!! An explanation is welcome! Using the formula Q = m x ^T x Cp, solve for energy, and round your answer to the correct number of sig figs and show all work:1) How much heat is absorbed by 1210. g water (Cp = 4.184 J/g*C) when it is heated from 20*C to 45*C A problem of interest to health officials (and others) is to determine the effects of smoking during pregnancy on infant health. One measure of infant health is birth weight; a birth weight that is too low can put an infant at risk for contracting various illnesses. Since factors other than cigarette smoking that affect birth weight are likely to be correlated with smoking, we should take those factors into account. For example, higher income generally results in access to better prenatal care, as well as better nutrition for the mother. An equation that recognizes this is bwght 5 b0 1 b1cigs 1 b2 faminc 1 u. (i) What is the most likely sign for b2 Why the following triangles are congruent! Simplify 25(1427)+2516.marking brainlest why did structural steel allowed cities to grow vertically not just horizontal? Help been stuck on this for an hour A box has a volume of 456 cubic inches, with a length of 1 foot and a height of 4 inches. Determine the width of the box. Which of the following equations correctly represents the set-up to solve for x?A: x-6+2x=10B: x-6+2x=90C: x-6=2x-8D: x-6+2x-8=180 Read the passage.Surrender Speechby Black Hawk1832You have taken me prisoner with all my warriors. I am much grieved, for I expected, if I did not defeat you, to hold out much longer, and give you more trouble before I surrendered. I tried hard to bring you into ambush, but your last general understands Indian fighting. The first one was not so wise. When I saw that I could not beat you by Indian fighting, I determined to rush on you, and fight you face to face. I fought hard. But your guns were well aimed. The bullets flew like birds in the air, and whizzed by our ears like the wind through the trees in the winter. My warriors fell around me; it began to look dismal. I saw my evil day at hand. The sun rose dim on us in the morning, and at night it sunk in a dark cloud, and looked like a ball of fire. That was the last sun that shone on Black Hawk. His heart is dead, and no longer beats quick in his bosom. He is now a prisoner to the white men; they will do with him as they wish. But he can stand torture, and is not afraid of death. He is no coward. Black Hawk is an Indian.He has done nothing for which an Indian ought to be ashamed. He has fought for his countrymen, the squaws and papooses, against white men, who came, year after year, to cheat them and take away their lands. You know the cause of our making war. It is known to all white men. They ought to be ashamed of it. The white men despise the Indians, and drive them from their homes. But the Indians are not deceitful. The white men speak bad of the Indian, and look at him spitefully. But the Indian does not tell lies; Indians do not steal.An Indian who is as bad as the white men, could not live in our nation; he would be put to death, and eat [sic] up by the wolves. The white men are bad school-masters; they carry false looks, and deal in false actions; they smile in the face of the poor Indian to cheat him; they shake them by the hand to gain their confidence, to make them drunk, to deceive them, and ruin our wives. We told them to let us alone; but they followed on and beset our paths, and they coiled themselves among us like the snake. They poisoned us by their touch. We were not safe. We lived in danger. We were becoming like them, hypocrites and liars, adulterers, lazy drones, all talkers, and no workers.We looked up to the Great Spirit. We went to our great father. We were encouraged. His great council gave us fair words and big promises, but we got no satisfaction. Things were growing worse. There were no deer in the forest. The opossum and beaver were fled; the springs were drying up, and our squaws and papooses without victuals to keep them from starving; we called a great council and built a large fire. The spirit of our fathers arose and spoke to us to avenge our wrongs or die . . . . We set up the war-whoop, and dug up the tomahawk; our knives were ready, and the heart of Black Hawk swelled high in his bosom when he led his warriors to battle. He is satisfied. He will go to the world of spirits contented. He has done his duty. His father will meet him there, and commend him.Black Hawk is a true Indian, and disdains to cry like a woman. He feels for his wife, his children and friends. But he does not care for himself. He cares for his nation and the Indians. They will suffer. He laments their fate. The white men do not scalp the head; but they do worsethey poison the heart, it is not pure with them. His countrymen will not be scalped, but they will, in a few years, become like the white men, so that you cant trust them, and there must be, as in the white settlements, nearly as many officers as men, to take care of them and keep them in order.Farewell, my nation. Black Hawk tried to save you, and avenge your wrongs. He drank the blood of some of the whites. He has been taken prisoner, and his plans are stopped. He can do no more. He is near his end. His sun is setting, and he will rise no more. Farewell to Black Hawk.Read this excerpt from the last paragraph of the speech.Farewell, my nation. Black Hawk tried to save you, and avenge your wrongs. He drank the blood of some of the whites.How does Black Hawk use rhetoric to advance his purpose in this excerpt?A.) He directly addresses his nation because he does not intend for the white men to hear the last paragraph of his speech.B.) He uses imagery to evoke feelings of remorse to show that he regrets his actions toward the white men.C.) He uses imagery to paint a picture of the wrongs he tried to avenge, which furthers his purpose of describing the white mens evils.D.) He directly addresses his nation to show that even though he is surrendering, he still has allegiance to his nation. A line has the following equation: y=\frac{6}{7}x+5y= 76 x+5What is the slope of a line parallel to the given line?Question Blanktype your answer...What is the slope of a line perpendicular to the given line?Question Blanktype your answer... what is multiple point perspective 312,919,563x500999,527 In your biology career, you may come across people attempting to use the Second Law of Thermodynamics to discredit the idea of evolution. Their argument goes something like this: The theory of evolution says that life evolved from smaller inorganic molecules to larger organic molecules to simple one-celled organisms to more complex multicellular organisms, moving towards more complexity and organization. But the Second Law of Thermodynamics says that entropy always increases, with everything moving towards increasing disorder. Therefore, if the Second Law is correct, then evolution is impossible. How would you respond to this argument In the space provided, summarize the case of McCulloch v. Maryland. What were the key points of the case? Why was this case important? whats is the 39th triangular number An employee worked 36 hours last week. This week, she worked 48 hours. Find the percent increase. Round to the nearest percent. wat is the answer