What is the energy yield number of ATP produced in aerobic metabolism of glucose What is the energy yield from anaerobic glycolysis?

Answers

Answer 1

The energy yield number of ATP produced in aerobic metabolism of glucose and the energy yield from anaerobic glycolysis is 36 ATP molecules, and 2 ATP molecules, respectively.

Aerobic metabolism is a process that occurs when there is adequate oxygen present in cells. The breakdown of glucose in the presence of oxygen produces a net total of 36-38 ATPs (Adenosine triphosphate), depending on which source of literature is used. Glycolysis yields 2 ATP molecules in the first step of glucose metabolism. The electron transport chain has a total yield of 34 ATP molecules. The 34 ATP molecules are produced by the electron transport chain in the last step of aerobic respiration. In the end, the yield is a net total of 36 ATP molecules (2 from glycolysis and 34 from the electron transport chain)

Anaerobic respiration is a type of respiration that occurs when there is an absence of oxygen in cells. In the absence of oxygen, the breakdown of glucose produces only 2 ATP molecules. The yield is a net total of 2 ATP molecules (from glycolysis) and 2 lactate molecules as end products. Anaerobic respiration produces less energy (only 2 ATP molecules) than aerobic respiration (36 ATP molecules). Therefore, anaerobic respiration is less efficient.

Learn more about ATP here: https://brainly.com/question/893601.

#SPJ11


Related Questions

calculate the filtered load of a substance that is dissolved in plasma given the plasma concentration of 0.065mg/ml and a GFR of 125 ml/min. consider that 30% of the substance is bound to plasma proteins. Round the answer to one decimal place.

Answers

The filtered load of the substance is 5.7 mg/min.

To calculate the filtered load of a substance, we need to use the formula:

Filtered load = Plasma concentration × GFR

Given the plasma concentration of 0.065 mg/ml and a glomerular filtration rate (GFR) of 125 ml/min, we can plug these values into the formula:

Filtered load = 0.065 mg/ml × 125 ml/min

Filtered load = 8.125 mg/min

However, we also need to consider that 30% of the substance is bound to plasma proteins. This means that only 70% of the substance is actually being filtered. To account for this, we need to multiply the filtered load by 70%:

Filtered load = 8.125 mg/min × 0.70

Filtered load = 5.6875 mg/min

Finally, we need to round the answer to one decimal place:

Filtered load = 5.7 mg/min

Learn more about glomerular filtration rate here: https://brainly.com/question/28288789.

#SPJ11

You are brewing beer using hopps and a facultative anaerobic
yeast. When you test the product, it has no alcohol. What are some
possible explanations?

Answers

If the beer has no alcohol, it may be due to problems with the fermentation process, the yeast, or the storage of the beer after fermentation.

There are several possible explanations for why the beer has no alcohol when using hopps and a facultative anaerobic yeast as follows:

1. There may have been a problem with the fermentation process, either due to incorrect temperature or a lack of nutrients for the yeast.

2. The yeast may have died before converting all of the sugars into alcohol.

3. The yeast may have been inactive or not used in the correct amount or concentration.

4. The beer may not have been left to ferment for long enough.

5. The beer may have been exposed to oxygen during the fermentation process, which can cause the yeast to die or become inactive.

6. The beer may not have been stored correctly after fermentation, which can cause the alcohol to evaporate or be lost in some other way.

7. The yeast strain used may not be suitable for producing alcohol from the particular sugars used in the beer mash or wort.

You can learn more about fermentation at: brainly.com/question/13050729

#SPJ11

1. What are two other pathologies that may occur in
patients with Leber’s hereditary optic neuropathy (sometimes
described as LHON plus)
2. Why is there a difference in the major variants that
cause

Answers

1. Two other pathologies that may occur in patients with Leber's hereditary optic neuropathy (LHON) are Cardiac arrhythmias,  Neurological disorders.

2. The difference in the major variants that cause LHON is due to the different genetic mutations that are involved.

1. Two other pathologies that may occur in patients with Leber's hereditary optic neuropathy (LHON) are:
a. Cardiac arrhythmias: Some patients with LHON may develop cardiac arrhythmias, which are irregular heartbeats that can be life-threatening.
b. Neurological disorders: Some patients with LHON may also develop neurological disorders, such as tremors, dystonia (a movement disorder), and peripheral neuropathy (damage to the nerves outside the brain and spinal cord).
2. The difference in the major variants that cause LHON is due to the different genetic mutations that are involved. LHON is caused by mutations in the mitochondrial DNA, specifically in the genes that encode for proteins involved in the electron transport chain. The three major variants of LHON are caused by mutations in the genes MT-ND1, MT-ND4, and MT-ND6. Each of these mutations affects the function of the electron transport chain in a different way, leading to the different clinical presentations of LHON.

For more such questions on  genetic mutations, click on:

https://brainly.com/question/4735157

#SPJ11

What is the exponential function for bacterial growth?

Answers

The exponential function for bacterial growth is N(t) = N₀e^(rt),

The exponential function is N(t) = N₀e^(rt);

N(t) is the number of bacteria at time t

N₀ is the initial number of bacteria

e is the mathematical constant approximately equal to 2.718

r is the growth rate

t is time.

This formula describes the exponential increase in the number of bacteria over time, assuming unlimited resources for growth. The growth rate, r, is a constant that depends on the specific bacteria and growth conditions. This formula is used in microbiology and related fields to model and predict bacterial growth.

To know more about bacterial growth click here:

https://brainly.com/question/14461247

#SPJ11

7. The presence of too much nitrogen in a water body can have devastating
effects. (10 points)
A. What is the name of the process that occurs when there is too much
nitrogen in a water body? (2 points)
B. What events occur during this process? (8 points)

Answers

The name of the process that occurs when there is too much nitrogen in a water body is eutrophication which leads to the increase of algae species, especially toxic algae, and also an increase in turbidity of the water.

What are the effects of the natural process of eutrophication in water?

The effects of the natural process of eutrophication in water are associated with an increase in biodiversity, especially of toxic algae, and also to an increase in turbidity which hampers photosynthesis.

Therefore, with this data, we can see that the effects of eutrophication include an increase in toxic algae.

Learn more about eutrophication here:

https://brainly.com/question/29050891

#SPJ1

Explain what is meant by long-day and short-day plants—to what
are they responding and how?

Answers

Long-day plants and short-day plants are plants that flower at different points in the day based on the length of sunlight they are exposed to. Long-day plants flower when exposed to long periods of daylight, while short-day plants flower when exposed to short periods of daylight. They respond to photoperiod, the period of light to darkness in a 24-hour cycle.

Long-day plants will flower when the amount of daylight is greater than the amount of darkness in a given day, typically more than 12 hours of daylight. When the length of the day is shorter, the plant will not flower. Examples of long-day plants include spinach, rhubarb, and barley.
Short-day plants, on the other hand, require short periods of daylight in order to flower. They typically flower when there are 8-10 hours of daylight in a given day.
The length of the photoperiod affects the growth and flowering of the plants by controlling their flowering hormones. When exposed to the right photoperiod, the plants produce the hormones necessary for flowering.

To know more about photoperiodism refer here:

https://brainly.com/question/23017696

#SPJ11

One of the first scientist in the Renaissance to advance taxonomy through first hand observation

Answers

One of the first Renaissance scientists, Valerius Cordus (1515–1544), described plants using first-hand observations of living organisms.

Students and taxonomists started classifying based on traits instead of uses starting in the seventeenth century. Among the first taxonomists of the Renaissance, he classified plants into groups or categories and used a scientific name with two words. The confusion caused by the proliferation of plant names was significantly lessened by his work. Growing quickly was taxonomy. It was becoming impossible to keep up with the vast amount of new plants and animals being discovered around the globe. There was a need for better-identifying techniques as well as descriptions. It was thus possible to classify plants and animals in a more rational, scientific fashion.

The complete question is:

One of the first scientists of the Renaissance to advance taxonomy through first hand observations was Aristotle.

Learn more about proliferation here:

https://brainly.com/question/29547775

#SPJ4

3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible.

Answers

Antibiotic resistance in bacteria can arise through different mechanisms. The most common way is through genetic mutations or the acquisition of resistance genes from other bacteria.

In the case of a nonpathogenic bacterium acquiring resistance, it can happen through horizontal gene transfer, where it receives a plasmid containing antibiotic resistance genes from another bacterium that has acquired it previously.

Once the nonpathogenic bacterium acquires the resistance gene, it can start producing enzymes that can break down the antibiotic or modify the antibiotic target, rendering it ineffective.

This results in the bacterium being able to survive and multiply in the presence of the antibiotic. If this resistance gene is then passed down to the bacterium's progeny, it can result in the emergence of a new resistant strain.

For more questions like Bacteria click the link below:

https://brainly.com/question/8008968

#SPJ11

NEED HELP

Your digestive system is very important. It breaks down the food you eat into a form your body can use to nourish your cells and provide energy to your muscles. When your digestive system doesn’t work properly, it causes problems which reduces or limits how much or how well your body receives the energy and nourishment it needs. Symptoms vary widely depending on the problem. These can change over time, which can make the problem difficult to diagnose and treat properly.

Research one of the digestive disorders found on the website below, or any other you find. Create a power point presentation on the disorder and its symptoms, along with who it can affect most, and what other issues it can cause. Also include information on any medications or treatments available and indicate how they help control the disorder or relieve symptoms, and how effective they are. Make sure to cite your sources, and include statistics in a table or a graph based on information you found about your disorder.

Answers

People with lactose intolerance are unable to fully digest the sugar (lactose) in milk. As a result, they have diarrhea, gas and bloating after eating or drinking dairy products. The condition, which is also called lactose malabsorption, is usually harmless, but its symptoms can be uncomfortable.Treatment consists of diet modifications

Treatment focuses on avoidance of dairy products, use of lactose-free products, or the use of lactase supplements.

https://www.mayoclinic.org/diseases-conditions/lactose-intolerance/symptoms-causes/syc-20374232#:~:text=People%20with%20lactose%20intolerance%20are,its%20symptoms%20can%20be%20uncomfortable.

The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).
TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA
3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.
B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.
C.- Indicate the effect on the protein in the following cases:
3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.
3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.
3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.
C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.
C.5.- Genomic rearrangement involving an inversion of codons 3 to 5.

Answers

A. The consensus sequences of the bacterial promoter are -10 (TATAAT) and -35 (TTGACA).

B. The synthesised protein would have the sequence: Met-Ala-Pro-Pro-Ser-Asp-Asp-Trp-Arg-Val-Asn-Asn-Arg-Leu-Asp.

C.1. Insertion of 3 bases in the consensus sequence of the promoter would likely disrupt the binding of RNA polymerase and prevent transcription from occurring, leading to no protein being produced.

C.2. Deletion of 3 bases in the consensus sequence of the promoter would also likely disrupt the binding of RNA polymerase and prevent transcription from occurring, leading to no protein being produced.

C.3. Insertion of 1 base in the consensus sequence of the promoter may or may not disrupt the binding of RNA polymerase, depending on the location and identity of the inserted base.

C.4. Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence would likely result in a frameshift mutation, causing a change in the reading frame and potentially altering the amino acid sequence of the protein.

C.5. Genomic rearrangement involving an inversion of codons 3 to 5 would result in a change in the amino acid sequence of the protein, potentially altering its function.

The consensus sequences of the bacterial promoter are specific DNA sequences that are recognized by RNA polymerase during transcription initiation. The promoter region of a bacterial gene typically contains two important conserved sequences, -10 and -35, located upstream of the transcription start site.

These sequences help to position the RNA polymerase correctly for transcription initiation and are critical for efficient transcription of bacterial genes.

Learn more about bacterial promoter brainly.com/question/15319293

#SPJ11

Temperature Differences, GHK, Constant Field Equations: Sometimes in order to determine membrane voltages correctly, you have to know the permeability, ionic concentrations, and temperature to calculate a correct number.
a) The Nernst Equilibrium formula is usually used at room temperature (20 C). The human body has a temperature of 37 C. Approximate EK using the numbers above for a temperature of 37 C.
b) Determine Vm using the following ion concentrations and permeabilities: [K]i = 168, [K]o = 6, [Na]i = 50, [Na]o = 337, [Cl]i = 41, [Cl]o = 340 PK = 1, PNa = 0.019, PCl = 0.381

Answers

The Nernst Equilibrium at room temperature is -78.5 mV and the membrane voltage using the following ion concentrations and permeabilities is 53.4 mV.

a) To calculate the Nernst Equilibrium (EK) at a temperature of 37°C, we can use the following equation:
Nernst Equilibrium, EK = -RT/zF ln([K]i/[K]o)

Where R is the gas constant (8.314 J/mol*K), T is the temperature in Kelvin (310.15 K), z is the valence of potassium (1), and F is the Faraday constant (96,500 C/mol).

Plugging in the given values, we get:
EK = -(8.314 J/mol*K)*(310.15 K)/(1)*(96,500 C/mol) ln(168/6) = -78.5 mV

b) To determine the membrane voltage (Vm), we need to use the GHK Constant Field equation, which is:
Vm = RT/F ln([K]o[Na]i + [Cl]i)/[K]i[Na]o + [Cl]o)
Where R, T, and F are the same as in the Nernst Equation.

Plugging in the given values, we get:
Vm = (8.314 J/mol*K)*(310.15 K)/(96,500 C/mol) ln((6*50 + 41)/(168*337 + 340)) = 53.4 mV

Know more about Nernst Equilibrium here:
https://brainly.com/question/28304088

#SPJ11

Describe some methods you could use to study cultural diversity/differences between human societies that drive evolution
and change. Where/when/how-logistics? Materials?Interviews/polls/surveys?

Answers

To study cultural diversity/differences between human societies that drive evolution and change, some methods that can be used are fieldwork, ethnography, documentary research and archival analysis, interviews, polls, and surveys.

Fieldwork is a type of research where researchers immerse themselves in the community they are studying. They observe and record people's behavior, beliefs, customs, and practices over a long period of time. Ethnography is the written account of this research, this method provides first-hand information about cultural diversity, enabling a better understanding of its causes and implications. Fieldwork and ethnography can be expensive, and the logistics can be challenging, but the data gathered can be invaluable.

Documentary research and archival analysis involve the study of existing documents, such as newspapers, government records, diaries, or literary works, to uncover information about different societies. This method helps to understand the cultural differences between societies that drive evolution and change. It can be done remotely and is relatively inexpensive. However, the validity and accuracy of the information gathered depend on the reliability and quality of the sources used.

Interviews, polls, and surveys are methods of gathering information from people. They can be used to study cultural diversity by asking people about their beliefs, customs, and practices, this method can be relatively easy and inexpensive. However, the accuracy of the information gathered depends on the quality of the questions asked and the sample of people surveyed. In conclusion, to study cultural diversity/differences between human societies that drive evolution and change, methods such as fieldwork and ethnography, documentary research and archival analysis, and interviews, polls, and surveys can be used. The choice of method depends on the research question, logistics, materials available, and the level of detail required.

Learn more about fieldwork at:

https://brainly.com/question/30258254

#SPJ11

You could use methods such as conducting interviews, polls, or surveys to gather data on the topic. You could also use a combination of quantitative and qualitative methods, such as analyzing written materials, journals, books, and artifacts.

Additionally, you could observe behavior in different societies and draw conclusions based on the observations. When conducting your research, make sure to consider the logistics such as when and where to conduct the study and how long it should take. Lastly, having the appropriate materials such as writing utensils and recording devices is essential for successful data collection.

What is participant observation?

Participant observation is a research method used in anthropology, sociology, and other social sciences. It involves observing and participating in the activities of the people being studied, in order to understand their culture, beliefs, and behaviors.

This method can be used to study a wide range of phenomena, from everyday life to rituals, festivals, and ceremonies.What are surveys, interviews, and polls?Surveys, interviews, and polls are methods used to gather data from a sample of people. Surveys typically involve asking questions to a large group of people, either face-to-face, by telephone, or online. Interviews involve asking open-ended questions to a smaller group of people, in order to gather detailed information about their experiences and perspectives. Polls are similar to surveys, but they usually focus on a specific question or issue, and are often used to gauge public opinion about political or social issues.

Learn more about interview at https://brainly.com/question/30054467

#SPJ4

1. Assign genotypes to all individuals in the pedigree using the symbols A and a. Use the underscore "_" symbol when you can’t determine whether an individual is heterozygous or homozygous dominant.
2. What is the probability that the child of Maria and Adam will be affected?

Answers

1. The genotypes of all individuals in the pedigree using the symbols A and a when can’t determine whether an individual is heterozygous or homozygous dominant are

Genotype of I-1 = aaGenotype of I-2 = AaGenotype of II-1 = AaGenotype of II-2 = aaGenotype of III-1 = AaGenotype of III-2 = AaGenotype of III-3 = aa

2. The probability that the child of Maria and Adam will be affected is 50%.

The genotype of Adam is not provided in the given pedigree, therefore, we cannot determine whether he is homozygous dominant or heterozygous dominant. However, we know that Maria is heterozygous dominant (Aa).

If Adam is homozygous dominant, his genotype will be AA. Therefore, the genotype of the child of Maria and Adam will be Aa, and the child will be unaffected. If Adam is heterozygous dominant (Aa), there is a 50% chance that he will pass the recessive allele to the child. Therefore, the genotype of the child of Maria and Adam will be aa, and the child will be affected.

For more information about homozygous dominant refers to the link: https://brainly.com/question/30703457

#SPJ11

What is channel protein in cell membrane?

Answers

Channel proteins are transmembrane proteins that assist in the movement of substances across cell membranes.

These channels form aqueous pores across the lipid bilayer of a cell membrane and allow small, water-soluble molecules to pass through them.

A channel protein is a protein that spans the cell membrane and helps to regulate the flow of molecules across it. These proteins, which are also known as ion channels, act as selective gates to allow the passage of ions, water, and other small molecules down their concentration gradient, in response to a variety of stimuli.

They are found in various cells of the human body, including nerve cells, muscle cells, and cells of the digestive system, and they play an important role in the transmission of information and the regulation of cellular processes. Channel proteins can be activated by a variety of stimuli, including voltage changes, chemical signals, and mechanical force.

To learn more about cell membrane, click here:

https://brainly.com/question/13524386

#SPJ11

Table 1: Time Required for Methylene Blue Color Change (10 points)
Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time- Start Time)
0 hours 1 hour 3 hours 4 hours

Answers

The table shows the time it took for the methylene blue color change for four different milk samples.

For the first sample, the start time was 0 hours and the end time was 1 hour, with a time elapsed of 1 hour.

For the second sample, the start time was 1 hour and the end time was 3 hours, with a time elapsed of 2 hours.

For the third sample, the start time was 3 hours and the end time was 4 hours, with a time elapsed of 1 hour.

Lastly, for the fourth sample, the start time was 4 hours and the end time was 0 hours, with a time elapsed of 4 hours.

In summary, the table shows that the time required for the methylene blue color change varied for the different milk samples, with a maximum time elapsed of 4 hours and a minimum time elapsed of 1 hour.

To know more about methylene refer here:

https://brainly.com/question/29426391#

#SPJ11

You performed a cross of two plants (one purple and one white) focusing on flower colors. You are aware that two genes are responsible for flower colors in this plant, but you are unsure of whether the two genes interact with each other. You cross two pure-breeding plants, one white and one purple, and all the plants in the F1 generation are purple. After crossing two members of the F1 generation, you notice the following phenotypes:
Purple – 120
White – 8
Calculate the phenotype ratio – 15:1
Provide the likely mode of inheritance and one reason supporting your answer –

Answers

The phenotype ratio, in this case is 120:8, which can be simplified to 15:1.

This indicates that the likely mode of inheritance is incomplete dominance, where one allele is not completely dominant over the other and the resulting phenotype is a blend of the two. One reason supporting this answer is that the F1 generation, which is the result of crossing two pure-breeding plants (one white and one purple), all have the same phenotype (purple).

This suggests that the purple allele is dominant over the white allele, but not completely dominant, as evidenced by the presence of white flowers in the F2 generation. Additionally, the ratio of purple to white flowers in the F2 generation (15:1) is consistent with the expected ratio for incomplete dominance (9:3:3:1), further supporting this mode of inheritance.

Learn more about F2 generation at https://brainly.com/question/12235645

#SPJ11

Look into the current literature and news - has there been an incident in the past where universal precautions were not observed - what happened? Discuss the accident, how were precautions not followed, what was the result of the precautions not being followed, and what should have been done differently. What has changed because of the incident. Please cite your article/information and add a copy of the link.

Answers

The Centers for Disease Control and Prevention (CDC) have reported multiple incidents in which universal precautions were not observed.

One of the most notable was a 1998 report of an outbreak of hepatitis B in a hospital in Baltimore, Maryland. In this instance, a healthcare worker failed to properly wash her hands between patients and did not follow universal precautions.

As a result, 21 patients in the facility were infected. The incident brought to light the importance of following proper universal precautions in order to prevent the spread of infections.

The hospital in Baltimore implemented changes such as improved hand-washing technique and other infection-control measures, such as using protective gloves and gowns when caring for patients. In addition, the CDC updated their recommendations for healthcare providers, which included implementing standardized procedures for infection control.

These changes are designed to ensure that healthcare workers follow universal precautions in order to prevent the spread of infections and to protect patients.

See more about Baltimore in:

https://brainly.com/question/28809935

#SPJ11

T/F This catecholamine drug is used for patients with asthma attacks, anaphylaxis, CPR, and simple glaucoma (pupil dilation).

Answers

True. The catecholamine drug that is used for patients with asthma attacks, anaphylaxis, CPR, and simple glaucoma (pupil dilation) is called epinephrine (also known as adrenaline).

A neurotransmitter and hormone used to treat allergic reactions, restore heart rhythm, and manage conditions like asthma, glaucoma, and mucosal congestion. a catecholamine neurotransmitter used to treat hypotension, reduced cardiac output, hemodynamic imbalances, and poor organ perfusion.

This drug is a type of adrenergic agonist that stimulates the sympathetic nervous system, leading to effects such as increased heart rate, bronchodilation, and vasoconstriction. These effects can help to relieve the symptoms of asthma attacks and anaphylaxis, as well as to support the heart during CPR and to dilate the pupils for eye exams or procedures.

For more such questions on catecholamine drug

https://brainly.com/question/30050932

#SPJ11

T/F runs the tendon of the supracoracoideus muscle, which attaches to the sternum and the dorsal side of the humerus, and lifts the wing upwards in flight.

Answers

True. The tendon of the supracoracoideus muscle runs from the sternum to the dorsal side of the humerus and lifts the wing upwards during flight.

It is responsible for elevating the wing, as well as aiding in the adjustment of the wingspan during flight.

Here you can learn more about The tendon

https://brainly.com/question/29850619#

#SPJ11

Think about how population genetic models correspond to what we observe in real organisms. Think of an organism that interests you. How might aspects of the organism's biology, ecology or behavior lead to the species being divided into subpopulations. Do you think individuals are able to migrate between populations? If so, how, and how often?

Answers

Population genetic models examine how genes are distributed throughout a species' population. In order to understand how this affects real organisms, it is important to consider the organism's biology, ecology and behavior.

For example, if an organism has different behaviors, adaptations, and environmental needs between two subpopulations, this could lead to the species being divided into two separate populations.

It is also possible for individuals to migrate between populations if they have the ability to move to another location and meet the environmental needs of the new population. This type of migration could occur seasonally, or if the populations are geographically close together.

See more about genetic in:

https://brainly.com/question/24461480

#SPJ11

(0)
Which pairing is CORRECT? Select all that apply Group of answer choices
Structural carbohydrate - Chitin
Deoxyribose sugar - DNA
Glycerol and three fatty acid tails - Phospholipids
Tertiary protein structure - Alpha helix

Answers

Deoxyribose sugar - DNA: DNA is a type of nucleic acid that contains the sugar deoxyribose, along with a phosphate group and a nitrogenous base.
Glycerol and three fatty acid tails - Phospholipids: Phospholipids are a type of lipid that contain a glycerol molecule, two fatty acid tails, and a phosphate group.

The other two pairings are incorrect:
Structural carbohydrate - Chitin: Chitin is a type of structural carbohydrate, but it is not the only one. Other examples include cellulose and lignin.
Tertiary protein structure - Alpha helix: The tertiary structure of a protein refers to the overall three-dimensional shape of the protein, which can include alpha helices, but also beta sheets and other types of folds. The alpha helix is a specific type of secondary structure found in proteins.

To know more about DNA refer here:

https://brainly.com/question/264225

#SPJ11

Transcribe the following DNA into RNA: TACGGGATT *
1 point
a. TUCGGGUTT
b. ATGCCCTAA
c. AUGCCCUAA
d. GUAGGGUAG

Answers

The DNA sequence TACGGGATT would be transcribed into the RNA sequence AUGCCCUAA. The correct answer is option c.

During transcription, DNA is converted into RNA. This process involves replacing the thymine (T) nucleotides in DNA with uracil (U) nucleotides in RNA. Additionally, the DNA strand is read in the 3' to 5' direction, so the RNA strand will be created in the 5' to 3' direction. This means that the RNA strand will be the reverse complement of the DNA strand.
Therefore, the transcription of the DNA strand TACGGGATT would result in the RNA strand AUGCCCUAA.
Option a is incorrect because uracil (U) is only found in RNA, not DNA. Option b is incorrect because it is the reverse complement of the DNA strand without the replacement of thymine with uracil. Option d is incorrect because it is not the reverse complement of the DNA strand and does not have the correct replacement of thymine with uracil.

For more such questions on DNA, click on:

https://brainly.com/question/28406985

#SPJ11

Your friend works in a biotechnology company and has discovered a few drugs that affect nuclear transport of proteins involved in cell signaling. He has done preliminary work to classify them but wants to understand the details.

Answers

Biotechnology has played a significant role in the medical field, from the production of vaccines to the development of drugs. The nuclear transport of proteins involved in cell signaling occurs through the nuclear pore complex (NPC).

One such area of biotechnology is nuclear transport of proteins involved in cell signaling. Your friend has discovered drugs that affect this process and wants to understand their details.

The nuclear transport of proteins involved in cell signaling occurs through the nuclear pore complex (NPC), which is a large protein complex that allows the exchange of molecules between the nucleus and the cytoplasm. Proteins involved in cell signaling move in and out of the nucleus through this complex.

Nuclear transport involves a series of steps.

Firstly, the protein is recognized by an importin, which binds to the protein and then moves towards the nuclear pore complex. Once it reaches the pore, the importin forms a complex with the nucleoporins, which allows the protein to pass through the pore. In the nucleus, the protein is released by the importin and binds to its target molecule, which initiates the signaling cascade. The process of protein export is similar, with exportins facilitating the movement of proteins from the nucleus to the cytoplasm.

Drugs that affect nuclear transport can target various steps of this process. For example, they can inhibit the binding of importins or exportins to the protein or the nucleoporins, thereby preventing the movement of the protein. Alternatively, drugs can target the nucleoporins themselves, altering the NPC's permeability and affecting nuclear transport.

The drugs discovered by your friend could be used to regulate cell signaling pathways by altering nuclear transport. Further research is needed to determine their efficacy and potential applications.

Nevertheless, drugs that affect nuclear transport of proteins involved in cell signaling have the potential to revolutionize the treatment of various diseases by targeting specific signaling pathways.



For more such questions on Biotechnology.

https://brainly.com/question/12871062#

#SPJ11

What is unique about the fiber orientation of vastus Medialis and what function does this fiber orientation serve?

Answers

The fiber of the vastus medialis obliquus is shorter and more obliquely oriented and it helps to stabilize the petalla and improve efficiency of knee extension.

The vastus medialis, also known as the vastus internus or teardrop muscle, is an extensor muscle that extends the knee and is situated medially in the thigh. A member of the quadriceps muscle group is the vastus medialis. One of the four muscles in the front compartment of the thigh is the vastus medialis. Together with the other muscles that make up the quadriceps muscle, it is involved in knee extension. Correct patella tracking also benefits from the vastus medialis.

It has been proposed that the vastus medialis muscle is divided into two groups of fibres: the vastus medialis obliquus, which is shorter and more obliquely oriented, and the vastus medialis longus, which is long and relatively aligned with the quadriceps ligament.

The vastus medialis has a unique fiber orientation which is perpendicular to the long axis of the thigh, meaning that it lies in a vertical direction when in a relaxed state. This orientation serves to help stabilize the patella and improve the efficiency of knee extension.

For more such questions on medialis , Visit:

https://brainly.com/question/14512638

#SPJ11

How
and why do the dominant primary producers in an aquatic system
change over time?

Answers

The dominant primary producers in an aquatic system can change over time due to a variety of factors including changes in nutrient availability, light intensity, temperature, and competition.

Changes in nutrient availability can affect the growth and survival of primary producers. For example, if there is an increase in nutrient availability, such as an increase in nitrogen or phosphorus, it can lead to an increase in the growth of primary producers, leading to a shift in the dominant species.


Changes in light intensity can also affect the growth of primary producers. If there is a decrease in light intensity, it can lead to a decrease in the growth of primary producers, leading to a shift in the dominant species.  


Changes in temperature can also affect the growth of primary producers. If there is an increase in temperature, it can lead to an increase in the growth of primary producers, leading to a shift in the dominant species.


Competition
between primary producers can also lead to a shift in the dominant species. If one species is able to outcompete another species for resources, it can become the dominant species in the system.

For such more question on aquatic:

https://brainly.com/question/15386540

#SPJ11

This is a genetic question:
The Bionomial is a more complex calculation used when you have multiple events AND multiple outcomes. Use the following P (s of A, t of B) = ( N! ) ps qt
S! T!
BTW= s + t = n and p+q = 1

Answers

The formula for the binomial distribution is:

P(s of A, t of B) = (N! / (S! * T!)) * (p^s) * (q^t)

Where:

N is the total number of trialsS is the number of successes in the trialsT is the number of failures in the trialsp is the probability of success in each trialq is the probability of failure in each trial

The binomial distribution is a useful tool for calculating the probability of a specific number of successes in a set of trials. It is commonly used in fields such as genetics, where it can be used to calculate the probability of a specific genetic outcome occurring in a population.

Here to learn more about the binomial distribution at the link

https://brainly.com/question/29163389

#SPJ11

What Is the relationship between "ticking"/time and ancestry?

Answers

Answer:

Explanation:

There is no inherent relationship between "ticking"/time and ancestry. "Ticking" or the passage of time is a universal experience that affects all individuals regardless of their ancestry or cultural background.

However, in some cultures, time may be viewed and experienced differently, and this can be influenced by factors such as history, religion, and social customs, which may in turn be related to ancestry. For example, some indigenous cultures may have a more cyclical view of time, where past, present, and future are interconnected and represented through cycles of nature. In contrast, Western cultures may have a more linear view of time, where time is seen as progressing forward in a straight line.

Ancestry, on the other hand, refers to one's familial or ethnic heritage, which can influence various aspects of an individual's life, including their physical traits, cultural practices, and social identity. An individual's ancestry may also be used to trace their family history over time, such as through genealogy research.

While there may not be a direct relationship between "ticking"/time and ancestry, an individual's experience of time and their understanding of their own personal history and cultural background may be influenced by their ancestry and cultural heritage.

(Please give brainlist)

which classes of the Baltimore classification system use the
host mechanisms for replication?

Answers

The classes of the Baltimore classification system that use the host mechanisms for replication are Class I, Class II, and Class III.

Class I viruses, also known as double-stranded DNA (dsDNA) viruses, use the host's DNA polymerase to replicate their genome.

Class II viruses, also known as single-stranded DNA (ssDNA) viruses, also use the host's DNA polymerase to replicate their genome, but they first need to convert their single-stranded DNA into double-stranded DNA.

Class III viruses, also known as double-stranded RNA (dsRNA) viruses, use the host's RNA polymerase to replicate their genome.

In contrast, Class IV and Class V viruses, which are single-stranded RNA (ssRNA) viruses, use their own RNA-dependent RNA polymerase for replication. Class VI and Class VII viruses, which are retroviruses, use reverse transcriptase to replicate their genome.

You can learn more about Baltimore classification system at

https://brainly.com/question/30036485

#SPJ11

The amount of a specific protein in a cell is influenced by different factors. Which are the following are likely to play a role in determining the amount of a specific protein present in a cell? Select ALL that apply.
Multiple answers: Multiple answers are accepted for this question
The transport of the mRNA for the specific protein from the nucleus to the cytosol.
The processing of the primary RNA for the specific protein.
The rate of transcription of the gene for the specific protein.
The half-life of the specific protein in the cytosol.

Answers

All of the options listed are likely to play a role in determining the amount of a specific protein present in a cell.

The transport of the mRNA for the specific protein from the nucleus to the cytosol is important because it determines how much of the mRNA is available for translation into protein in the cytosol.

The processing of the primary RNA for the specific protein is also important because it determines how much of the RNA is available for translation into protein. Processing includes steps such as splicing, which removes introns and joins exons together, and the addition of a 5' cap and a 3' poly-A tail, which help protect the RNA from degradation and promote translation.

The rate of transcription of the gene for the specific protein is important because it determines how much mRNA is produced in the first place. The more mRNA that is produced, the more protein can potentially be made.

The half-life of the specific protein in the cytosol is important because it determines how long the protein will be present in the cell before it is degraded. The longer the half-life, the more protein will be present in the cell at any given time.

Overall, all of these factors play a role in determining the amount of a specific protein present in a cell.

Learn more about specific protein : https://brainly.com/question/29787306

#SPJ11

Levator Scapulae are Concentrically accelerates cervical extension, lateral flexion, and ipsilateral rotation when the scapulae are anchored, assists in elevation and downward rotation of the scapulaw . t/f

Answers

The given statement "The Levator Scapulae muscle is responsible for concentrically accelerating cervical extension, lateral flexion, and ipsilateral rotation when the scapulae are anchored. It also assists in the elevation and downward rotation of the scapulae." True. It play important activities such as movement of head and neck.

Muscle is a connective tissue in the body with the main task of contraction. Muscle contractions function to move body parts and substances in the body.

Muscles located in the neck and connects the cervical spine to the scapula. When it contracts, it helps to move the head and neck, as well as the shoulder blade. It is an important muscle for maintaining good posture and for performing activities that require movement of the head, neck, and shoulders.

Learn more about muscle contractions at:

https://brainly.com/question/14883830

#SPJ11

Other Questions
Knowledge Check Questior Write an equation in slope-intercept form for the line with slope (2)/(3) and y-intercept -6. Question 2. A water tank has the shape of an inverted circular cone with base radius2mand height.4m. If water is being pumped into the tank at a rate of2 m3/min, find the rate at which the water level is rising when the water is3mdeep. (Volume of cone,V=31r2h) Question 3. A street light is mounted at the top of a15fttall pole. A man6fttall walks away from the ole with a speed of5ft/secalong a straight path. How fast is the tip of his shadow moving when he is oft from the pole. (Hint: Use properties of similar triangles) These lists show the ages of attendees in a yoga class and a dance class.Yoga: 18, 31, 17, 44, 20, 33, 36Dance: 20, 47, 23, 38, 26, 42, 30Which statement about attendees in the two classes is true?A. The median age of the attendees in the yoga class is greater than the median age ofthe attendees in the dance class.B. The median age of the attendees in the dance class is greater than the median age ofthe attendees in the yoga class.C. The median age of the attendees in the yoga class is the same as the median age of theattendees in the dance class.D. The median age of the attendees in the yoga class is 44 years and the median age ofthe attendees in the dance class is 47. how many solutions are in 16 (3x 6) = 18 (4x + 8). The final RSVP guest count is 60 people Which catering company will offer the best deal for your family? How much money will your family save by choosing that company A current of 4.5 A flows through a point for 25 minutes. Calculate the charge through the point after 25 minutes. help please!!!!!!!!!!!!! How much heat is transferred when the temperature of 36.4g of aluminumis raised from 32.5C to 71.6C? Maldives Winery operates a wine outlet in a tourist area. One gallon bottles sell for $12. Daily fixed costs are $3,000, and variable costs are $6 per gallon. An average of 750 gallons are sold each day. Clearwater has a capacity of 800 gallons per day. a. Determine the average cost per gallon. b. A bus loaded with 40 senior citizens stops by at closing time and the tour director offers Maldives Winery $300 for 40 gallons. Maldives Winery refuses, saying they would lose $2.50 on each gallon. Is Maldives Winery correct about losing the $2.50? Why or why not? c. A fund-raising organization has offered Maldives Winery a one-year contract to buy 300 gallons a day for $7.50 per gallon. Should they accept the offer? Why or why not? In the inequality 3>2,if you mulutiply boyh sides by a positive number do you have to reverse the direction of the inequity sign For the following transactions prepare the T-accounts, and prepare a Trial Balance at the end of the first month using the following details: (18 points for the T-Accounts and 12 points for the Trial Noah and his friends are going to an amusement park. the total cost of admission for eight students is $100, and all students share the cost equal. Noah bought $13 for his ticket. did he bring enough money to get to the park? bring your reasoning. i've had a stubborn cough for weeks that just won't go away. The doctor takes a throat sample and results come back all blue when viewed in the microscope during an acid-fast stain. is this good or bad news? explain uour answer The figure is shown composed of a rectangle and a hexagon. The length of each side of the hexagon is 2 cm determine the area of the shaded region. 'Socialization controls the way people behave.' - Using sociological material, give oneargument against this view. 1. How does the democracy of Mexico differ from the democracy of the UnitedStates? Review the list of patients below and select the one who is at greatest risk for cholelithiasis. a. Jeffery Zimmerman, 51 year old, with type 2 diabetes and hypercholesterolemia who weighs 250 poundsb. Cheyenne Hardison, a 36-year-old female who lost 10 pounds over a 6-month period and is recovering from hepatitis Ac. William Suggs, a 32-year-old whose father had cholelithiasis at the age of 50 and who is currently being treated for hepatitis Cd. Tiesha Jansen, a 39-year-old female with type 2 diabetes who weighs 260 pounds Please help me solve Use a calculator to approximate the measure of the acute angle A to the nearest tenth of a degree. sin A = 0.9659 a. 60.3 Degrees b. 56 Degrees c. 75 Degrees d. 55.5 Degrees According to the Global-4 Text: Global economic integration isapolitical in nature and its fundamental goal is to promotepeace.True or False