И a whole
•
The cell of
an elephant will be not be larger than that of an ant give reasons?
Answer:
Explanation:
The cell of an elephant will be not be larger than that of an ant.
This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.
So the cell of the elephant will not be larger than that of an ant.
Hope it helps!
Please mark as brainliest!
In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine
Answer:
31%
Explanation:
Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If
G = 19% then C= 19%
19% + 19% = 38%
100% - 38% = 62%
62% for A and T
Divide by 2 and you get
31%
Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.
Answer:
Yes.
Explanation:
Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.
For predation to occur, there must be a predator species and a prey species. Define predator and prey and give an example of each.
Describe one method to reduce the air pollutants released from a coal burning power plant
Answer:
A method to reduce the air pollutants released from a coal burning power plant is carbon capture.
Explanation:
Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.
Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
Answer:
i dont know i need points
Explanation:
Why does a mountain create a rain shadow on the other side of a mountain?
Answer:
I hope this will help u
Explanation:
A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow
Plants produce oxygen which animals use. Animals produce carbon dioxide which plants use. Predict the most likely outcome if airborne pollution blocked the sun’s rays so significantly that the percentage of living plants was decreased by 95%.
A. Plants would quickly evolve to consume a mixture of oxygen and carbon dioxide
B. Animals would quickly evolve to begin using carbon dioxide
C. The atmosphere would fill with carbon dioxide, and animals would begin to die.
D. The atmosphere would fill with oxygen, and animals would begin to die.
Answer:
C
Explanation:
A can’t happen because there are barely any plants
B can’t happen because Animals need Oxygen to breathe
D won’t happen due to lack of plants
In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.
A. 36 to 38
B. 19 to 24
C. 2 to 4
D. 63 to 68
E. 38 to 42
genes for traits that help an organism be more successful reproductively can be expected to ...
A - cause it to evolve into species
B - eventually be eliminated by natural selection
C - become more common in the future
D- cause the extinction of the species
Can someone name and explain each lymph organ?
Answer:
The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.
Answer:
please follow me
Explanation:
yr60zpzyoy9yit*fiif7rrr
Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations
Answer:
OA increased soil aeration due to an increase in earthworm populations.
Answer:
it is B. decreased rainfall due to a prolonged period of drought
Explanation:
trust me i got it right on my quiz
List 4 characteristics of Animals.
Answer:
animals
Explanation:
The Animal Kingdom
Animals are multicellular.
Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.
Animals typically reproduce sexually.
Animals are made up of cells that do not have cell walls.
Animals are capable of motion in some stage of their lives.
Cytotoxic T cells protect the body by _____________.
A. secreting toxic substances that destroy pathogens
B. phagocytizing invaders
C. activating the complement system
D. making antibodies that float free in the body fluids
Someone’s help me please
Answer:
trailmix
Explanation:
PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert
Answer:
I cant see the question just use the snipping tool to tack a screenshot
Explanation:
Mary pushes her cart across the floor with a force of 150N for a distance of 10m. What is the work done on the cart?
Answer:
1500Joules
Explanation:
Work done, denoted by W, can be calculated using the formula:
Work done (W) = force (F) × distance covered (d)
According to the information in this question, Mary pushes her cart across the floor with a force (F) of 150N for a distance (d) of 10m.
Hence, work done (W) by the cart is:
W = 150N × 10m
W = 1500 Newton.metre (N.m) or Joules (J).
REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?
Answer:
carries the blood components throughout the body
Explanation:
plasma is the largest part of your blood.
What were the old women doing?
In Percy jackosn
Answer:
If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.
Explanation:
in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.
In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.
PLEASE ANSWER THIS DUE BY 3:00 PM PLEASE
THIS IS NOT MULTIPLE CHOICE AND I DID NOT MEAN TO SELECT D.
( I put a better view of the graph)
Answer:
option C suits the best
Explanation:
The answers and why they are correct or incorrect:
A:
Incorrect because it cannot be answered with the graph and does not apply.
B:
Incorrect since the loudest sound ever recorded is not on the graph.
C:
Correct because the graph shows the difference Between normal conversation vs whispering.
D:
Incorrect, because like the first one it cannot be answered with this graph and makes no sense.
I HOPE I HELPED!!! HAVE AN AMAZING DAY/NIGHT!!! PLEASE MARK ME BRAINLIEST IF I HELPED YOU!!
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)
Answer:
Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)
Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.
Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.
PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or
Answer: ?
Explanation:
I don’t have a lot of time please help!
No websites or links.
Don’t answer it if you don’t now. Thanks
Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.
Answer:
The phenotypic ratio is 9:3:3:1
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaExplanation:
We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.
Let us assume that round is the dominant trait, codified by a diallelic gene, so
R is the dominant alleler is the recessive alleleLet us also assume that axial is the dominant trait, so
A is the dominant allelea is the recessive alleleCross:
Parentals) RrAa x RrAa
Gametes) RA, Ra, rA, ra
RA, Ra, rA, ra
Punnett Square) RA Ra rA ra
RA RRAA RRAa RrAA RrAa
Ra RRAa RRaa RrAa Rraa
rA RrAA RrAa rrAA rrAa
ra RrAa Rraa rrAa rraa
F1) Among the progeny, we expect to observe the following phenotypic ratio:
9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraaWhich list describes the organization within multicellular organisms from least complex to most complex?
A,proteins, organelles, cells, organisms
B,proteins, cells, organelles, organisms
C,cells, organelles, proteins, organisms
D,organelles, cells, proteins, organisms
d
Cells, organelles, proteins, organisms describes the organization within multicellular organisms from least complex to most complex. The correct option is C.
What are multicellular organisms?Multicellular organisms include a mixture of more than one cell, with differentiating groups of cells performing specialized functions.
Early stages of development, cells in humans distinguish towards becoming nerve cells, skin cells, muscle cells, blood cells, as well as other types of cells.
All animals, land plants, and most fungi are multicellular, as are numerous algae, with the exception of slime molds and social amoebae such as the genus Dictyostelium, which are partially unicellular and partially multicellular.
Cells, organelles, proteins, and organisms describe the organization of multicellular organisms in descending order of complexity.
Thus, the correct option is C.
For more details regarding multicellular organisms, visit:
https://brainly.com/question/24381583
#SPJ2
Please help, any unnecessary answers will be reported. Thanks :)
it's c
Explanation:
because there's different types of cold and illnesses so there can be different symptoms each time
What processes can increase the amount of atmospheric CO2?
Answer:
Explanation:
Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.
Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.
Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO
Hope This Helped !! :)
what did humans evolve from I am creating a a evolution chain I know this can be considered a unintelligent question I am just not positive on what we evolved from
Answer: Human evolution, the process by which human beings developed on Earth from now-extinct primates. Viewed biologically, we humans are Hono Sapines, a culture-bearing upright-walking species that lives on the ground and very likely first evolved in Africa about 315,000 years ago.
Human evolution is not linear manner it is a web, in the process of evolution primates lead to the emergence of homo-sapiens, which is distinct from the hominid family.
How did humans evolve?Human evolution is observed in a web manner not linear in evolutionary history primates lead to the homo-sapiens which is distinct from another family of hominids.
The hominid family includes great apes that diverged from the gibbons 15-20 million years ago. Evolution involves some studies, genetic studies, and h behavioral studies.
Anatomically it is observed in Africa 300000 years ago humans appeared, these studies were observed anatomically as the origin of humans.
Therefore human evolution is observed in a web manner not linear.
Learn more about human evolution, here:
https://brainly.com/question/24276894
#SPJ2
what is the complementary DNA of TACCGGATGCCAGATCAAATC?
Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary DNA strand.