what is passive acoustic monitoring? why would the researchers want to use this method to survey bats?

Answers

Answer 1

Passive acoustic monitoring is a technique that uses sound recordings to track and study animal populations. Researchers want to use this method to survey bats because they are nocturnal animals that are difficult to observe directly.

What is passive acoustic monitoring?

Passive acoustic monitoring is a technique that uses sound recordings to track and study animal populations. It works by placing microphones in the field to pick up the sounds made by animals. These sounds can then be analyzed to identify the animals present and their behavior. This technique is particularly useful for studying animals that are difficult to observe directly, such as nocturnal animals or those that live in dense vegetation or underwater.

Why would researchers want to use this method to survey bats?

Researchers would want to use passive acoustic monitoring to survey bats because they are nocturnal animals that are difficult to observe directly. Bats use echolocation to navigate and find prey, and they produce high-pitched sounds that are outside the range of human hearing. By using specialized microphones and software, researchers can detect these sounds and identify the species of bats present in an area. This information can be used to study the distribution and abundance of bat populations, as well as their behavior and habitat use.

To know more about Passive acoustic monitoring, visit:

https://brainly.com/question/23111296

#SPJ11


Related Questions

Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices

Answers

Answer: c. isotopes

Explanation:

maybe sorry if wrong

16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?

Answers

Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.

What causes Blue Andalusian birds to exist?

The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.

What kind of hens are Blue Andalusian?

According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.

To know more about heterozygous visit:

https://brainly.com/question/30622664

#SPJ1

What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?

Answers

The significance of crossing over is the creation of new combinations of genetic material in offspring.

Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.

It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.

To learn more about Crossing over, here

https://brainly.com/question/19671756

#SPJ4

Question 6
Skeletal muscles work with bones to give your body:
Strength
The ability to move
Strength and the ability to move
O None of the above

Answers

Strength and ability to move

What is transport in humans and plants and what is the difference?

Answers

Answer:

In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.

Explanation:

Which type of valve opens in response to increasing pressure in the ventricles?

Answers

The type of valve opens in response to increasing pressure is semilunar valves.

Semilunar valve, one of two pocket-like, half-moon-shaped organs that connect the heart's left and right ventricles to the aorta (aortic valve) and pulmonary artery, respectively. The semilunar valves allows blood to flow into the arteries from the ventricles and prohibit the backward flow of blood from the arteries into the ventricles.

The endocardium, a thin, smooth membrane, and connective tissue make up the semilunar valves. The atrioventricular valves, which are situated halfway between the atrium and the ventricle, cooperate with them in order to function. The audible pulse is connected to the closure of the heart valves. The atrioventricular valves close first, followed by the pulmonary and aortic semilunar valves, which produce the second sound.

Learn more about Semilunar valves:

https://brainly.com/question/14481540

#SPJ4

There is evidence that the increasing carbon dioxide levels in the atmosphere are causing oceans to become more acidic. Ocean acidification may negatively impact species of phytoplankton, which are microscopic photosynthetic organisms that live in surface waters. Explain how the carbon cycle might be affected, if phytoplankton populations were to decrease.

Answers

Phytoplankton play a significant role in the carbon cycle. They are responsible for a large portion of the photosynthesis that takes place in the ocean, taking up carbon dioxide from the atmosphere and converting it into organic matter through photosynthesis.

If phytoplankton populations were to decrease due to ocean acidification, the amount of carbon dioxide that is absorbed from the atmosphere through photosynthesis would also decrease. This would result in an increase in atmospheric carbon dioxide levels, which would exacerbate the problem of global warming and climate change.

Furthermore, when phytoplankton die, they sink to the ocean floor, taking carbon with them. This is called the biological pump, which is an important mechanism for transferring carbon from the surface ocean to the deep ocean. If phytoplankton populations decrease, the biological pump would be weakened, leading to less carbon being transferred to the deep ocean. This would further exacerbate the problem of increasing atmospheric carbon dioxide levels, as less carbon would be removed from the atmosphere.

In summary, a decrease in phytoplankton populations due to ocean acidification could have significant effects on the carbon cycle, leading to increased atmospheric carbon dioxide levels and a weakening of the biological pump.

what are the two ways the video mentions that invasive species can be introduced into aquatic ecosystems? a) on ship hulls and in large aquariums b) on ship hulls and through hitchhikers c) in ballast water found in ships and through fish farm nets d) in ballast water found in ships and as bait in commercial fishing expeditions please select the best answer from the choices provided a b c d

Answers

Invasive species can be introduced into aquatic ecosystems through a variety of pathways, but the video mentions two specific ways.

The first way is through ballast water found in ships, which is water taken on board to stabilize the vessel during travel. When the ship reaches its destination, this ballast water is discharged along with any organisms it may contain, including potential invasive species. This is a common pathway for the introduction of aquatic invasive species.

The second way is through the use of live bait in commercial fishing expeditions. Live bait can contain non-native species that can be introduced into new environments if they are not properly disposed of. This pathway is often overlooked but can be an important source of invasive species in aquatic ecosystems.

Therefore, the correct answer is d) in ballast water found in ships and as bait in commercial fishing expeditions.

To learn more about aquatic ecosystems visit;

https://brainly.com/question/4967501

#SPJ4

which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover

Answers

Crossover is the process based on DNA recombination.

The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.

Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.

Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.

Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.

Learn more about DNA: https://brainly.com/question/16099437

#SPJ11

a black haired true breeding guinea pig is crossed with a white haired true breeding guinea pig. all of the offspring have black hair.

a. which color is dominant?
b. what are the genotypes and phenotypes of the parents?
c. what are the genotypes and phenotypes of the offspring?

Answers

a. Their phenotypes are black-haired and white-haired, respectively.

b. The genotype and phenotype of all offspring are BB and black-haired, respectively.

c. All of the offspring have black hair, so they must all have the genotype BB.

What are the genotypes and phenotypes of the parents?

In this case, we can infer that black hair color is dominant over white hair color since all offspring have black hair.

Since they are both true breeding, their genotypes are homozygous dominant and homozygous recessive, respectively. Therefore, the genotypes of the parents are BB and bb. Their phenotypes are black-haired and white-haired, respectively.

Let's denote the black-haired true breeding guinea pig as BB and the white-haired true breeding guinea pig as bb.

Therefore, the genotype and phenotype of all offspring are BB and black-haired, respectively.

Learn more about genotype here: https://brainly.com/question/902712

#SPJ1

the term for a specific molecule on which an enzyme acts is the

Answers

The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.

Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction.  The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.

Learn more about substrate: https://brainly.com/question/4047091

#SPJ11

if a cell with 4 chromosomes undergoes mitosis how many daughter cells are made and how many chromosomes will each daughter have

Answers

If a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes. Hence, if a cell with 4 chromosomes undergoes mitosis, 2 daughter cells are made and each daughter cell will have 4 chromosomes.

What is Mitosis?

Mitosis is a biological method that results in the replication of cells. This means that, as a result of mitosis, the number of cells in an organism increases. The whole process happens in four different phases: prophase, metaphase, anaphase, and telophase.

Cell division is a crucial aspect of human growth, and it is controlled by genes within the cell. It is important for the survival and growth of living organisms. It ensures that the genetic material in each cell is divided equally and that the daughter cells inherit the same genetic material as the parent cell.

Mitosis is a part of the cell cycle, in which a single parent cell divides into two daughter cells with identical genetic information. Each daughter cell produced during mitosis is identical to the parent cell in terms of its DNA content, meaning that the two daughter cells will each have the same number of chromosomes as the parent cell.

To learn more about chromosomes here:

https://brainly.com/question/30993611

#SPJ11

which atomic particles are in a unique cloud outside of the nucleus of the atom?

Answers

The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.

The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.

Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.

To know more about electrons click here:

https://brainly.com/question/1255220

#SPJ4

discuss why it is important which of the two dna strands serves as a template during transcription.

Answers

DNA is double-stranded, but only one strand serves as a template for transcription at any given time. This template strand is called the noncoding strand. The nontemplate strand is referred to as the coding strand because its sequence will be the same as that of the new RNA molecule.

a bacterial species differs from a species of eukaryotic organisms in that a bacterial species group of answer choices does not breed with other species. breeds with its own species. can be distinguished from other bacterial species. is a population of cells with similar characteristics. has a limited geographical distribution.

Answers

"A bacterial species differs from a species of eukaryotic organisms in that a bacterial species does not breed with other species."

A bacterial species does not interbreed with other species, but will only breed with its own species. This is different from a species of eukaryotic organisms, which may be able to breed with other species. Additionally, bacterial species can be distinguished from other bacterial species based on characteristics such as morphology, genetic makeup, and metabolic characteristics. Bacterial species also typically have a limited geographical distribution.

Learn more about bacterial species: https://brainly.com/question/8695285

#SPJ11

A human starts as ______ cell(s) and by the time they are an adult, they have ______ cell(s).
A. 1, 50 trillion
B. 50 trillion, 50 trillion
C. 2, 10 million
D. 10,000, 50 trillion

Answers

A person has 1 cell at birth and 50 trillion cells by the time they reach adulthood.

A single cell called a zygote is created when a sperm fertilizes an egg at the commencement of human development. The human body starts to grow and evolve from this one cell.

Organs and tissues start to form as a result of cell division and differentiation into distinct cell types. A person's body is thought to contain 50 trillion cells by the time they reach maturity.

So a person is born as a single cell (zygote), and by the time they reach adulthood, their body contains 50 trillion cells.

To improve our health and well-being and advance medical studies and treatments, it is crucial to comprehend the biology of the human body and the process of human development.

learn more about cells here

https://brainly.com/question/13920046

#SPJ1

Need help asap please :(

Answers

Answer:

picture quality is low

Explanation:

write your question

Which of the parent cells can transmit the changed DNA to the offspring?

Answers

Through the process of cell division and reproduction, any parent cell that experiences a change in its DNA (genetic material) has the potential to pass the altered DNA to its offspring.

The egg cell (female gamete) and the sperm cell (male gamete) are the two parent cells in sexual reproduction, and they each provide the baby with half of its genetic makeup. An alteration in the DNA of either the egg or the sperm cell, such as a mutation, can be passed on to the progeny.

Asexual reproduction creates identical children by dividing the parent cell. Before dividing, if the parent cell goes through a DNA alteration, this DNA change will be present in both the parent cell and the child.

The type and magnitude of the DNA mutation, as well as other parameters including the progeny's viability and survival, all play a role in determining whether altered DNA is transmitted to offspring during sexual and asexual reproduction.

To know more about cell division,

https://brainly.com/question/29773280

#SPJ4

What happens after glycolysis but before citric acid cycle?

Answers

I think it’s oxidative phosphorylation when in presence of oxygen.

the body compartments that participate in the immune system, after the formation of immune cells, are the . multiple select question. extracellular fluid mononuclear phagocyte system ciliary escalator bloodstream gastrointestinal lumen bone marrow cerebrospinal fluid lymphatic system

Answers

The body compartments that participate in the immune system, after the formation of immune cells, are the lymphatic system, extracellular fluid, mononuclear phagocyte system, and bloodstream.

What is the specific role of the immune system?

The specific role of the immune system refers to the finish with pathogenic agents such as microorganisms or viruses, which depend on the presence of specialized cells and organs.

Therefore, with this data, we can see that the specific role of the immune system is to fight against bacteria and viruses to maintain a health state.

Learn more about  the immune system here:

https://brainly.com/question/15595309

#SPJ1

a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left.true or false

Answers

The statement "a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left" is False.

A decision tree is read from left to right, but the conditions are usually represented as nodes or circles, and the actions or outcomes are represented as branches or lines. The conditions are evaluated at each node, and based on the outcome of that evaluation, the tree branches off to the next node, and so on until an action or outcome is reached.

The branches are typically labeled with probabilities or expected values, and the goal of the decision tree is to identify the optimal decision or course of action based on the available information and the desired outcome.

To learn more about decision tree refer to:

brainly.com/question/30673588

#SPJ4

TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA

Answers

AUG UCC UAG UAA AGC GCU UGC CUC GGC CUU GA(?) last letter there is gone

Why are the ddNTPs fluorescently labeled?

Answers

Answer :

Labeling either the DNA sequencing primers or the individual nucleotides with a radioactive or fluorescent tag enables this visualization. In automated sequencing, the ddNTPs are labeled with fluorescent dyes that are detected by a scanner. This makes it possible for all four reactions (dGTP, dATP, dCTP, and dTTP) to be run in one lane, so you can have huge numbers of reactions on one gel.

Stomates are small openings on the leaves of plants. The following data was recorded for the stomates of a particular plant under various conditions of moisture in the air as measured by relative humidity.

Time Relative Humidity Stomates Condition
06:00 15% Closed
09:00 27% Closed
12:00 58% Open
15:00 82% Open
18:00 26% Closed




The data in the table could be used to support which explanation of a function of stomates? Stomates are responsible for–



A
preventing the loss of moisture from the plant to the environment.

B
regulating the flow of water from one cell to another in the plant.

C
ridding the plant of excess water vapor in dry conditions.

D
allowing the plant to absorb water from the soil after it rains.

Answers

a limiting the plant's ability to lose moisture to the environment.

Several plant species that thrive under the same circumstances in various settings have their roots measured.

This example demonstrates how negative feedback keeps homeostasis in check: a. where the face is subjected to friction, the epidermis thickens to produce a callus. The control of blood calcium levels is another illustration of negative feedback. The hormone parathyroid is secreted by the parathyroid glands, and it controls the amount of calcium in the body. The parathyroid glands detect a drop in calcium and release more parathyroid hormone as a result. Cell counting, pcv, cell fresh weight, and cell dry weight are methods for gauging growth in suspension culture.

Learn more about plant

https://brainly.com/question/31220793

#SPJ1

mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.

Answers

Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance

What is inheritance?

Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.

Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.


The law of segregation,
which states that the two alleles of a gene separate into different gametes when a plant produces gametes (sex cells).
The law of independent assortment, which states that each pair of alleles segregates independently during gamete production.
The law of dominance, which states that a dominant allele will always be expressed in the phenotype of the organism.

To know more about inheritance of traits refer here:

https://brainly.com/question/22686199#

#SPJ11

1. The steps of the carbon cycle are described below.
Place the steps in the correct order.
a. Animals and plants release carbon dioxide and
water as a result of cellular respiration.
b. Carbon dioxide is released by plants and animals
and moves into the biosphere.
c. Plants use water and carbon dioxide from the
atmosphere to make sugar and oxygen through
the process of photosynthesis.
d. Animals and plants use sugar and oxygen for the
process of cellular respiration.
e. Cellular respiration transforms sugar and oxygen
into carbon dioxide and water.

Answers

Answer:

1. Plants use water and carbon dioxide from the atmosphere to make glucose and oxygen through photosynthesis.

2. Animals and plants use glucose and oxygen for cellular respiration

3. Cellular respiration transforms glucose and oxygen into carbon dioxide and water.

4. Animals and plants release carbon dioxide and water as a result of cellular respiration.

5. Carbon Dioxide is released by plants and animals and moves in the biosphere

Explanation: CO2 + H2O with energy (sun) = C6 H12 O6 + O2

the sequence of amino acids determines the __ protien which determines the protiens__

Answers

Answer:

The sequence of amino acids determines the primary structure of a protein, which determines the protein's higher-order structure, function, and properties.

The primary structure is the linear sequence of amino acids in a protein, which is stabilized by peptide bonds. The specific sequence of amino acids determines the protein's overall shape and how it interacts with other molecules.

The higher-order structure of a protein includes its secondary, tertiary, and quaternary structures, which are determined by various interactions between amino acids such as hydrogen bonds, disulfide bonds, and hydrophobic interactions.

The protein's function and properties are determined by its structure, and this can include enzymatic activity, transport of molecules, signaling, and structural support. Therefore, the sequence of amino acids is critical to the overall function and properties of a protein.

The amino acid sequence of a polypeptide chain defines the protein's ultimate 3D shape. Protein structure is classified into four levels: primary structure, secondary structure, tertiary structure, and quaternary structure. Furthermore, there are two types of 3D protein structures: spherical proteins and filamentous proteins. The information contained in the cellular genetic code determines the amino acid structure of a protein. The sequence of amino acids in a polypeptide chain is distinctive to each protein. A single amino acid change produces a DNA mutation, which usually results in a non-functioning protein. The "R" group changes between amino acids and dictates how these protein monomers vary. The information contained in the cellular genetic code determines the amino acid structure of a protein. The pattern of nucleotide bases in nucleic acids (DNA and RNA) that codes for amino acids is known as the genetic code. Proteins are made up of molecules called amino acids. A protein is composed of one or more straight strings of amino acids, each of which is referred to as a polypeptide. There are several types of amino acids that are frequently present in proteins.

Which Leu codon can be converted to either Ser, Val, or Met by a single nucleotide substitution?
CUA
CUU
CUC
CUG

Answers

The Leu codons are CUA, CUU, CUC, and CUG. Of these, the CUA codon can be converted to either Ser, Val, or Met by a single nucleotide substitution.

Specifically, a CUA to UCA (Ser), CUA to GUA (Val), or CUA to AUG (Met) substitution would result in a different amino acid being incorporated into the protein sequence.

The other Leu codons (CUU, CUC, and CUG) have different nucleotide sequences and would require multiple nucleotide substitutions to be converted to Ser, Val, or Met codons.

The ability of the CUA codon to be converted to multiple different amino acids by a single nucleotide substitution is an example of genetic code degeneracy or redundancy.

This is because there are more codons (64) than there are amino acids (20), so some amino acids are coded for by multiple different codons. In the case of Leu.

To learn more about Leu codons here:

https://brainly.com/question/30367265

#SPJ11

observe your frog heart after it has been removed. did it continue to beat? how? what else did you learn from your frog? anatomy? physiology? did you do any further tests? please elaborate. g

Answers

Yes, the frog heart continued to beat after it had been removed. This is due to the intrinsic excitability of the myocardium, or muscle tissue in the heart. This intrinsic excitability means that the heart can continue to beat without any external input from the nervous system.

From observing the frog heart, we can learn about anatomy and physiology. Anatomy refers to the structure and physical form of the heart. We can see the size and shape of the heart and the blood vessels entering and leaving it. Physiology is the function and processes of the heart. We can observe how the heart beats and pumps blood.

Further tests could include a detailed analysis of the heart rate. This could involve measuring the heart rate over time, looking for any changes in rate, or measuring the heart rate under various conditions. Additionally, one could measure the electrical activity of the heart by using an electrocardiogram. This would involve placing electrodes on the heart and measuring the electrical impulses.

In conclusion, by observing the frog heart we can learn about both anatomy and physiology and also explore other tests to gain a deeper understanding of the heart’s function.

For more such questions on Frog heart.

https://brainly.com/question/11126450#

#SPJ11

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True or False?

Answers

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True

A component with a lower flavor threshold means that it can be detected at lower concentrations, and therefore, can make a bigger contribution to the overall flavor profile of the beer.

For example, compounds like isoamyl acetate, which gives banana-like flavor, and diacetyl, which gives a buttery flavor, have low flavor thresholds and can be perceived even at low concentrations. Therefore, a small amount of these compounds can have a noticeable impact on the taste and aroma of the beer.

Learn more about lower flavor

https://brainly.com/question/17515899

#SPJ4

Other Questions
why do engineers perform reverse engineering on products? I need help with a walter mosley everbody is guilty of something claim and a henriques contradicting quote from pages 360-364 of the wizard of lies on a cisco router, which two actions are functions of the control layer between the routing protocol and the firmware data plane microcode? suppose the total cost for various levels of output for a competitive price-taker firm are given in the table below: q tc 0 10 1 12 2 15 3 19 4 24 5 30 6 37 7 46 8 55 9 65 if the market price is $8, how many units should the firm produce to maximize profit? group of answer choices 5 6 7 8 what term is used to describe a loop where the number of times that the loop will execute is known before the body of the loop executes for the first time? The height of a mirror is 168.73 cm correct to 2 decimal places. a) What is the lower bound for the height of the mirror? b) What is the upper bound for the height of the mirror? a 14.5 g sample of iron is allowed to react with oxygen to form its oxide. if 20.7 g of the iron oxide compound is formed what is the mass percent for each element in the compound? 5. we know that the true relative risk of an association between a selected exposure and outcome is 1.5 in the entire population of a city x. a study conducted to examine the same association, but in a small sample of participants from city x, with a certain degree of measurement bias, yielded a relative risk of 4.0. what type of error would you expect in this study? Question 1 (if someone answers this I give 15 points)The net for a cylindrical candy container is shown.net of a cylinder with a diameter of both circles labeled 1.8 inches and a rectangle with a height labeled 0.8 inchesThe container was covered in plastic wrap during manufacturing. How many square inches of plastic wrap were used to wrap the container? Write the answer in terms of . 7.92 square inches 7.2 square inches 3.06 square inches 2.34 square inches(no rush at all these are for my notes) A halogen gas sample showing a pressure of 1. 63 atm has a density of 7. 37g/l at 157C. What gas is it? In order to meet the needs of a large population, which form of agriculture would you most likely find in a country with a largely urban population? what is d shape tentacles present contractile vacuoles present trichocysts defence cilia helps movement transverse division Miguels coffee shop makes a blend that is a mixture of two types of coffee. Type A coffee costs Miguel $5.95 per pound, and Type B coffee costs $4.65 per pound. This months blend used three times as many pounds of Type B coffee as Type A, for a total cost of $796.00. How many pounds of Type A coffee were used? Which lines show that juliet is obedient? check all that apply. how now! who calls? your mother. what is your will? speak briefly, can you like of paris love? ill look to like, if looking liking move "no more deep will i endart mine eye / than your consent gives strength to make it fly." expalin 3 reasons why the kalinago were able to resist European domination longer than the taino i need some help adding a sentence or two to this paragraph can i get some help? Based off of Elie Wiesels speech called The Perils of Indifference, specifically, Of course, indifference can be temptingmore than that, seductive. It is so much easier to look away from victims. It is easy to look away from pain and unnatural occurrences, to ignore them until they affect you personally leaving the ones in pain, such as Elie Wiesel a victim of that indifference. The third term and the sixth term of A geomatric sequence are 2 and 16 respectively. Find the first term and the common ratio Which of these substances speeds up the absorption of alcohol? a.plain water b.carbonated liquids c.starchy foods d.meat products Use the given scenario.Keiras coach lets each player choose a marble from a bag with 3 green, 2 blue, 5 red, and 5 yellow marbles.If the player chooses a blue marble, they do not have to run laps at the end of practice. What is the theoretical probability a player chooses a blue marble? 15 class, you have been talking about whether being a professional athlete is an easy job. ur teacher has asked you to write an article about it. Exercise 6 Here are some comments from your classmates: They have to train every day. There's a lot of pressure on them to win. They get to do a job they love. They can earn a lot of money. Write an article for your teacher, giving your views. The comments above may give you some ideas, and you can also use some ideas of your own. Your article should be between 100 and 150 words long. You will receive up to 6 marks for the content of your article, and up to 6 marks for the language used.pls help