what is a summary of act ll phantom tollbooth, and how did Milo change?? pls help lolol

Answers

Answer 1

Answer:

Throughout the book, Milo learns not only values but also how to put those values to work for himself. When he finally returns to the real world, Milo is forever changed. He realizes that he does not need the tollbooth to travel to exotic and magical places; he only needs to look around him.

Explanation:

I don't know how to put my summary into words. Im sorry


Related Questions

es about Literature: Mastery Test
in
ly. I
O
S
-body
d
ed
2
What does Mr. Collins's third reason for the proposal suggest?
5
O A.
O B.
O C.
O D.
Mr. Collins wants to please his noble patroness.
Mr. Collins is oblivious to Lizzy's lack of regard for him.
Mr. Collins is obligated to do as his patroness asks.
Mr. Collins lacks the ability to make his own decisions.

Answers

Mr. Collins's third reason for the proposal suggest that he wants to please his noble patroness. The Option D.

What was Collins's reason for the proposal?

In Pride and Prejudice, he said my reasons for marrying are, first, that I think it a right thing for every clergyman in easy circumstances (like myself) to set the example of matrimony in his parish

Secondly, that he is convinced that it will add very greatly to my happiness; and thirdly, that perhaps, he ought to have mentioned earlier, that it is the particular advice and recommendation of the very noble lady whom I have the honour of calling patroness.

Read more about Collins

brainly.com/question/28000120

#SPJ1

Hoping to prepare it easily, the battered shrimp sizzled in the deep fryer. A.misplaced modifier B. dangling modifier C. phrase fragment D. none of the above

Answers

The Correct option is A. misplaced modifier.

The phrase "hoping to prepare it easily" is placed before "the battered shrimp," implying that the battered shrimp is hoping to prepare itself easily. This creates a sense of confusion in the sentence, making it a misplaced modifier. The sentence can be revised as "Hoping to prepare it easily, he dropped the battered shrimp in the deep fryer and let it sizzle."

What is a misplaced modifier?

A misplaced modifier is a word, phrase, or sentence that is positioned too far away from the term it modifies or describes. Due to the divide, sentences containing this flaw typically sound awkward, ludicrous, or ambiguous. Also, they could be totally unreasonable.

To fix the issue of the misplaced modifier, one should position single-word adjectives before the word they modify and adjective phrases or clauses precisely after the word they modify. In the examples below, adjective phrases were placed immediately before the word they modify to avoid any misinterpretation.

Virtually, hardly, just, merely, almost, and only are the most common words. If these are not placed right before the nouns they are meant to modify, the phrase's meaning is changed.

To learn more about misplaced modifier from given link

https://brainly.com/question/27896938

#SPJ1

The narrator describes the transition from childhood to adulthood as moving from innocence to compassion She says a person cannot have both Do you agree? use 3 pieces of evidence ftom thr story to support your answer.

The story is Marigold
The question is from Activity
Learn

Answers

In the story "Marigold," the narrator does describe the transition from childhood to adulthood as moving from innocence to compassion. However, I do not agree that a person cannot have both innocence and compassion.

Firstly, when the narrator is reflecting on her own transition from childhood to adulthood, she says, "Innocence and compassion cannot coexist" (paragraph 7). While this may have been true for her, it does not mean that it applies to everyone. Different people may have different experiences and perspectives.

Secondly, the character of Miss Beam, the narrator's teacher, is an example of someone who embodies both innocence and compassion. Miss Beam is described as being "childlike and compassionate" (paragraph 8) and is able to connect with the children in a way that other adults cannot.

Finally, at the end of the story, the narrator has a moment of compassion towards her younger brother, Raja. She realizes that Raja is afraid of the dark and offers to hold his hand, showing a level of compassion that is not incompatible with innocence.

In conclusion, while the narrator of "Marigold" believes that innocence and compassion cannot coexist, I do not agree. The character of Miss Beam and the narrator's own moment of compassion towards her brother demonstrate that it is possible to have both innocence and compassion.

can someone help me with this please
here is the picture is just 4 questions i also put the pages of the reading

i need to answer the questions in order please
the questions are in the picture that says "Thinking About the Text"

Answers

Lynda Barry's personal anecdote enhances her political argument, and the incident that she uses from her own life strengthens her point. She is urging schools to promise to place a higher priority on creativity and offer more possibilities for arts education.

What does Lynda Barry convey in her essay?

Lynda Barry gives a concrete illustration of how a student's lack of support for creativity in the classroom can have detrimental effects by describing her harrowing personal experience of being neglected and left behind in her education. All students can benefit from art instruction, even though it is true that not every child will grow up to be a great artist. Both figurative and literal meanings of "the sound off" or "the sound turned off" are utilized in Lynda Barry's essay.

Additionally, in 'The Sanctuary of School' she advises that schools should promote children's creative pursuits and encourage them to explore their creativity. She mentions, for instance, how her own institution made art supplies available and encouraged students to take part in a mural project. In general, Barry is pushing for a change in the educational system's emphasis away from a singular focus on academic accomplishment.

To learn more about anecdote, visit:

https://brainly.com/question/28320686

#SPJ1

Fill in the blanks with correct prepositions: a. We are leaving for Kathmandu .... Sunday. b. Tokyo is the most crowded city ...... the world c. Rina laughed.... the joke. d. We have lived here. 5 years. He is married.... my friend. 1​

Answers

A. On Sunday, we will depart for Kathmandu. B. Tokyo is the world's most populous city, and C. Rina chuckled at the joke. D. It's been five years since we moved in. E. My pal and he is married.

What do prepositions mean?

A group of terms known as prepositions and postpositions, collectively referred to as adpositions (or, more generally, prepositions in traditional grammar), are used to convey geographical or temporal links (in, under, towards, or before), as well as to denote different semantic responsibilities (of, for).

This combination of a preposition or postposition and a noun phrase is known as the complement, or occasionally the object, of the preposition or postposition. A postposition is placed following its complement, while a preposition is placed before it.

However, there are a few exceptions, such as "ago" and "notwithstanding," as in "three days ago" and "financial limitations notwithstanding." In general, English uses prepositions rather than postpositions; words like in, under, and of precede their objects, such as in England, under the table, and of Jane.

Learn more about prepositions with the help of the given link:

brainly.com/question/4956879

#SPJ9

What evidence in the text supports the inference that Sully was a competent sailor?
Scoot thought he was a good teacher.
A) He'd been around boats for most of his life.

B) He'd borrowed the boat from family friend.

C) He thought the Sea Dog was the best in her category.

Answers

A is the correct answer

differences between internal conflict and normal conflict

Answers

Internal conflict is the opposite of external conflict, which occurs when a character faces outside oppositional forces, such as another character or an act of nature
Internal conflict is a conflict that takes place within an individual, while normal conflict is a conflict between two or more people or groups. Internal conflict is often caused by a person's inner struggles, such as conflicting beliefs, values, or emotions. Normal conflict is usually caused by a disagreement between two or more people or groups over a certain issue.

PLS HELP ME. 15 POINTS!!!!!! LA.
Which informational text is an example of a primary source?

A. A biography
B. A speech
C. A textbook
D. An encyclopedia

Answers

Answer:

I think its B

"O God," he thought, "what a demanding job I've chosen!
Day in, day out, on the road. The stresses of selling are
much greater than the actual work going on at head office,
and, in addition to that, I still have to cope with the
problems of travelling, the worries about train connections,
irregular bad food, temporary and constantly changing
human relationships, which never come from the heart. To
hell with it all!"
A. Train travel was the best way to get from one city to the other.
B. People had jobs that were repetitive and boring.
C. It was easy to make friends with new people.
D. People enjoyed traveling by train.

Answers

Answer: A

Explanation:

Travelling in trains are one of the best ways. If the person is a traveler they most likely would take a train, if this was in the past.

A. I think maybe man or D

A rectangular parking space has an area of 98 square meters .its width is 7 meters what is the length of parking space

Answers

Therefore, the length of the parking space is 14 meters.

What formula can be used to find the length of a rectangular parking space given its area and width?

Area = length x width

We are given the width as 7 meters and the area as 98 square meters.

Substituting these values into the formula, we get:

98 = length x 7

To solve for the length, we can isolate it by dividing both sides of the equation by 7:

length = 98/7

Using a calculator or simplifying by hand, we get:

length = 14

Therefore, the length of the parking space is 14 meters.

To learn more about length follow the given link: https://brainly.com/question/28317102

#SPJ1

27. While he was reading and the rain started. (write)​

Answers

A story desires combat and resolution; anxiety and release; thriller and revelation. There ought to be losses and gains, setbacks and comebacks, peaks and troughs. And, above all, a story have to be about people: their dreams and desires; loves and hates; issues and passions.

What makes a profitable story?

The excellent story is a well-told story about something the reader feels is applicable or significant. The satisfactory testimonies are extra complete and greater comprehensive. They contain extra demonstrated statistics from greater sources with greater viewpoints and expertise. They show off greater enterprise, more reportorial effort.

There are 5 key elements to every story: plot, setting, characters, factor of view, and conflict.

Learn more about story writing here:

https://brainly.com/question/1643608#SPJ9

Read the final two paragraphs from "Money to Us Is of No Value."

You have talked to us about concessions. It appears strange that you should expect any from us, who have only been defending our just rights against your invasions. We want peace. Restore to us our country, and we shall be enemies no longer.

We desire you to consider, brothers, that our only demand is the peaceable possession of a small part of our once great country. Look back and review the lands from whence we have been driven to this spot. We can retreat no farther, because the country behind hardly affords food for its present inhabitants, and we have therefore resolved to leave our bones in this small space to which we are now confined.

Which best describes a central idea of this excerpt?

A. The tribes will defend their rights under any circumstances.

B. The tribes have no place left to retreat.

C. The tribes want to live peacefully on their land.

D. The US government has been pushing the tribes off their land.

Answers

Correct Answer C Read the final two paragraphs from "Money to Us Is of No Value."

What purposes do paragraphs serve?

To make it easier for your reader to comprehend the rationale of your argument, employ paragraphs. They shouldn't be too short (one or two phrase paragraphs usually haven't provided your client enough information) or too long (typically speaking, paragraphs more than 3/4 of a page is probably too long).

What number of words are in a paragraph?

Often, a paragraph only addresses one idea. Normally, you'll utilize one sentence to establish the topic and several supporting sentences to finish it. A paragraph typically has between 100 and two hundred word, though this generalization is less rigid than you may imagine.

To know know more about paragraph visit:

https://brainly.com/question/24460908

#SPJ

according to the text how did NASA's understanding of software engineering develop over time?

Answers

NASA grew to understand the importance of software engineering in the Apollo missions over time.

What is Software Engineering?

Software engineering is a thorough examination of engineering as it relates to software design, development, and maintenance. The problem of poor-quality software projects was addressed with the introduction of software engineering.

Issues occur when software frequently goes beyond budgets, schedules, and quality standards. It guarantees that the application is created consistently, accurately, on schedule, within constraints, and within budget.

Software engineering becomes more necessary to keep up with the rapid changes in user requirements and the environment that applications are expected to operate in.

Therefore, NASA grew to understand the importance of software engineering in the Apollo missions over time.

To learn more about Software engineering, refer to the link:

https://brainly.com/question/10339061

#SPJ1

Although Noah’s parents’ relaonship was against the law and could have induced violence if
discovered, his mother always made sure that Noah knew he was loved and wanted, even
though he lost contact with his father for many years. How do you think this knowledge
affected Noah growing up, and in his mother’s insistence that he reconnect with his father?

Answers

Noah's knowledge that he was loved and wanted despite the illegality of his parents' relationship likely gave him a strong sense of self-worth and security growing up.

What is knowledge?

Knowledge is the awareness, understanding or familiarity acquired through study, experience or being taught. It is the accumulation of facts, skills and information that is gained through education and understanding. Knowledge is the ability to use that information to understand the world and make decisions. It can come from books, teachers, personal experiences and observations. Knowledge is power and can be used to make decisions, solve problems, create solutions and form opinions. It is the foundation for critical thinking and helps to build a better understanding of the world around us.

To learn more about knowledge

https://brainly.com/question/29768296

#SPJ1

Essay on health and fitness (sports, leisure activities) expected text length:

Answers

Positive effects from sports activities are finished more often than not thru bodily pastime, but secondary results deliver health advantages including psychosocial and personal improvement and much less alcohol consumption. Negative consequences, inclusive of the danger of failure, accidents, ingesting problems, and burnout, also are obvious. Because physical interest is increasingly performed in an prepared way, game’s role in society has end up more and more vital over the years, no longer simplest for the character but additionally for public health. In this paper, we intend to explain recreation’s physiological and psychosocial health blessings, stemming both from physical interest and from recreation participation consistent with se. This narrative overview summarizes studies and affords health-related information from Swedish authorities. It is mentioned that our every day lives are becoming less physically energetic, whilst organized exercise and schooling increases. Average electricity intake is increasing, creating an energy surplus, and thus, we're seeing more and more individuals who are obese, that is a sturdy contributor to fitness issues. Physical interest and exercising have significant nice results in stopping or alleviating intellectual contamination, which includes depressive symptoms and tension- or strain-associated disorder. In conclusion, sports activities can be evolving, if non-public capacities, social state of affairs, and organic and mental maturation are taken into account. Evidence suggests a dose–reaction relationship such that being energetic, even to a modest level, is advanced to being inactive or sedentary. Recommendations for wholesome sports are summarized.

Answer:

What use to be an environment with one simple concept to improve fitness and health has evolved to a fitness vibe. For starters, nutrition is the key to reaching and maintaining your individual weight loss and fitness goals. What once required a proper diet has now evolved into   “nourishing “your body in order for it to function properly and to its upmost  potential.

If you are incorporating any of the aforementioned exercise regiments into your daily routine and are interested in tech toys. You will probably have purchased the latest tech gadget which uses the science of Telemetry (data tracking). These trendy gadgets will track your daily activity, heart rate monitors which sync up with your personalized apps.

Online workouts,  web based fitness, short workouts (1 hour or less) and fitness for kids just to name a few are other alternatives to the traditional gym workout.                                                     However, statistics show of 54 million, online streaming and sweating has increased up to 60% and apps 87% faster. That’s to say, boutique fitness is the fastest growing and hardest workout there is in recent years. What once was dominated by big-box gyms, the boutique trend is rapidly gaining class by itself. Personalized fitness is the way to go. According to a 2014 Health Club Consumer Report personalized fitness studios, or “boutique gyms” had profits of Twenty One billion dollars and captured twenty-one percent of the market.

Explanation:

Help with this question please

Answers

Answer:

B. A man should be proud of his devotion to the gods.

Explanation:

In short this is said as: " And I’m the things that touch upon the gods it’s best in the word of deed to shun unholy pride "

Meaning: The message of Antigone is told by the Choragos to the audience at the end of the play. It means that those that those who lack wisdom cannot ever truly be happy. This wisdom has to come to them in submission to the gods. Big words, also known as hubris, are always punished.

Answer:

C. A man should not be so self-righteous to think that there is no authority above him.

Explanation:

The lines suggest that when it comes to matters concerning the gods, it is best for humans to avoid showing arrogance and pride, as there is a higher authority above them. This implies that humans should show humility and respect towards the gods and recognize their authority.

involving in relationship as a means of overcoming depression
statement of the problem

Answers

Explanation:

Statement of the problem: Can involving in a romantic relationship serve as an effective means of overcoming depression, or does it potentially exacerbate symptoms and lead to further negative outcomes?

Would you recommend this memoir to someone who might not be familiar with Trevor Noah
and his comedy? Would you read further memoirs by Noah?

Answers

Trevor Noah, a South African comedian, wrote an autobiographical comedy book titled Tales from a South African Childhood, which was released in 2016.

How is Trevor Noah portrayed in the narrative?

He is a bright, enthusiastic child who regularly acts inappropriately. Despite how much he loves his mother, he is not afraid to go against her wishes. Even though he doesn't get to visit his father very frequently, he still takes care of him.

In order to explain his peculiar upbringing, Trevor Noah wrote Born a Crime. During Apartheid, he was born in South Africa to a black mother and a white father, making his presence illegal and dangerous for both of his parents, especially the mother.

To learn more about Born a Crime from the given link

https://brainly.com/question/25051942

#SPJ1

Recommend TWO ways in which you may advise your school mates to successfully set realistic academic goals. In your mswer, also indicate how that could assist them perform better their studies. ​

Answers

Answer:

Encourage your schoolmates to break down their goals into manageable steps and remind them that it's okay to adjust their goals as necessary. By setting realistic academic goals, your schoolmates can stay motivated and focused on their academic journey, ultimately leading to academic success.

Explanation:

Encourage your schoolmates to break down their goals into manageable steps and remind them that it's okay to adjust their goals as necessary.

What are goals?

A goal is an idea of the future or desired result that a person or a group of people envision, plan and commit to achieve. People endeavour to reach goals within a finite time by setting deadlines.

A goal is roughly similar to a purpose or aim, the anticipated result which guides reaction, or an end, which is an object, either a physical object or an abstract object, that has intrinsic value.

Goal-setting theory was formulated based on empirical research and has been called one of the most important theories in organizational psychology. Edwin A. Locke and Gary P. Latham, the fathers of goal-setting theory, provided a comprehensive review of the core findings of the theory in 2002.

Learn more about goals,here:

https://brainly.com/question/21032773

#SPJ5

Https://www.cnn.com/2021/12/01/opinions/covid-19-world-aids-day-lotito/index.html

create an outline for your selected current event article. See this Rhetorical Analysis Outline Download Rhetorical Analysis Outline
The outline should include:
Introduction
Summary Paragraph
Analysis Paragraph 1 (ethos)
Analysis Paragraph 2 (pathos)
Analysis Paragraph 3 (logos)
Concluding Paragraph

Answers

Outline for a rhetorical analysis essay. I. Inauguration Rhetorical Summary: A. Author's name and a compliment about them to lend them credence.

How should a rhetorical analysis be written for an article?

A successful rhetorical analysis should address the aim or purpose of the essay, the appeals, evidence, and methods used and why, examples of those appeals, evidence, and strategies, as well as your reasoning for why they succeeded or didn't.

How should a rhetorical scenario be outlined?

The purpose, audience, topic, writer, and context are the five elements that make up a rhetorical situation. When taken together, these elements help to more thoroughly identify the settings and situations of a piece of writing. If they are properly understood, these elements can also help to direct your writing choices at work.

To know more about  Rhetorical Analysis visit:-

https://brainly.com/question/14605052

#SPJ1

can someone help with questions

Answers

In Night by Elie Wiesel, the author describes the horrific experiences he and his father endured during the Holocaust. Specifically, this passage may refer to one of the many instances where Jewish prisoners were rounded up and taken to the gas chambers to be killed en masse.

How to explain the information

The tone of this passage is somber and despairing. Elie Wiesel is witnessing unspeakable atrocities and is deeply affected by the cruelty and inhumanity he sees around him. He is also feeling a sense of helplessness and hopelessness as he realizes that he and his fellow prisoners are powerless to stop the atrocities being committed against them.

In this passage, the main character expresses a wish to return to his childhood home, where he had lived a peaceful and happy life. This desire for normalcy and safety is an example of dramatic irony because the reader knows that the main character will never be able to return to his childhood home or enjoy the same sense of security and innocence that he once had. The horrors of the Holocaust have forever changed his life and robbed him of his youth and innocence.

Learn more about Night on

https://brainly.com/question/640987

#SPJ1

What happened to the USS Cyclops? What were the explanations behind what happened? ​

Answers

The Philadelphia, Pennsylvania-based William Cramp and Sons Ship and Engine Construction Company constructed the Proteus-class collier known as the USS Cyclops for the US Navy.

What is USS Cyclops?

In general, colliers are a class of cargo ship constructed especially for carrying coal. But at the time of her disappearance, the Cyclops was transporting manganese ore, which is significantly denser than coal.

The unfortunate ship departed Rio de Janeiro's port on February 16th, 1918, with a destination of Salvador, Brazil. However, the trip appeared to be in trouble from the get-go.

The ship had reportedly been overweight and had a damaged cylinder before leaving port, however the maintenance team at the time advised having the ship return.

Therefore, The Philadelphia, Pennsylvania-based William Cramp and Sons Ship and Engine Construction Company constructed the Proteus-class collier known as the USS Cyclops for the US Navy.

To learn more about USS cyclops, refer to the link:

https://brainly.com/question/903121

#SPJ9

PLS HELP ME I WILL GIVE 5 STARS

Answers

The conclusion that can be drawn from the above is that the history about the discovery of America by Christopher Columbus as we know it is not a subject of argument and may soon be disproven as a historical fact.

What is a conclusion in literature and why is it important?

A conclusion in literature is the final section of a literary work, which summarizes the main ideas and themes of the work. It often includes a resolution to the plot, and may provide commentary or reflection on the events of the story.

A conclusion is important because it provides closure to the reader, helps them understand the meaning and purpose of the work, and allows them to reflect on the story's themes and messages.

Learn more about the Conclusion:
https://brainly.com/question/28481816
#SPJ1

In the first sentence of the second paragraph ("The sprawling . . . has found”) (lines 4–6), the author uses dashes primarily to

stress the connection between land and sea
clarify the futility of seeking a solution
qualify a sweeping assertion
emphasize an illustrative detail
showcase recent scientific findings

Answers

The author uses dashes in the first sentence of the second paragraph primarily to emphasize an illustrative detail.

What are dash and its uses?

As a flexible form of punctuation, a dash can be used in place of a bracket or colon to denote parenthesis within a sentence. In English, two independent clauses are typically connected or separated by a dash.

An underscore appears at the bottom of a line of text; a dash appears in the middle of the line. It is frequently used to indicate a range or a pause and is longer than a hyphen. Instead of dividing words into parts like a hyphen does, dashes are used to divide groups of words. A dash divides words into parenthetical statements, whereas a hyphen connects two or more words.

To learn more about dash, visit:

https://brainly.com/question/8120718

#SPJ1

In what year was McDonald's founded?​

Answers

Answer:

McDonald's was founded in 1940.

Brief Explanation:

McDonald's was founded on May 15, 1940, by Richard and Maurice McDonald in San Bernardino, California, USA. Initially, the restaurant was a barbecue joint, but the brothers realized that hamburgers and fries were more popular with their customers. They streamlined their menu, developed an innovative assembly-line system for preparing food quickly, and opened several successful McDonald's restaurants in the 1940s and 1950s. The company continued to expand over the years, becoming one of the largest fast-food chains in the world. Today, McDonald's has over 38,000 locations in over 100 countries.

TRUE OR FALSE - The sum of all the numbers on a roulette wheel is 666.​

Answers

It's the ultimate joke. Pascal not only created probability, but also gambling. 666 is the result of multiplying 36 by 37 and dividing the result by two. That was a joke.
Final answer:

The sum of all the numbers on a roulette wheel is not 666.

Explanation:

The statement is false. The sum of all the numbers on a roulette wheel is not 666. A standard roulette wheel has 38 numbers, including 1 through 36, 0, and 00. To find the sum of all the numbers, you can add them up: 1 + 2 + 3 + ... + 36 + 0 + 00 = 666. However, this is not the case as the numbers on a roulette wheel do not add up to 666.

Learn more about Roulette wheel numbers here:

https://brainly.com/question/32255838

#SPJ2

Which of these makes the best time for a daily study period?
A. The period right after your easiest class
B. The part of the day right after physical exercise
C. The time of day when your mind is usually most active
D. The hour right before you go to be

Answers

Answer:

Explanation:

I think C because for me it's when my mind is more active because to me studying is kind of boring so when my mind is active then it's more fun because i can think of whatever i'm doing and make it into something fun make the problem into something fun.

Hey is someone great at english if so can someone give me great ideas to mention in my introduction of my essay.

So basically the essay is about how can Allegory of the Cave be analyzed with the formalist lens
And my thesis is "The Allegory In The Cave" can be analyzed through the formalist lens because of the symbolism of light and darkness both literally and metaphorically throughout its text. "

Right now I'm struggling on what to write in my intro before I add my thesis and I really want to write a good essay. And please explain well!

Answers

In his book Republic, the Greek philosopher Plato compares "the influence of education and the lack of it on our character" through the use of an allegory known as The Cave Allegory, commonly known as Plato's Cave.

What is the significance of the cave's allegory?

Plato's Allegory of the Cave illustrates how characters might escape intellectual obscurity by being enlightened and having the courage to try out novel concepts.

What does Plato's allegory of the cave try to convey?

The key distinction in this metaphor is between individuals who only label knowledge as the sum of their sensory perceptions and those who comprehend true knowledge through witnessing reality. It is presented as a conversation between Plato's elder brother Glaucon and Socrates.

To know more about The Allegory In The Cave visit:-

https://brainly.com/question/30398463

#SPJ1

PLease help ASAP, WILL GVIE BRAINLIEST!!!!

Read the excerpt from "Annabel Lee" by Edgar Allan Poe. Then, answer the question that follows.

For the moon never beams, without bringing me dreams
Of the beautiful Annabel Lee;
And the stars never rise, but I feel the bright eyes
Of the beautiful Annabel Lee;

Which sound device is illustrated in the bolded text?

Alliteration
Internal rhyme
Onomatopoeia
Slant rhyme

Answers

Answer: Internal Rhyme

Explanation:

Internal rhyme is a poetic device where words within the same line of poetry rhyme with each other. In the bolded text, "beams" and "dreams" as well as "rise" and "eyes" rhyme with each other within the same lines, thus illustrating internal rhyme.

conclusion is to introduction as poverty is to

Answers

Answer: wealth

Explanation: The relationship between conclusion and introduction is that the conclusion is the final part of an argument or a discussion, while the introduction is the beginning part that sets the stage for the argument or discussion. Similarly, the relationship between poverty and wealth is that poverty represents a lack of resources or basic necessities, while wealth represents an abundance of resources or financial assets.

Other Questions
From the candy factory, Stattles candies come in five different colors that are equally distributed (20% orange), and each 14 ounce bag has a random sample of 220 of Stattles. a. Find the mean and standard deviation of the sampling distribution of pb. Calculate the probability that Cindy will get at least 48 orange Stattles in her next 14 ounce bag. Almost all writing fits into one genre or another. This is something that can certainly be debated, and often is. Research the various types of fictional genres, and try to figure out what genre Journey to the Center of the Earth would fit into. Using credible sources, such as .edu, try to find examples or definitions of the genre you choose. After you have done that, look for at least five examples from the novel that fit into the category. The writing you will submit will include:the definition or characteristics of the genre you think the novel fits ina list of five examples from the novel that support the idea that this novel fits into the genre you found Project Option 1-Individually 1 Change the equation to slope intercept form identify the slope and y-intercept of the equation. Be sure to show all your work 2 Describe how you would graph this line using the slope intercept method Be sure to write using complete sentences 4 Graph the function On the graph make sure to label the intercepts. You may graph your equation by hand on a piece of paper and scan 5 Suppose Saf's total profit on lunch specials for the next month is $1.503. The profit amounts are the same $2 for each sandwich and S graphs of the functions for the two months are similar and how they are different 02.03 Key Features of Linear Functions-Option 1 Rubric Requirements Student changes equation to slope-intercept form Student shows all work and identifies the slope and y-intercept of the equation Student writes a description which is clear precise, and correct, of how to graph the line using the slope-intercapt method Student changes equation to function notation Student explains clearly what the graph of the equation represents Student graphs the equation and labels the intercepts correctly Student writes at least three sentences explaining how the graphs of the two equations are the same and how they are different Question 5 (1 point) What best describes the following statements? Statement 1: Smith believed that countries should trust in comparative advantage a decision framework and only restrain trade in a fe the current in a circuit is 0.59 A. The circuit has two resistors connected in series: one is 110 ohms and the other is 130 ohm. What is the voltage in the circuit? Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose?