Answer:
D. A reaction in which an atom has gained 1 or more electrons.
Explanation:
The oxidation reduction reactions are called redox reaction. These reactions are take place by gaining or losing the electrons and oxidation state of elements are changed.
Oxidation:
Oxidation involve the removal of electrons and oxidation state of atom of an element is increased.
Reduction:
Reduction involve the gain of electron and oxidation number is decreased.
Consider the following reactions.
4KI + 2CuCl₂ → 2CuI + I₂ + 4KCl
The oxidation state of copper is changed from +2 to +1 so copper get reduced by gaining the one more electron
2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell
Answer:
D
Explanation:
The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.
Answer:
a cell
Explanation:
All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.
Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride
Explanation:
Fluorine: F-
Aluminium: Al3+
Bromine: Br-
3F2 + 2AlBr3 => 3Br2 + 2AlF3
The balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
What is balanced equation?An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.
The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.
The balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
Therefore, the balanced equation for the given chemical reaction can be given as
3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]
To know more about balanced equation, here:
https://brainly.com/question/29769009
#SPJ2
Which of these goals of President Truman's "Fair Deal" were met?
A. Providing federal aid to education
B. Getting rid of the Taft-Hartley Act
C. Starting a national health insurance program
D. Expanding Social Security
The goals of President Truman's "Fair Deal" were met is to be considered as the option d. Expanding Social Security.
Reason for Truman's "Fair Deal":Congress has approved Truman's extension of Social Security benefits, due to this it eliminates the national health care idea, that avoid any passing of new civil rights legislation, and failed to tackle concerns with respect to the fair labor practices.
Hence, the option d is correct.
And, the rest of the options are incorrect.
Learn more about health here: https://brainly.com/question/22618986
"Fair Deal" was a proposal given by Harry S. Truman, the president of America. The primary goal of the deal was to expand social security. Thus, option D is correct.
What was the "Fair Deal?""Fair Deal" was proposed by Truman to halt the inflation rate by controlling the economy, increase in the minimum wage structure, reform in agriculture, progressive tax layout, expansion of social security, etc.
Truman's fair deal was not a success and was a failure because of the rise in political conservatism. Social security was related to the national health care idea. Only three of his ideas in the deal were met at the end of the congress session others were a failure.
Therefore, the expansion of social security was met in Truman's "Fair Deal."
Learn more about "Fair Trade" here:
https://brainly.com/question/11801594
#SPJ5
How are mass and density different
Answer:
An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.
Answer:
brainleist
pls
Explanation:
An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.
Which of the following orbits the nucleus?
Select one:
a. proton
b. neutron
c. electron
Answer:
Electrons are the orbiting particles
Explanation:
Hope this helps UvU
Atoms of which element below are most likely to gain electrons?
Group of answer choices:
carbon
lithium
zinc
phosphorus
Answer:
Carbon and phosphorus
Explanation:
The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .
The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.
Metals are usually electron donors .
Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.What is the sequence in the formation of the Earth and the Universe?
The Earth and Universe formed around the same time
The Earth formed billions of years after the Universe formed
The Universe formed millions of years before the Earth formed
The Earth Formed before the Universe formed
Answer:
The Earth formed billions of years after the Universe formed
Explanation:
The "universe" is said to have been formed billions of year ago through an explosion. This was called the "Big Bang Theory." This lead to the expansion of the universe owing to its high temperature and density. After which, the universe cooled down. Galaxies and stars were then formed. Some of the stars died due to explosion, which then led to the creation of planets. Such formation of the planets happened around 4.5 billion years ago. This is 9.3 billions of years later than the universe was formed (13.8 billions of years ago). So, this explains the answer.
For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?
The percent yield : 73.5%
Further explanationGiven
Reaction
C+2H₂⇒CH₄
Required
The percent yield
Solution
mol of Carbon(as a limiting reactant) :
[tex]\tt \dfrac{100}{12}=8.3[/tex]
mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3
Mass of Methane(theoretical yield) :
[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]
[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]
What is the momentum of a bird with a mass of 2 kg flying at 9 m/s? *
Answer:
18 kg.m/sExplanation:
The momentum of an object can be found by using the formula
momentum = mass × velocity
From the question we have
momentum = 2 × 9
We have the final answer as
18 kg.m/sHope this helps you
Which of the alkaline-earth metals has the smallest ionization energy?
Answer:
Cesium
Explanation:
HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!
Answer:
dalton
Explanation:
believe his first name is james, if your not to sure search it
What actions can you take to reduce your impact on society?
Answer:
Cut Down On Waste. One of the simplest ways you can reduce your impact on the planet is by cutting down on waste. ...
Support Sustainable Companies. ...
Limit Your Meat Intake. ...
Reduce Energy and Water Use. ...
Offset Your Carbon Emissions. ...
Re-purpose, Recycle, and Borrow.
Explanation:
Plz mark brainliest thanks
A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?
Answer:
The final volume of the Nitrogen gas is 54.03 L.
Explanation:
Given;
initial volume of the Nitrogen gas, V₁ = 80 L
initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa
final pressure of the Nitrogen gas, P₂ = 150 kPa
If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.
V₁P₁ = V₂P₂
[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]
Therefore, the final volume of the Nitrogen gas is 54.03 L.
2. Explain how to determine the wavelength of a wave.
Type your answer here.
I
Answer:
Hope it helps:)
Explanation:
Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...
To find the wavelength of a wave;
The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.
what is the purpose of chemistry?
Answer:
To know more about chemicals and how to utilise them to solve man's probl
In trying to control fall armyworms in crops, an Agriculture extension officer applied cypermethrin which was prepared by dissolving 200g of the cypermethrin , C22H19Cl2NO3 in 1000g of water H2O . Calculate the mole fraction of cypermethrin in the solution.
Answer:
Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.0086
Explanation:
Mole fraction remains a sort of concentration. It indicates:
moles of solute / (moles of solute + moles of solvent)
Moles of solute / Total moles.
Solute: Cypermethrin → C₂₂H₁₉Cl₂NO₃
Solvent: Water (PM = 18g/mol)
We calculate moles from solvent: 1000g /18 g/mol = 55.5 moles
We calculate PM for C₂₂H₁₉Cl₂NO₃
12g/mol . 22 + 1g/mol . 19 + 35.45 g/mol . 2+ 14g/mol + 16g/mol . 3 = 416 g/m
Moles of solute: 200 g / 416g/mol = 0.481 moles
Total moles: 0.481 + 55.5 = 55.98 moles
Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.481 moles / 55.98 moles = 0.0086
Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.
Answer: Boiling water
Explanation:
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.
Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG
mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG
Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG
(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop
N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?
setup 1 : to the right
setup 2 : equilibrium
setup 3 : to the left
Further explanationThe reaction quotient (Q) : determine a reaction has reached equilibrium
For reaction :
aA+bB⇔cC+dD
[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]
Comparing Q with K( the equilibrium constant) :
K is the product of ions in an equilibrium saturated state
Q is the product of the ion ions from the reacting substance
Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)
Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium
Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)
Keq = 6.16 x 10⁻³
Q for reaction N₂O₄(0) ⇒ 2NO₂(g)
[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]
Setup 1 :
[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]
Q<K⇒The reaction moved to the right (products)
Setup 2 :
[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]
Q=K⇒the system at equilibrium
Setup 3 :
[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]
Q>K⇒The reaction moved to the left (reactants)
Answer:
The system will shift toward the products
The system is at equilibrium
The system will shift toward the reactants
Explanation:
This is correct on edg... Good Luck!!!!
Many organisms in an ecosystem compete with each other for resources. What might different species of trees in a forest ecosystem compete for?
Answer:
Water
Explanation:
Answer:
Water
Explanation:
Becasue the forest needs water to survie they may all compete for it.
The reaction AgNO3(aq) + NaCl(aq) → AgCl(s) + NaNO3(aq) is a_________
reaction. please help
Answer:
it's a precipitation reaction.
Explanation:
the solid produced is insoluble with water–making it a precipitate.
A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.
I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)
When the equations Na + O2 → Na2O is balanced the coefficient for O2 is
a) 1
b) 2
c) 3
d) 4
The coefficient of oxygen gas (O2) in the following balanced equation is: 4Na + O2 → 2Na2O, is 1.
BALANCING EQUATION:
A balanced equation is an equation that contains the same number of atoms of each element on both sides of the equation. Balancing a chemical reaction requires the use of coefficients, which are numbers placed in front of the elements/compounds involved. According to this question, the following reaction is given:Na + O2 → Na2OThe balanced chemical equation using coefficients is as follows:4Na + O2 → 2Na2OThis balanced equation shows that 1 mole of oxygen is involved, hence, the coefficient is 1.Learn more about coefficient of balanced equation at: https://brainly.com/question/21049751?referrer=searchResults
What is the mass of 5 moles of Fe2(CO3)3 ?
Answer:
1218.585
Explanation:
Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.
Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms
Fe: 55.845×2= 111.69
C: 12.011×3= 36.033
O:15.999×6=95.994
Add the values together: 243.717 g/mol
That is 1 mole of the molecule. Multiply by 5 for the final answer.
243.717×5=1218.585
A physical change is __________ if energy is given off.
Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible
Answer:
A
Explanation:
For the chemical reaction of ammonia combustion, write the expressions for velocity chemical reactions as a change in the concentration of all participants: 4 NH 3 (S ) + 5O 2 ( g ) 4 NO ( g ) + 6 H 2 O ( g )
Answer:
See explanation
Explanation:
We define the rate of reaction as the rate of disappearance of reactants or the rate of appearance of products. The negative sign written before the rate of change of concentration of reactants shows that their concentration decreases with time.
The rate of reaction in terms of the concentration of each reactant or product is shown below;
Rate = -1/4d[NH3]/dt
Rate = -1/5d[O2]/dt
Rate = 1/4d[NO]/dt
Rate = 1/6[H2O]/dt
Helpz me pleaz! I don't quite get it
Answer:
Al2O3
Explanation:
Al2O3 has an ionic bond because the bonds between them are very strong
name two life processes that viruses cannot carry out
Two life processes that viruses cannot carry out are Respiration and Sensitivity.
Which one is correct? Please hurry, the audio is just reading the question!
plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region
Answer:
True
Explanation:
Answer:
It is true!
I hope this helps. Have an awesome day <3