What function does red bone marrow serve?

A)protects the surface of bone from injury
B)acts as a factory for blood cells
C)serves as a storage location for oxygen
D)creates nutrients the body needs

Answers

Answer 1

Answer:

b, acts as a factory for blood cells

Answer 2

Answer:

b

Explanation:

edg 2021


Related Questions

Which of the following are functions of the rib cage? Check all that apply.

A) gives form and structure to the chest and torso
B) connects the carpals and tarsals
C) protects the vital organs of the torso from direct impact
D) connects the vertebrae to the skull
E) supports the weight of the skull

Answers

Answer:

A

C

?

Explanation:

Answer:

C

Explanation:

because it protects the vital organs

I just need 2 sentences for each on why the meal is healthy

Will mark brainliest for good answers!

Answers

The first meal is amazing because it is lower in calories if that is what one is looking for in a meal.
The second is a healthy meal having eggs and bacon giving amazing nutrients to the body to keeps us going all day long.
The third meal is healthy because you have protein and vegetables together getting both in a meal is amazing keeps us going.
The last meal is healthy because it is giving protein and starch with our body’s need these two things are giving humans nutrients.

If you are a female, what are the approximate odds that you will retain your
full hearing until you reach 65 years of age? *

Answers

Answer:

Approximately one in three people

Explanation:

hope this helps

hey is 156.1 cm(5'1.5) ok for a 14 y/o girl .I am conscious though.

Answers

Answer:

Yes i think so !!!

Explanation:

Answer:

Of course!! All heights are normal:). In my opinion there isn't a too tall or too short.

6. True or False. Chances of muscle soreness and injury are increased without a warm-up session.
(1 Point)

Answers

I’m pretty sure this would be true
This is true! When you don’t warmup first can and will cause muscle soreness

Reflection Question: How might you feel being interviewed while wearing the sensors and having your heart and respiratory rate data collected? How might this affect the data being collected? (is it always apparent from a polygraph what is FACT?)

Answers

Answer:

It could affect data due to you being tense

Explanation:

When you are being tested, usually a human always becomes tense, therefore your heart rate is tampered with and such

I NEED THIS TOMORROW!!!!!!!

Can someone pls right me a one page paper explaining what is badminton to someone who’s never played it???? Pls include rules, strategy, history and etc.

I WILL GIVE BRAINIEST!!

Answers

I love my Badminton but a lot of people I know haven't tried it and think it's a soft game, they have only seen people playing what is referred to as “patting” the shuttle over the net gently without moving your feet at all.

They tend to either change their minds as soon as they see it properly played and start enjoying the sport or go and try to play it and get angry that they cannot play the way they think it should be played.

A diagram of the digestive system is shown below what is the main function of the digestive system

Answers

Answer:

"to break down food into nutrients that can be circulated throughout the body"

Explanation:

I had this question on study island and got it right!

Hypothesis: When I stop activity, then

Answers

Answer:

I fail?

Explanation:

The
perspective refers to the psychological approach that emphasizes the unconscious mind's desires
and wishes.
A. humanistic
B. behavioral
C. psychodynamic
D. cognitive
Please select the best answer from the choices provided

Answers

Answer:

C) psychodynamic

Explanation:

edge 2023

The psychodynamic perspective in psychology refers to an approach that emphasizes the role of the unconscious mind's desires. Therefore, the correct option is C.

Th psychodynamic perspective, pioneered by Sigmund Freud, suggests that many of our thoughts, feelings, and behaviors are driven by unconscious conflicts and motivations.

According to the psychodynamic perspective, unresolved conflicts from childhood experiences and repressed desires can influence our emotions and behaviors in ways we may not consciously recognize.

Learn more about psychodynamic perspective in:

https://brainly.com/question/30726641

#SPJ7

1.
If one cork-based shuttle has 16 feathers how many feathers would be
needed in the construction of 5 shuttles?

Answers

80 feathers would be needed for the construction of 5 shuttles

One cork-based shuttle has 16 to construct of 5 such shuttles, 80 feathers are required.

What feather is used to make a shuttlecock?

The shuttlecock used like a ball consists of a cork head (made from the bark of the cork tree) a skirt of overlapping 16 feathers, threads and glue. In China, goose feathers are used. In India, white duck. Only six feathers in each wing can be used to make a shuttlecock.

Thus, 80 feathers are required for the construction of 5 shuttles.

To learn more about the goose feather click here:

https://brainly.com/question/14134671

does anyone love me (Cassie)

Answers

Answer:

i'm sure your family does, im pretty sure no one on here knows you but we're here for you! <3

Explanation:

why does an injured area hurt?

a) increase temperature in the area stimulates pain receptors
b) histamine stimulate pain receptors
c) swelling in the area stimulates pain receptors​

Answers

Answer:

I think that your answer is B.

Explanation:

Hope It helps!

The answer is C for example if you hit your head you’ll get a knot.

helpp me pleaseee :)

Answers

they both seem like D lol
D) All of the above

Poor decisions lead to trouble with parents, school, and even law enforcement.

List and explain the three stages of your body's stress response. Then name the four common psychosomatic responses.​

Answers

Answer:

Explanation:

The three stages are; alarm, resistance, and exhaustion.

Alarm - Mind and body go on high alert. Sometimes referred to Fight or Flight. Prepares the body to defend itself or flee from a threat.

Resistance - If the stressor continues your body adapts and reacts to the stressor. You may perform at a higher level and with more endurance for a brief period.

Exhaustion/Fatigue - Exposure to prolonged stress causes your body loses its ability to adapt. Begins to get tired and lose the ability to manage the stress effectively.

The most common psychosomatic responses are as follows; Headache, Asthma, High Blood Pressure, and a Weakened Immune System.

Which of the following are symptomatic of a digestive or metabolic disorder? Check all of the boxes that apply.

A person has difficulty losing weight.

A person is unable to digest certain foods.

A person has a severe facial rash.

A person is prone to multiple growth spurts.

A person has a hard time with physical activity.

Answers

The first 2 being difficulty losing weight and unable to digest certain foods
it would be the first two

Which of the following would be considered a normal RESTING heart rate?
95
150
45
65
PLS HELP

Answers

Answer:

65

Explanation:

answer- 65
hope that helped!

A unit of measure used to describe the amount of food recommended is known as:

Answers

Serving..if that is not the answer, portion is :)

Explanation:

Plz mark Brainliest

the three main parts of a warm up

Answers

Answer:

a light aerobic exercise, such as jogging or skipping, followed by stretching, and concluding with a sport-specific activity

The three main parts of a warm up
The basic components of a warm up consists of a light aerobic exercise, such as jogging or skipping, followed by stretching, and concluding with a specific activity. These three components will vary in their content based, on your athletic proficiency.
(Hope this helps)

ill give away my 1639 points if you answer these two questions correctly please

Answers

I don’t know just need points

Two diseases that can be caused by smoking are _______________________ and _________________________.

Answers

Answer:

1. lung cancer

2. Emphysema

Hopes this helps :)

write three things that makes you realize the importance of participating in physical activities​

Answers

Answer:

obesity, eating, fat

Explanation:

if you dont work out then you will become fat and when u decide to change then it will be harder

***Please help with this *** 12 points

When would standard precautions provide enough protection?

1. when a friend has a stomach virus
2. when a friend has a cut
3. when a friend has head lice
4. when a friend has the measles

Answers

Answer:

2 i think

Explanation:

hbvvljvhkcvk

It would be 3 lol I just did this test yesterday and I got it right good luck

When your on your period, could you lose enough blood to make it be fatal?

Answers

Answer: no, you cant, you only lose like a cup of blood in the whole week

Explanation:

Answer:

no

Explanation:

your body has gallons and galllons of blood so it would not be fadal but there is a 1% chance it could happen if you concred talk to your doc

what is an example of personal behavior stressors ​

Answers

Loss of someone important to your life [Ex. family member, close friend, s/o] Injuries, and so on.

Explanation: Personal Behavior Stressors - Negative response to the body. Whether it's effected with alcohol, drugs, or a lack of activity to the body.

An example of personal behavior stressors can be excessive procrastination. Procrastination is the habit of delaying or postponing tasks, often leading to increased stress levels.

When individuals consistently put off important responsibilities, they may experience heightened pressure and anxiety as deadlines approach. This self-imposed stress can negatively impact their well-being and productivity. Procrastination can be influenced by various factors, including poor time management skills, perfectionism, fear of failure, or difficulty prioritizing tasks.

Therefore, addressing and managing personal behavior stressors like procrastination can contribute to reducing overall stress and improving one's ability to cope with daily challenges.

For more details regarding Procrastination, visit:

https://brainly.com/question/533589

#SPJ2

I WILL GIVE BRAINLEYES. 2. Which of the following is true about sexual reproduction?
a. Genetically identical offspring are produced.
b. Only one parent is involved.
c. It puts animals at an evolutionary disadvantage in terms of variation.
d. It involves the exchange of genetic material between two individuals.​

Answers

Answer:

D

Explanation:

It involves the exchange of genetic material between two individuals

pls make me brainliest

tq

The answer to this is D.

Sexual reproduction involves genetic material between to individuals.

Hope this helps
Happy Valentines Day

. 20 points brainliest if correct
brainliest if correct 20 points
Keeping blood sugar levels stable is a key factor in managing which of the following illnesses?
A.bulimia nervosa
B.celiac disease
C.diabetes
D.anorexia nervosa

Answers

The answer is c diabetes it is important to keep your blood sugar stable to prevent spikes or drops in your blood sugar

Which step is one of the universal steps for operating an AED?
a Removing the victim from water
b.Shave the victim's hairy chest
c Place pads on the victim's bare chest
d Finding the victim's implanted pacemaker

Answers

Answer:

C) place pads on victim's bare chest

Explanation:

this is true for all cases. You always remove clothing from the patient's chest and place the AED pads. You would only remove the victim from water if they were in water in the first place (and quickly wipe the check dry). you would only shave the victim's hairy chest if you only have one set of pads, or when you try to apply the pads the first time, the AED tells you to make sure they are correct. And you would only find the victim's implanted pacemaker if you see a scar. You can still shock someone with a pacemaker, you just can't put the pads on top of the device.

One of the universal steps for operating an AED is C. Place pads on the victim's bare chest

AED simply means an automated external defibrillator. This is a portable device that's used in diagnosing ventricular fibrillation.

An automated external defibrillator refers to a medical device that is used in analyzing the rhythm of the heart and then delivers an electric shock to the person.

It should be noted that the automated external defibrillator is placed on the chest of the person to check the heart rhythm.

Read related link on:

https://brainly.com/question/20779567

Scenario: texting while driving

1. List a few ways you could fix the problem

2. What are the consequences (list pros and cons)

3. List how to Decide and act during this situation

4. Evaluate the situation (how do you determine how well the outcome was?)

Answers

1: Put the phone down. Pull over if it’s that important. Or do whatever your doing later.
2: Accident, Ticket, Death. (Sorry I don’t really wanna put pros because you should never text and drive.)
3: Put the phone down and answer later
4: Nothing good would happen no matter what. You can make it through or you’ll get hurt.

Which of the following is not a step in eating healthy?
balance your sodium intake
O limit added sugar intake
eat three meals a day
o eat a variety of foods

Answers

Answer:

last answer

Explanation:

I'm pretty sure it's the last one

The last one I’m think
Other Questions
Which of the following verbs is typically used with el baloncesto?A. JugarB. HacerC. TocarD. Tomar Write the equation of the line that passes through the points (-1,3) and (-6, -7).Put your answer in fully reduced point-slope form, unless it is a vertical or horizontalline. Photosynthesis uses all of the following exceptto make food.carbon dioxideO light energyO chemical energywateris its A? Sally says her stomach and liver have nothing to do with her heart and blood, and that they are completely separate. What did she say that is wrong?What would be the correct statement?What are the facts youd use to correct her? In 1985, the Gramm-Rudman-Hollings Balanced Budget and Emergency Control Act was passed in order to ensure that the federal government submitted goals to meet the deficit. If the goals are not met, then the president must order spending cuts across the entire budget based on the recommendation of the comptroller general, a position appointed by the president.The scenario above describes which of the following powers attributed to Congress?a. Congressional oversight by reviewing appropriations requests that need to meet certain spending criteriab. Congressional response to presidential budget cuts based on the comptroller general's recommendationsc. Congressional subcommittees that can review improper relationships between the comptroller and the presidentd. Congressional action to block proposed spending cuts to all federal agencies by amending the executive budget to target items from the president's agenda Which is the dominantmouth shape for emojis inthe picture below?How do you know?Smiley = MFrowny = mSchilly ScienceSMILEYFROWNY Gary wants to buy a bike that is 30% off. The original price is $109.56. What is the amount of the discount? Loss of voluntary control over urination is calledO dialysisO incontinenceO neurogenic bladderO urgencyPrevious what is one sixth of the product of four and nine table saws you can use with __ or __ but not both at the same time HELP PLS What is the value of the x variable in the solution to the following system of equations? (1 point)4x + 2y = 6x - y = 3O-15-22 Do violence and alcohol have anything to do with each other? If so, what do they have in common? If they don't have anything in common, tell me why? (SAT Prep) Find the value of x. He math team does practice drills that each last hour. In February the team did practice drills for a total of 24 hours. How many practice drills did the math team do in feburary PLEASE ANSWER FAST!!!!Explain why the U.S. decided to change its goal from protecting western settlements to attacking Native Americans and forcing them onto reservations. i just asked my best friend if she talk ab me behind my back bc i kinda have trust issues and i dont get what she means by this.... do yall have any idea? Write and solve an equation to determine the value of x in the figure. a. 3x 84; 252 b. 3x 84; 28 c. 3x 84; 84 d. 3x 84; 81 Find the value of x. Plsssssss Help!!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC