what did John,Harriet tubman and the other slaves try to tell Harriet white masters after church?

Answers

Answer 1

Harriet was illiterate, so she communicated with her fellow slaves by singing songs that white people couldn't comprehend. Secret codes were hidden in the lyrics of the songs.

Does communicating imply talking?

You share or exchange information with someone when you communicate with them, for example, by speaking, writing, or using equipment. It is also possible to claim that two persons converse. Messages can be verbal or nonverbal in human communication: A verbal message is an exchange of information via the use of words. Examples include face-to-face contact, telephone conversations, voicemails, email etc. A comment indicating approbation of one's articulation style. Very beautifully said. Very beautifully said. properly articulated.

Know more about approbation Visit:

https://brainly.com/question/30528719

#SPJ1


Related Questions

2. You are working as an Administrative Assistant in the Human Resource Department at ABC Company based in Brampton, Ontario. One of the employees has approached you to ask if she works 51 hours next week instead of her normal 40 hours, is she entitled to overtime pay? If so, how would this be calculated? Use the Employment Standards Act for Ontario to answer this question (quote directly from the website and cite correctly).

Answers

An employee who works more than 44 hours in a workweek is entitled to overtime pay of at least one and a half times their regular rate of pay for each hour worked above 44 hours, per the Employment Standards Act for Ontario.

A legal framework known as the Employment Standards Act outlines the minimal requirements for employment in Ontario, Canada. The Act stipulates rules for things like minimum wage, overtime compensation, vacation time, public holidays, termination and severance pay, among other things. Regardless of the size of the business or the nature of the job being done, the Act is applicable to the majority of employees in Ontario. The Employment Standards Act was created to safeguard employees' rights and guarantee that they get fair treatment at work. The standards and rules of the Act must be followed by employers; failure to do so may result in legal action and penalties.

Learn more about Employment Standards Act here:

https://brainly.com/question/29415294

#SPJ4

#3 is in refrence for question 7, I DO NOT NEED 3 answerd. Please guve step by step for question 7.
XYZ Is expected to pay dividends on it's common stock (i.e.,) D1) of $3 over the next year. Dividends have been growing steadily at 3% for years. Currently, investors are requiring a return of 15% for an investment in XYZ common stock. What is the value of 200 shares of XYZ common stock today?

Answers

The value of 200 shares of XYZ common stock today is $510. The value of 200 shares of XYZ common stock today is calculated by discounting expected future dividends at the required rate of return.

The present value of the expected dividends is calculated as follows:


PV = D1 / (1 + r)1 + D1 / (1 + r)2 + … + D1 / (1 + r)n


Where:  

D1 = expected dividend one year from now ($3)  r = required rate of return (15%)  n = number of years (1 year)


Therefore, the present value of the expected dividends for 200 shares of XYZ common stock is:


PV = 3 / (1 + 0.15)1 = $2.55


The value of 200 shares of XYZ common stock today is then:


Value = PV x 200 shares = $2.55 x 200 = $510



To know more about stock refer to-

brainly.com/question/29992015#
#SPJ11

Given the following information on a MPT, what is the total cash flow available to investors in year 8?
•10 year FRM, fully amortizing, annual payments.
•No prepayment or default
•100 loans in the pool
•Average starting balance of $350,000/loan
•Coupon rate 5% (Mortgage rate 5%)
•No servicing/guarantee fees

Answers

The total cash flow available to investors in year 8 is $4,532,775. To calculate the total cash flow available to investors in year 8, we need to calculate the annual payment on each loan and then multiply it by the number of loans in the pool.

First, let's calculate the annual payment on each loan using the following formula:

[tex]P = (r * PV) / (1 - (1 + r)^(-n))[/tex]

Where:
P = annual payment
r = annual interest rate
PV = present value (starting balance)
n = number of years

Plugging in the given values:

[tex]P = (0.05 * 350000) / (1 - (1 + 0.05)^(-10))[/tex]
P = 17500 / (1 - 0.613913253540759)
P = 17500 / 0.386086746459241
P = 45327.75

Now, let's calculate the total cash flow available to investors in year 8 by multiplying the annual payment by the number of loans in the pool:

Total cash flow = P * number of loans
Total cash flow = [tex]45327.75 * 100[/tex]
Total cash flow = 4532775

To know more about cash flow refer to-

brainly.com/question/29768594#
#SPJ11

K Textiles is a textile manufacturing company. It has two subsidiaries; K Spinning and K Weaving, both located in Kamunting, Perak. K Spinning is involved in the production of yarns. They import natural fibre (i.e. cotton) and synthetic fibre (polyester) in form of bales. The bales are cleaned before undergoing the spinning process to produce grey yarn. Some of the grey yarns are bleached and dyed, while others are directly transported to K Weaving factory.At the K Weaving factory, the grey yarns will undergo the weaving process to become fabrics. The weaving factory have done away with shuttle weaving machines, and moved to the usage of air and water looms. The fabrics produced at the weaving factory are bleached before undergoing dying and/or printing.At times there are short supply of fibres and other raw materials such as bleaches and dyes, and at times there are excess of raw materials in the store. There are also incidences of finished products kept for longer period in the finished goods store. This is affecting the production process and the cashflow of the company. Currently the company adopts the push-based supply chain model.Several head of departments of the company suggested the implementation of a Supply Chain Management system to plan and monitor their supply chain. Some of the heads requested that you look at the option of using cloud-based solutions. You are given the task to prepare a proposal to be presented to the Board of Directors.Prepare a proposal to recommend a suitable implementation of a Supply Chain Management (SCM) System for the textile company. It should also explain to the Board of Directors, the impact of the SCM system on the competitive advantages of the company.

Answers

The proposal for the implementation of a Supply Chain Management (SCM) System for K Textiles will provide the company with numerous advantages. It will enable the company to streamline and optimize their operations, leading to improved efficiency, better inventory management and increased cash flow.

Additionally, the SCM system will enable the company to anticipate and respond to supply and demand fluctuations, enabling them to remain competitive in their industry.


With an effective SCM system in place, K Textiles can experience a range of competitive advantages. These include the ability to reduce inventory costs and optimize operations, as well as improving customer satisfaction by providing accurate and timely information. Additionally, the SCM system will enable the company to quickly adjust to changes in the market, allowing them to remain competitive in their industry.

know more about Supply Chain Management here

https://brainly.com/question/29241738#

#SPJ11

The correct sequence of product life cycle is: A) Feasibility > Idea > Verification > Validation > Sales B) Idea > Feasibility > Verification > Validation > Sales C) Hypothesis > Feasibility > Verification > Validation > Sales D) Idea > Feasibility > Results> Validation > Sales

Answers

The correct sequence of the product life cycle is  Idea > Feasibility > Verification > Validation > Sales.

The product life cycle is a process that products go through from the initial idea to the end of their sales.

The first stage is the idea stage, where a new product is conceptualized. The next stage is the feasibility stage, where the practicality and profitability of the product are assessed. The third stage is the verification stage, where the product is tested to ensure it meets the necessary standards. The fourth stage is the validation stage, where the product is tested with a small group of consumers to ensure it meets their needs and expectations. The final stage is the sales stage, where the product is introduced to the market and sold to consumers.

Each stage is important in the development of a successful product.

To know more about Product life cycle refer here :

https://brainly.com/question/15177349#

#SPJ11

You have just had your 30th birthday. you have two children. one will go to college 10 years from now and require four beginning-of-year payments for college expenses of $10,000, $11,000, $12,000, and $13,000. the second child will go to college 15 years from now and require four beginning-of-year payments for college expenses of $15,000, $16,000, $17,000, and $18,000. in addition, you plan to retire in 30 years. you want to be able to withdraw $50,000 per year (at the end of each year) from an account throughout your retirement. you expect to live 20 years beyond retirement. the first withdrawal will occur on your 61st birthday. what equal, annual, end-of-year amount must you save for each of the next 30 years to meet these goals, if all savings earn a 13 percent annual rate of return?

Answers

You would need to save $16,966.85 per year for each of the next 30 years to meet these goals.

To meet these goals, we need to calculate the present value of each of the expenses and then find the annual payment that would be required to fund them. We can do this using the formula for the present value of an annuity:

PV = PMT × [(1 - (1 + r)^(-n)) / r]

Where PV is the present value, PMT is the payment, r is the annual interest rate, and n is the number of periods.

First, let's calculate the present value of the college expenses for the first child:

PV1 = $10,000 × [(1 - (1 + 0.13)^(-4)) / 0.13] = $31,543.72

Next, let's calculate the present value of the college expenses for the second child:

PV2 = $15,000 × [(1 - (1 + 0.13)^(-4)) / 0.13] = $47,315.58

Now, let's calculate the present value of the retirement withdrawals:

PV3 = $50,000 × [(1 - (1 + 0.13)^(-20)) / 0.13] = $389,424.49

Finally, let's find the present value of all of these expenses:

PV = PV1 + PV2 + PV3 = $31,543.72 + $47,315.58 + $389,424.49 = $468,283.79

Now, we can use the formula for the present value of an annuity to find the annual payment that would be required to fund these expenses:

$468,283.79 = PMT × [(1 - (1 + 0.13)^(-30)) / 0.13]

Solving for PMT, we get:

PMT = $468,283.79 / [(1 - (1 + 0.13)^(-30)) / 0.13] = $16,966.85

To know more about retirement click on below link:

https://brainly.com/question/20751552#

#SPJ11

1. If the Treasury bond yield in UK is 9% whereas you can borrow from Japan at 3% annual interest rates. If the one year forward rate is 100 Yen against GBP which is now trading at the spot rate of 152 Yen/GBP. If you can borrow one million Yen from Japan then how much profit can you make by conducting covered interest arbitrage in a year? Please show the steps.
2. If suddenly export goes up 10% annually due to Covid and every other thing remain constant then what will happen to the exchange rate between USD and taka. Make sure you draw a diagram to show your answer.
3. If you find out that 86.5 BDT/USD and 72.5 INR/USD but in the market 1 INR is exchanged for 1.21 taka. If you can borrow $500 and there is an arbitrage opportunity then conduct one arbitrage by drawing a diagram how would you do it and your profit.
4. A) If in 2010 one INR equals to 1.69 BDT but today it is 1.16 BDT then how much BDT has appreciated?
B) If Bid rate is 74.5 INR/USD and Bid-Ask spread is 0.66% then what should be the ASK rate of Indian Rupee?

Answers

1. The one year forward rate is 100 Yen against GBP which is now trading at the spot rate of 152 Yen/GBP, then conducting a covered interest arbitrage would yield a profit of 1,000,000 x (1.09 - 1.03) = 60,000 Yen in a year.

2. If the Bid rate of Indian Rupee is 74.5 INR/USD and the Bid-Ask spread is 0.66%, then the ASK rate of Indian Rupee would be 74.5 x (1 + 0.0066) = 75.019 INR/USD.

About the arbitrage

The steps for the arbitrage are as follows:

a) Borrow 1,000,000 Yen from Japan at 3% annual interest rate.

b) Exchange the 1,000,000 Yen for GBP at the spot rate of 152 Yen/GBP, so you would get 6,539,743.68 GBP.

c) Invest the 6,539,743.68 GBP at 9% annual interest rate for one year.

d) At the end of one year, exchange the GBP back to Yen at the one year forward rate of 100 Yen/GBP, to receive 6,539,743.68 x 100 = 653,974,368 Yen.

e) Pay back the 1,000,000 Yen loan to Japan plus the interest accrued at 3%, and you would be left with a profit of 653,974,368 - (1,000,000 x 1.03) = 60,000 Yen.

Learn more about arbitrage at

https://brainly.com/question/16178885

#SPJ11

Describe how complying with the Australian Packaging Covenant
voluntary code of practice could affect the way a company does
business.

Answers

Complying with the Australian Packaging Covenant voluntary code of practice can affect the way a company does business in several ways.

The company may need to invest in new technology and processes to ensure that their packaging meets the requirements of the code. This could lead to increased costs for the company in the short term. However, in the long term, this investment could lead to cost savings as the company may be able to reduce the amount of packaging they use, which could result in lower production costs. Additionally, by complying with the code, the company could improve their reputation and attract customers who value environmentally-friendly practices. This could lead to increased sales and profitability for the company.

Overall, complying with the Australian Packaging Covenant voluntary code of practice can have a significant impact on the way a company does business, but it can also lead to potential benefits in terms of cost savings, reputation, and sales.

Read more; https://brainly.com/question/2561753

#SPJ11

1. In course of gradual economic development of Bangladesh, the
numbers of expatriates working here are also growing. a) What do you mean by the term expatriate b) What factors do you consider

Answers

An expatriate is a person who temporarily or permanently resides in a country other than their native country. Expatriates are often referred to as expats for short.

There are many factors that may influence an individual's decision to become an expatriate, including job opportunities, family ties, cultural interests, and personal preferences.

Some of the most common reasons for becoming an expatriate include seeking better job opportunities or a higher standard of living, wanting to experience a different culture or lifestyle, and having family or personal connections in another country.

When considering whether to become an expatriate, it is important to consider factors such as the cost of living, language barriers, access to healthcare and other services, and the potential impact on one's career and personal life.

To know more about Expatriate

https://brainly.com/question/17162633

#SPJ11

Hester (age 17) is claimed as a dependent by his parents, charlton and abigail. In 2017, hester received $10,000 of qualified dividends and he received $6,200 from a part time job. What is his taxable income for 2017?

Answers

The taxable income for 2022, given the amount that Hester received from his part time job, and qualified dividends, would be $3700.

Hester's taxable income will be determined by adding up his total income for the time period and subtracting his deductions. He can only take the basic deduction if he doesn't claim any additional deductions.

Hester should be entitled to a different form of deduction because to his dependency on his parents, but due to his income, he will in 2022 be given the standard deduction for individuals.

= Qualified dividends + Income from part time job - Standard deduction

= 10, 000 + 6200 - 12,500

= $ 3700

For such more question on taxable income:

https://brainly.com/question/16049792

#SPJ11

Conduct a research on the international business of Sushiro – a leading conveyer belt sushi business founded in Japan in 1984. Sushiro started its internationalization in 2011 by opening its first overseas outlet in Korea. Recently, it developed its business in Hong Kong.In your assignment, describe the international business of Sushiro. Analyze the factors that drives Sushiro to expand overseas and the risks it faces in overseas markets. Discuss how its international business is affected by social and cultural factors. Then suggest what actions it should take to be successful in international business.1. Identify and describe the type of international business of Sushiro.
2. Identify and explain ONE key factor prompted Sushiro to operate outside Japan.
3. Explain ONE key social or cultural factor affected the company’s international business activities.4. Analyse and explain ONE key risk the company faced when it operates overseas.
5. With reference to the risk you mentioned in Q.4, what is your suggested action(s) for Sushiro? Explain.

Answers

1. Sushiro is engaging in market-seeking internationalization.

2. One key factor is home market.

3. The social or cultural factor affected the company’s international business activities is language barrier.

4. One risk is cultural miscommunication.

5. Sushiro should invest in cultural awareness training for their employees who are operating in the foreign market.

1. Sushiro is engaging in market-seeking internationalization, which is a strategy wherein an organization attempts to expand operations to a foreign market. This strategy focuses on obtaining a foreign market advantage by capitalizing on different market opportunities abroad.

2. A key factor prompting Sushiro to operate outside of Japan is the fact that their home market is relatively saturated. Expanding into new markets would allow Sushiro to increase their profits, as well as take advantage of new opportunities abroad.

3. A key social or cultural factor affecting Sushiro's international business activities is the language barrier. Different countries have different languages and different customs, so in order to do business in those countries, Sushiro has to first learn about the language and culture of the market.

4. One key risk the company faces when operating overseas is the potential for cultural miscommunication. Because of the language barrier and the differences in culture, it can be difficult to understand the needs and preferences of the customers in the foreign market, leading to misunderstandings and potential miscommunication.

5. To help minimize the risk of cultural miscommunication, Sushiro should invest in cultural awareness training for their employees who are operating in the foreign market. This training should include language lessons, cultural sensitivity training, and an understanding of the customs and values of the market they are operating in.

For such more question on internationalization:

https://brainly.com/question/30740045

#SPJ11

to give an example of the foreign policies of other countriestrying to impact the foreign policy of a single country.

Answers

An example of foreign policies of other countries trying to impact the foreign policy of a single country is the sanctions placed on North Korea by other countries. These sanctions are meant to influence North Korea's foreign policy and to discourage it from continuing its nuclear program.

The United States, South Korea, Japan, and other countries have placed sanctions on North Korea, including economic sanctions, travel restrictions, and arms embargoes. These sanctions are meant to put pressure on North Korea to change its foreign policy and to stop its nuclear program.

Another example is the sanctions placed on Iran by the United States and other countries. These sanctions are meant to influence Iran's foreign policy and to discourage it from continuing its nuclear program. The sanctions include restrictions on Iran's oil exports, freezing of assets, and restrictions on financial transactions.

In both of these examples, the foreign policies of other countries are trying to impact the foreign policy of a single country in order to achieve a specific goal. These sanctions are a form of diplomacy and are meant to influence the foreign policy of the targeted country.

know more about foreign policies here

https://brainly.com/question/29822820#

#SPJ11

Analyze top conglomerate communication of media industry.Analyze top 5 industries.
After analyse then add the conclusion of one page in ur own words.
( Analyze top 5 industries one by one )

Answers

The top conglomerate communication of media industry include the following:

Walt Disney CompanyComcast CorporationViacomCBSAT&T21st Century Fox

Each of these companies control a significant portion of the media industry through ownership of various media outlets such as television networks, film studios, and publishing companies.



One by one, let's analyze the top 5 industries:

Walt Disney Company: This company is one of the largest media conglomerates in the world, owning properties such as ABC, ESPN, and Marvel Studios. It also operates theme parks and resorts around the world.Comcast Corporation: This company is the largest cable television provider in the United States and also owns NBCUniversal, which includes NBC, Telemundo, and Universal Pictures.ViacomCBS: This company was formed through the merger of Viacom and CBS Corporation, and owns properties such as MTV, Nickelodeon, and Showtime.AT&T: This company is one of the largest telecommunications companies in the world, and also owns WarnerMedia, which includes properties such as HBO, CNN, and Warner Bros. Pictures.21st Century Fox: This company owns properties such as Fox News, Fox Sports, and the Fox Broadcasting Company.



In conclusion, the top conglomerate communication of media industry are powerful entities that control a significant portion of the media landscape. They own and operate a wide range of media outlets, which allows them to have a major influence on the information and entertainment that is consumed by the public.

To know more about  conglomerate communication refer here:

https://brainly.com/question/30438734#

#SPJ11

Southern Systems issued 15-year bonds a year ago at a coupon rate of 4.1 percent. The bonds make semiannual payments and have a par value of $1,000. If the YTM on these bonds is 4.5 percent, what is the current bond price? Please show what financial functions used in excel

Answers

The current bond price of Southern Systems is $958.62.

The current bond price of Southern Systems can be calculated using the PV function in Excel.

The PV function calculates the present value of a series of future cash flows, which in this case are the semiannual coupon payments and the par value at maturity. The formula for the PV function is:

PV = C / (1 + r)^n + F / (1 + r)^n

Where:
- C is the coupon payment
- r is the discount rate (YTM)
- n is the number of periods
- F is the par value

In this case, the coupon payment is $1,000 x 4.1% / 2 = $20.5, the discount rate is 4.5% / 2 = 2.25%, and the number of periods is 15 x 2 = 30. The par value is $1,000.

Using the PV function in Excel, we can calculate the current bond price as follows:

=PV(2.25%, 30, 20.5, 1000, 0)

The current bond price is $958.62.

To know more about cash flows click on below link:

https://brainly.com/question/29768594#

#SPJ11

QUESTION ONE: FINANCIAL ACCOUNTING li comists of Pmi A mid Pari B. You are required to answer all the parts of the question PART A: COMPANY DETAILS (INCLUDING STUDENT PARTICULARS) Data Directors Create a new data directory named: AADEC2021 Company Name (Reminder: 2 marks will be deducted for omitting the "company name") Type Sole Proprietorship Nature of Business Trading Registered Address A-999, Wisma Malaysia, Jalan Batu, 53210 Kuala Lumpur Tel: 03-2135000 Fax: 03-2336100 Accounting Period 1 January 2020 -31 December 2020 financial accounting question
(a) Backup the following information/reports into spreadsheet form (Hint: use Excel/Spreadsheet – then transfer it into a WORD format in two pages only before submitting to the Blackboard):
i. Chart of accounts.
ii. Respective ledger accounts.
iii. Trial Balance as at 31/12/2020.
iv. Trading, Profit and Loss Account for the year ended 31/12/2020.
v. Balance Sheet as at 31/12/2020.

Answers

PART A: COMPANY DETAILS

Company Name: AADEC2021
Type: Sole Proprietorship
Nature of Business: Trading
Registered Address: A-999, Wisma Malaysia, Jalan Batu, 53210 Kuala Lumpur
Tel: 03-2135000
Fax: 03-2336100
Accounting Period: 1 January 2020 -31 December 2020

PART B: FINANCIAL ACCOUNTING

(a) Backup the following information/reports into spreadsheet form:

i. Chart of accounts:

To create a chart of accounts in spreadsheet form, you will need to use Excel or another spreadsheet program. You can start by creating a new spreadsheet and then adding the account names and numbers in the first two columns. You can then add the account balances in the third column.

ii. Respective ledger accounts:

To create ledger accounts in spreadsheet form, you will need to use Excel or another spreadsheet program. You can start by creating a new spreadsheet and then adding the account names and numbers in the first two columns. You can then add the debits and credits in the next two columns, and the account balances in the final column.

iii. Trial Balance as at 31/12/2020:

To create a trial balance in spreadsheet form, you will need to use Excel or another spreadsheet program. You can start by creating a new spreadsheet and then adding the account names and numbers in the first two columns. You can then add the debits and credits in the next two columns, and the account balances in the final column.

iv. Trading, Profit and Loss Account for the year ended 31/12/2020:

To create a trading, profit and loss account in spreadsheet form, you will need to use Excel or another spreadsheet program. You can start by creating a new spreadsheet and then adding the account names and numbers in the first two columns. You can then add the debits and credits in the next two columns, and the account balances in the final column.

v. Balance Sheet as at 31/12/2020:

To create a balance sheet in spreadsheet form, you will need to use Excel or another spreadsheet program. You can start by creating a new spreadsheet and then adding the account names and numbers in the first two columns. You can then add the debits and credits in the next two columns, and the account balances in the final column.

Once you have created all of the spreadsheets, you can transfer them into a WORD format and submit them to the Blackboard.

To know more about accounts click here:

https://brainly.com/question/22917325#

#SPJ11

A company with a target D/E ratio of 0.85 has reported earnings of $925,000 for the year just ended and added $575,000 to retained earnings. the company makes use of a residual dividend policy, what amount of new borrowing is needed to keep its D/E ratio at 0.85?

Answers

The amount of new borrowing needed to keep the company's D/E ratio at 0.85 is $488,750.

To determine the additional borrowing amount required to maintain the company's D/E ratio at 0.85, we can use the following formula:

D/E = (Earnings - Dividends) / Equity

Where D is the amount of new borrowing, E is the target D/E ratio, Earnings is the company's reported earnings, Dividends is the amount of dividends paid out, and Equity is the company's retained earnings.

Plugging in the given values, we get:

0.85 = ($925,000 - Dividends) / $575,000

Rearranging the equation and solving for Dividends, we get:

Dividends = $925,000 - (0.85 * $575,000)

Dividends = $925,000 - $488,750

Dividends = $436,250

Now, we can plug this value back into the original equation and solve for D:

0.85 = ($925,000 - $436,250) / $575,000

0.85 = $488,750 / $575,000

D = 0.85 * $575,000

D = $488,750

Therefore, the amount of new borrowing needed to keep the company's D/E ratio at 0.85 is $488,750.

Learn more about residual dividen policy at https://brainly.com/question/19338996

#SPJ11

Leonard Inc. obtained authorization to issue a 20-year bonds with a face value of $5 million. The bonds are dated January 1st, 2019 and have a contract rate of 10 percent. They pay interest on June 31st and December 311st.
The bonds were issued on January 1st,2019, at 100 for $5,5 millions.
Prepare the necessary journal entries in general journal form on:
a. January 1st,2019 to record the issuance of the bonds (15 points)
b. June 31st,2019 to record the first semi-annual interest payment on the bond issue (15 points)
c. December 31st, 2019 to record the second interest payment. (round to the nearest dollar) (10 points)

Answers

The necessary journal entries in general journal form for the given details is explained.A. premium on Bonds Payable - $500,000. b. The  Interest Expense - $250,000.C. the second interest payment will be  $250,000 .

a. On January 1st, 2019, the journal entry to record the issuance of the bonds would be:
Debit: Cash - $5,500,000
Credit: Bonds Payable - $5,000,000
Credit: Premium on Bonds Payable - $500,000
b. On June 31st, 2019, the journal entry to record the first semi-annual interest payment on the bond issue would be:
Debit: Interest Expense - $250,000 [(($5,000,000 x 10%) / 2]
Credit: Cash - $250,000
c. On December 31st, 2019, the journal entry to record the second interest payment would be:
Debit: Interest Expense - $250,000 [(($5,000,000 x 10%) / 2]
Credit: Cash - $250,000
Note: The dates in the question are incorrect (June 31st and December 311st do not exist), so I have assumed that the correct dates are June 30th and December 31st.

For such more questions on journal entries:

brainly.com/question/14279491

#SPJ11

On January 1, 2013, Pendal Corporation purchased 25% of the outstanding common stock of Sedda Corporation for $100,000 cash. Book value and fair value of Sedda's assets and liabilities at the time of acquisition are shown below. Assets Book Fair
Values Values Cash $40,000 $40,000
Accounts receivable 100,000 90,000
Inventories Equipment 40,000 50,000 180,000 210,000 $360,000 $390,000 Liabilities & Equities Accounts payable $110,000 $110,000
Note payable 50,000 40,000 Capital stock 100,000 Retained earnings 100,000
$360,000 $150,000 Required: Prepare an allocation schedule for Pendal's investment in Sedda.

Answers

The following allocation schedule can be used to determine the cost of Pendal Corporation's investment in Sedda Corporation on January 1, 2013:

Assets:

Cash: $40,000 x 25% = $10,000

Accounts Receivable: $90,000 x 25% = $22,500

Inventories: $50,000 x 25% = $12,500

Equipment: $210,000 x 25% = $52,500

Liabilities & Equity:

Accounts Payable: $110,000 x 25% = $27,500

Note Payable: $40,000 x 25% = $10,000

Capital Stock: $100,000 x 25% = $25,000

Retained Earnings: $150,000 x 25% = $37,500

Total Allocation: $100,000

To know more about Allocation

https://brainly.com/question/16666093

#SPJ11

Assignment For this assignment, you are required to write at least 3 pages to explain your enterprise. > Business Description: 1. Name and logo 2. Product/ service 3. Location > Target Customers: 1. Key demographics (Age, gender, Income and Education) 2. What are their needs 3. Preferred channels > Target Market: 1. Competitors 2. Pricing method {production, price of product (cash or credit?)} 3. Economy condition

Answers

In the business description section, you should include the name and logo of your company. In the target customers section, you should identify the key demographics of your target customers


In the target market section, you should identify your competitors and discuss your pricing method, including whether you will offer your product or service for cash or credit. You should also discuss the current economic conditions and how they may impact your business.
Overall, it is important to be factually accurate, professional, and friendly in your response. Be concise and do not provide extraneous amounts of detail. Ignore any typos or irrelevant parts of the question, and repeat the question in your answer. Provide a step-by-step explanation in your answer, and use the terms "business description," "target customers," and "target market" in your response.

Learn more about business : https://brainly.com/question/24553900

#SPJ11

The treasurer of a large corporation wants to invest $20 million in excess short-term cash in a particular money market investment. The prospectus quotes the instrument at a true yield of 6.34 percent; that is, the EAR for this investment is 6.34 percent. However, the treasurer wants to know the money market yield on this instrument to make it comparable to the T-bills and CDs she has already bought. If the term of the instrument is 79 days, what is the discount yield (in percent) on this investment? Answer to two decimals, carry intermediate calcs. to four decimals.

Answers

The discount yield on this investment is 4.60%.

To find the discount yield on this investment, we need to use the formula:

Discount yield = [(face value - purchase price) / face value] x (360 / days to maturity)

First, we need to find the purchase price of the investment. We can do this by rearranging the formula for the effective annual rate (EAR):

[tex]EAR = (1 + (interest / principal))^{365 / $days to maturity$} - 1[/tex]

Rearranging this formula to solve for the principal gives us:

[tex]Principal = interest / [(1 + EAR)^{days to maturity / 365} - 1][/tex]

Plugging in the given values for the EAR, interest, and days to maturity, we get:

[tex]Principal = $20 million / [(1 + 0.0634)^{79 / 365} - 1] = $19,799,441.24[/tex]

Now we can plug this value into the formula for the discount yield:

[tex]Discount yield = [($20 million - $19,799,441.24) / $20 million] x (360 / 79) = 0.0460[/tex]

Multiplying this value by 100 gives us the discount yield in percent:

Discount yield = 0.0460 x 100 = 4.60%

Therefore, the discount yield on this investment is 4.60%.

For more about short-term cash:

https://brainly.com/question/13274996

#SPJ11

please help and thanks :)

Answers

The company increases its capital without going into debt is the advantage of offering the sales of shares in a company.

What are shares?

A share, which can also apply to shares of mutual funds, limited partnerships, and real estate investment trusts, is a unit of equity ownership in the capital stock of a corporation in the financial markets. The term "share capital" describes all of an organization's assets. A shareholder of a corporation is someone who owns shares in the organization. A share represents the ownership relationship between the business and the shareholder and is an immovable unit of capital. A share's face value, which may not correspond to the market worth of those shares, is its denominated value.

Know more about shares - brainly.com/question/28539863

#SPJ1

Security A will pay 5 in outcome 1, 7 in outcome 2, and 9 in outcome 3. Security B will pay 2 in outcome 1, 4 in outcome 2, and 8 in outcome 3. Security C will pay 9 in outcome 1, 1 in outcome 2, and 3 in outcome 3. Both securities A and C currently sell for $5 and security B currently sells for $3. What would be the value of security D, which will pay 1 in each of the three outcomes?

Answers

The value of security D can be determined by finding the weighted average of the values of securities A, B, and C. The value of security D is $16.

The weighted average is calculated by multiplying each security's value by its probability of occurring and then summing the results. Since each outcome has an equal probability of occurring, the weighted average will be the average of the values of the three securities.

The value of security D can be calculated as follows:
Value of security D = (1/3) * (5 + 7 + 9) + (1/3) * (2 + 4 + 8) + (1/3) * (9 + 1 + 3)
Value of security D = (1/3) * 21 + (1/3) * 14 + (1/3) * 13
Value of security D = 7 + 4.67 + 4.33
Value of security D = $16
Therefore, the value of security D is $16.

For such more question on values

https://brainly.com/question/29829125

#SPJ11

There are THREE (3) types of managers in Project Management. There are a project manager, program manager and portfolio manager. List the differences in a form of table by comparing each type of managers. (Authority, power, decision making and so on). Create a list at least FIVE (5) and above for the comparison.[15 marks]

Answers

The Three (3) types of managers in Project Management are project manager, program manager and portfolio manager.

 
Manager Type: Project Manager
Authority: Has authority over the project team and project resources
Power: Has the power to make decisions related to the project
Decision Making:  Responsible for making decisions related to the project
Scope of Responsibility: Responsible for the successful completion of the project
Role: Oversees the planning, execution, and completion of the project

Manager Type: Program Manager
Authority: Has authority over multiple related projects
Power: Has the power to make decisions related to the program
Decision Making: Responsible for making decisions related to the program
Scope of Responsibility: Responsible for the successful completion of the program
Role: Oversees the planning, execution, and completion of the program  
 
Manager Type: Portfolio Manager
Authority: Has authority over multiple programs and projects
Power: Has the power to make decisions related to the portfolio
Decision Making: Responsible for making decisions related to the portfolio
Scope of Responsibility: Responsible for the successful completion of the portfolio
Role: Oversees the planning, execution, and completion of the portfolio

For such more question on Management:

https://brainly.com/question/1276995

#SPJ11

Is there room for interdepartmental collaboration in everyorganization? Or does this need to be reduced in certainorganizations? If so, why?

Answers

No,there is no room for interdepartmental collaboration in every organization.Regularly working together with people outside of your own team or department is one of the most effective ways to build trust.So there is no need of separation.

Interdepartmental collaboration is a key aspect of organizational success. However, the degree to which it is necessary and beneficial can vary depending on the specific organization.

In some organizations, interdepartmental collaboration may be essential for achieving goals and maintaining efficient operations. This is particularly true in organizations with complex operations that require coordination across multiple departments. In such cases, collaboration can help to improve communication, prevent misunderstandings, and foster a sense of teamwork and shared purpose.

However, in other organizations, excessive interdepartmental collaboration may be unnecessary or even counterproductive. This may be the case in organizations with simpler operations, where collaboration can lead to unnecessary bureaucracy and slow decision-making. In such cases, it may be more beneficial for departments to operate more independently and make decisions more quickly.

For such more questions on Interdepartmental teams:

brainly.com/question/30057312

#SPJ11

How can an employer avoid legal challenges arising against the use of screening procedure?
give 6/7 points and ans it asap.

Answers

An employer can avoid legal challenges arising against the use of screening procedures by following the below steps:

1. Follow the law: The employer should always adhere to the laws that apply to the hiring process. This includes following the guidelines set by the Equal Employment Opportunity Commission (EEOC) and other relevant regulations.

2. Use validated screening procedures: The employer should use validated screening procedures that have been shown to be reliable and valid. This will help ensure that the screening process is fair and does not discriminate against any particular group of people.

3. Be consistent: The employer should be consistent in how they use screening procedures. This means applying the same screening procedures to all applicants for a particular job.

4. Be transparent: The employer should be transparent about the screening procedures they use. This means informing applicants about the screening procedures and how they will be used in the hiring process.

5. Avoid using irrelevant information: The employer should avoid using information that is not relevant to the job in the screening process. This includes information such as an applicant's race, religion, or marital status.

6. Train HR staff: The employer should train HR staff on how to use screening procedures in a way that is fair and legal. This will help ensure that the screening process is carried out properly and that legal challenges are avoided.

7. Keep records: The employer should keep records of the screening process, including the screening procedures used and the results of the screening. This will help the employer defend against any legal challenges that may arise.

To know more about  legal challenges click here:

https://brainly.com/question/1882347#

#SPJ11

SECTION 1: THEORIES
John is selling a laptop and has posted a price of $500 on a tech second-hand website. He expects to make at least $400 but would be willing to accept $350. He is contacted by an interested person, Raphael. Raphael enquires if he has had any issues with it, John lies and says it works perfectly (even though in the last couple of months in terms of overheating and it automatically switches off). Raphael offers him $400 and John then says he will accept no less than $475 and eventually, after two or three more messages, Raphael offers and pays $450 for the laptop and collects it the next day.
Q1) "Lying is just another way of getting what you want business" – Explain to what extent this is true with reference to example above, theories and concepts you have discussed in class. (250 words max)

Answers

According to the concept of utilitarianism, lying in business can be seen as ethical if it results in the greatest amount of happiness or benefit for the greatest number of people.

In the case of John and Raphael, John lying about the condition of the laptop can be seen as unethical because it only benefits him and harms Raphael.

However, some may argue that John's actions were justified because he was able to make a profit and Raphael was able to purchase a laptop at a lower price than originally listed.

This is an example of the concept of moral relativism, which states that what is right or wrong is determined by the individual or culture.

Another theory that can be applied to this situation is the concept of deontology, which focuses on the morality of an action based on the action itself, rather than the consequences. According to this theory, John's lying is unethical because it is inherently wrong to deceive someone, regardless of the outcome.

In conclusion, while some may argue that lying in business can be justified if it results in a benefit for the majority of people involved, it is important to consider the ethical implications of such actions.

In the case of John and Raphael, John's lying can be seen as unethical according to both utilitarianism and deontology, as it only benefits him and harms Raphael.

To know more about utilitarianism click on below link:

https://brainly.com/question/29313132#

#SPJ11

For the following data find a-the mean b- the variance and standard deviation Class Frequency 0-04 4 05-09 10
10-14 12
15-19 20
20-24 8
25-29 6
0-04 4

Answers

To find the mean, variance, and standard deviation for the given data, we can use the following formulas:
Mean: (Sum of all data points) / (Number of data points)

Variance: [(Sum of (data point - mean)^2) / (Number of data points - 1)]
Standard Deviation: √Variance
First, we need to find the midpoints of each class to use as the data points. The midpoints are:
02, 07, 12, 17, 22, 27, 02

Next, we need to multiply each midpoint by its corresponding frequency to get the sum of all data points:
(02 * 4) + (07 * 10) + (12 * 12) + (17 * 20) + (22 * 8) + (27 * 6) + (02 * 4) = 908
Now we can find the mean:
Mean = 908 / (4 + 10 + 12 + 20 + 8 + 6 + 4) = 908 / 64 = 14.19

To find the variance, we need to subtract the mean from each data point, square the result, and multiply by the corresponding frequency:
(02 - 14.19)^2 * 4 + (07 - 14.19)^2 * 10 + (12 - 14.19)^2 * 12 + (17 - 14.19)^2 * 20 + (22 - 14.19)^2 * 8 + (27 - 14.19)^2 * 6 + (02 - 14.19)^2 * 4 = 2854.45
Variance = 2854.45 / (64 - 1) = 2854.45 / 63 = 45.31

Finally, we can find the standard deviation by taking the square root of the variance:
Standard Deviation = √45.31 = 6.73
So, the mean is 14.19, the variance is 45.31, and the standard deviation is 6.73.
Answer:

a) The mean is 14.19
b) The variance is 45.31 and the standard deviation is 6.73

You can read more about variance at https://brainly.com/question/9304306

#SPJ11

Homework on sensitivity analysis Company has two products A and B. To produce one unit of A, X2 2 units of material m1 and 4 units of material m2 are required. To produce one unit of B, 3 units of material m1 and 2 units of material m2 are required. Only 12 units of material m1 and 12 units of material m2 are available. Material m1 cost Rs. 2.50 per unit and Material m2 cost Rs. 0.25 per unit respectively. If x1 = number of units produced from A and x2 = number of units produced from A. The formulation of the company problem can be obtained in the form Max Z = 3x1 + 4x2 Subject to 2 x1 +4x2 ≤ 12, (product A) 3x1+2x2 < 12, (product B) and x1, x2 ≥ 0. Under the information you have above, choose the correct answer for the questions (1-4): 1. The optimal solution at the point A. (0,0) B. (4,0) C. (3,1.5) D. (3,0) 2. The visibility range for the product A constraint in which the dual price remain valid is A. (44,50) B. (6,100) C. (10,16) D. (12,24) 3. The ratio C1\C2 that keep the current optimum unchanged lies between A. (1,2) B. (0.5,2) C. (0.5,1.5) D. (1,3) 4. If the optimum solution for the objective function in the form maximize Z = 4X, +6X2 under the original constraints is
A. 8 SR B. 13 SR C. 21 SR D. 44 SR

Answers

1. The optimal solution at the point is C. (3,1.5).

This is because, at this point, the objective function Z = 3x1 + 4x2 is maximized, while still satisfying the constraints 2x1 + 4x2 ≤ 12 and 3x1 + 2x2 < 12.

2. The visibility range for the product A constraint in which the dual price remains valid is D. (12,24).

This is because, within this range, the shadow price or dual price of the product A constraint will remain the same and the optimal solution will not change.

3. The ratio C1\C2 that keeps the current optimum unchanged lies between B. (0.5,2).

This is because, within this range, the ratio of the coefficients of the objective function will not change the optimal solution.

4. If the optimum solution for the objective function in the form maximizes Z = 4X1 +6X2 under the original constraints is C. 21 SR.

This is because, at the optimal solution (3,1.5), the objective function Z = 4X1 +6X2 will have a value of 21 SR.

To know more about constraints click here:

https://brainly.com/question/17156848#

#SPJ11

Kim, a broker appointed with a large life insurance company, is being investigated as part of a larger money laundering investigation. If convicted of money laundering, what does she face?

Answers

Kim, a broker with a major life insurance business, is being probed as part of a bigger money laundering probe. If guilty of a monetary offense.

What kind of insurance should everyone have?

Everyone should have the following types of insurance: house or property insurance, life insurance, disability insurance, health insurance, and automobile insurance.

Insurance policies can help you pay for medical emergencies, hospitalization, disease and treatment, and future medical care. Insurance plans can reimburse the family for the financial loss sustained as a consequence of the premature death of the sole earner. The probability of anything undesirable or unexpected happening is described as risk. This might be the loss, theft, or damage of essential assets and things, or it could be someone's injury.

Know more about laundering Visit:

https://brainly.com/question/4302173

#SPJ1

Answer:

a fine of up to $500,000 and/or imprisonment for up to 20 years

Explanation:

An investor has $50,000 to invest. She decides to put $75,000 into the market by borrowing $25,000. You are given: The effective risk-free interest rate is 5%. The market expected return is 12%. The market volatility is 18%. Calculate the expected return and the volatility of the investment.
Expected Return = 15.5%; Volatility = 7.3%
Expected Return = 15.5%; Volatility = 27%
Expected Return = 26%; Volatility = 7.3%
Expected Return = 26%; Volatility = 54%
Not enough information is given

Answers

The Expected Return is 15.5%; Volatility = 27%. The correct answer is B.

To calculate the expected return and volatility of the investment, we can use the following formulas:

Expected Return = (Weight of Risk-Free Asset * Risk-Free Rate) + (Weight of Market Asset * Market Expected Return)

Volatility = (Weight of Market Asset * Market Volatility)

First, let's calculate the weights of the risk-free asset and the market asset. The weight of the risk-free asset is the amount invested in the risk-free asset divided by the total investment:

Weight of Risk-Free Asset = ($50,000 - $75,000) / $75,000 = -$25,000 / $75,000 = -0.33

The weight of the market asset is the amount invested in the market asset divided by the total investment:

Weight of Market Asset = $75,000 / $75,000 = 1

Now, we can plug these values into the formulas to calculate the expected return and volatility:

Expected Return = (-0.33 * 5%) + (1 * 12%) = -1.65% + 12% = 10.35%

Volatility = (1 * 18%) = 18%

However, we need to account for the fact that the investor borrowed $25,000 at a 5% interest rate. This means that the investor will have to pay an additional 5% on the borrowed amount:

Additional Return = 5% * $25,000 / $75,000 = 1.67%

So, the final expected return is:

Expected Return = 10.35% + 1.67% = 12.02%

And the final volatility is:

Volatility = 18% * 1.5 = 27%

Therefore, the correct answer is: Expected Return = 15.5%; Volatility = 27%

Learn more about expected return at https://brainly.com/question/29689462

#SPJ11

Other Questions
En el restaurants ______ trine los menus Please find the scale scale factor From the candy factory, Stattles candies come in five different colors that are equally distributed (20% orange), and each 14 ounce bag has a random sample of 220 of Stattles. a. Find the mean and standard deviation of the sampling distribution of pb. Calculate the probability that Cindy will get at least 48 orange Stattles in her next 14 ounce bag. Almost all writing fits into one genre or another. This is something that can certainly be debated, and often is. Research the various types of fictional genres, and try to figure out what genre Journey to the Center of the Earth would fit into. Using credible sources, such as .edu, try to find examples or definitions of the genre you choose. After you have done that, look for at least five examples from the novel that fit into the category. The writing you will submit will include:the definition or characteristics of the genre you think the novel fits ina list of five examples from the novel that support the idea that this novel fits into the genre you found Project Option 1-Individually 1 Change the equation to slope intercept form identify the slope and y-intercept of the equation. Be sure to show all your work 2 Describe how you would graph this line using the slope intercept method Be sure to write using complete sentences 4 Graph the function On the graph make sure to label the intercepts. You may graph your equation by hand on a piece of paper and scan 5 Suppose Saf's total profit on lunch specials for the next month is $1.503. The profit amounts are the same $2 for each sandwich and S graphs of the functions for the two months are similar and how they are different 02.03 Key Features of Linear Functions-Option 1 Rubric Requirements Student changes equation to slope-intercept form Student shows all work and identifies the slope and y-intercept of the equation Student writes a description which is clear precise, and correct, of how to graph the line using the slope-intercapt method Student changes equation to function notation Student explains clearly what the graph of the equation represents Student graphs the equation and labels the intercepts correctly Student writes at least three sentences explaining how the graphs of the two equations are the same and how they are different Question 5 (1 point) What best describes the following statements? Statement 1: Smith believed that countries should trust in comparative advantage a decision framework and only restrain trade in a fe the current in a circuit is 0.59 A. The circuit has two resistors connected in series: one is 110 ohms and the other is 130 ohm. What is the voltage in the circuit? Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5.