What causes the Pacific Ring of Fire to have so many volcanoes?

What Causes The Pacific Ring Of Fire To Have So Many Volcanoes?

Answers

Answer 1
The abundance of volcanoes and earthquakes along the Ring of Fire is caused by the amount of movement of tectonic plates in the area. Along much of the Ring of Fire, plates overlap at convergent boundaries called subduction zones. That is, the plate that is underneath is pushed down, or subducted, by the plate above. As rock is subducted, it melts and becomes magma. The abundance of magma so near to Earth’s surface gives rise to conditions ripe for volcanic activity. A significant exception is the border between the Pacific and North American Plates. This stretch of the Ring of Fire is a transform boundary, where plates move sideways past one another. This type of boundary generates a large number of earthquakes as tension in Earth’s crust builds up and is released.

So C would be your answer
Answer 2

Answer:

the answer is c

Explanation:


Related Questions

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

Which defensive adaptation would best help a plant survive in an environment with leaf-eating animals?

A.
large fruits

B.
thick stems

C.
sharp thorns

D. colorful flowers

Answers

Answer:

C.  sharp thorns

Explanation:

The plants stand still, are not very physically active, and seem to be on the menu of many animals. Precisely because they cannot win at the first sign of danger, one has developed other ways in which they can defend themselves from annoying and dangerous animals.

Some have developed long thorns that repel attackers. Some have poisons that are very strong and because of which animals do not think of trying to eat that plant, but the defense of some plants seems to be well thought out and ready for all forms of attack.

Question 2
In this part of the experiment, you’ll prepare and test three milk solutions: milk and water, milk and lactase enzyme, and milk and heated lactase enzyme.

Prepare

Use masking tape to label the three beakers: “milk,” “lactase solution,” and “heated lactase solution.”
Measure 60 milliliters of milk in the graduated cylinder (or ¼ cup of in a measuring cup. Pour it into the beaker labeled “milk.”
In the beaker labeled “lactase solution,” add one lactase tablet and 100 milliliters (or 1/2 cup) of cool or room-temperature water. Use the stirrer to dissolve the lactase tablet in the water.
Add 100 milliliters (or 1/2 cup) of milk to the microwaveable container. Dissolve a lactase pill in the container. Put the solution in the microwave and heat it to boiling (about 2 minutes). Use oven mitts to remove the container. Pour the heated lactase solution into the beaker labeled “heated lactase solution” and let it cool.
Stay safe! Be careful while handling the boiled mixture to avoid spilling it on your hands.

Test

While you’re waiting for the lactase solution to cool, read the directions on the test strips. The test strips in the Edmentum lab kit will react to glucose within a few seconds. If you use different strips, the reaction time may vary. Now follow these steps to test the solutions. Record your data in the answer space.

Milk and water solution: Fill the first test tube one fourth full of milk. Fill the small graduated cylinder with water and gently add it to the milk in the test tube until the test tube is half full. Use the stirrer to thoroughly mix the solution. Then insert the test strip for 10 to 20 seconds. Look at the test strip, and record whether it changed color. Wash the stirrer.
Milk and lactase enzyme solution: Fill the second test tube one fourth with milk and one fourth with the lactase solution. Use the stirrer to thoroughly mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color. Wash the stirrer.
Milk and heated lactase enzyme solution: Fill the third test tube with one fourth milk and one fourth of the heated lactase solution. Use the stirrer to mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color.
Note: Keep the lactase and heated lactase solutions for the next part of the experiment.

Wash the “milk” beaker, the test tubes, and the stirrer. If you used paper cups as an alternative, throw them away.

Answers

Answer:

The bacterium should stop production of lactase.

Explanation:

This is because the E. coli bacteria can degrade lactose, but lactose is not preferred as source of fuel or energy to glucose. If glucose is present, E. coli would preferably employ it over lactose as Glucose needs little process and minimal energy to degrade when compared to lactose. Although, if lactose is the major sugar that is present, the E. coli will have no option than to employ it as it's source of fuel or energy. The formation of lactase enzyme utilizes energy, which cannot be utilised in the presence of high level glucose.

This appears to be a set of instructions for a lab experiment involving testing different milk solutions with lactase enzyme.

What is lactase enzyme?

Lactase is an enzyme that breaks down lactose, a sugar found in milk and dairy products, into glucose and galactose. People who are lactose intolerant have insufficient levels of lactase, which can lead to symptoms such as bloating, gas, and diarrhea when they consume dairy products.

The experiment involves preparing three different solutions (milk and water, milk and lactase enzyme, and milk and heated lactase enzyme) and then testing each solution with a test strip to see if it changes color, indicating the presence of glucose.

The instructions also include safety precautions, such as being careful while handling the heated lactase solution. Finally, the instructions remind the reader to wash all equipment used in the experiment.

Some people may have lactose intolerance, which means that they do not produce enough lactase to break down lactose in their bodies, resulting in discomfort and digestive problems.

Learn more about Lactase at:

https://brainly.com/question/27612608

#SPJ3

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

1. Chantelle was given a sample of breakfast cereal to test for carbohydrates. (a) First, she decided to test the sample for glucose. Describe the test she should carry out and the results she might expect if glucose is present.

Answers

Answer:

The correct answer is - Benedict's solution for the test for glucose in food.

Explanation:

Benedict's solution is a test that is used to check if there is a presence of glucose in a food sample or not. It is possible due to the oxidation of the aldehyde present in the glucose turns to carboxylic acid in presence of the clear blue solution of sodium and copper salts or benedict's solution.

In presence of Benedict's solution the color of the sample turns yellow to orange with an increase in heat, however, the initial color of the solution is aqua blue.

Thus, the correct answer is - Benedict's solution for the test for glucose in food.

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Atoms in covalent bonds _____ their electrons.

Answers

um i think it’s share but i’m not sure

Answer:

share

Explanation:

covalent bonds share electrons

ionic bonds transfer electrons

Elevated fibrinogen levels result in a(n) ___________, which increases the risk of a coronary or cerbrovascular incident.

Answers

Answer:

hypercoagulable state

Explanation:

Elevated fibrinogen levels result in hypercoagulable state , which increases the risk of a coronary or cerbrovascular incident.

A hypercoagulable state in medicine refers to a condition in which there is an abnormal increase in the tendency toward the clotting of blood also known as blood coagulation.

When fibrinogen levels are high, there is an increase in clot stiffness, increase in resistance of the clot to fibrinolysis as well as an increased blood viscosity.

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Answer asap

In what stage are humans learning essential skills like hunting, cooking and animal identification

Adult

Childhood

Adolescence

Infancy

Answers

Answer:

Adolescence

Explanation:

Given that infancy, age is the age of little children from the point of birth to about four years

Hence, this cannot be an answer.

Childhood is wrong because the childhood age is the age of 2 to 13. At such a tender age, one cannot go hunting due to fear of wild animals or have the capacity to learn to cook different food

Adult is also not correct because Adult age lies between 21 to 40 when middle age comes by. At this stage, one is expected to have at least basic skills to survive.

Therefore the correct answer is Adolescence. This is the age of 10 to 19. It is the last stage before Adulthood where one has to hone his basic and surviving skills. At this point, it is believed one has full mental capacity.

Answer:

Its Childhood don't listen to the other guy

Explanation:

I just got it right on my quiz

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

Can anyone name all these parts of the microscope? please label each part with the number on the picture.

Answers

Answer:

Explanation:

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

Which fish species are the least tolerant of water pollution? Which fish species are most tolerant. how would you arrive at your conclusion?
Fishes used;
Bass
Carp
Gar
Catfish
Trout​

Answers

The fish that is less tolerant to water pollution is trout hope this helps :D

Hypothesis: If the type of the food available
changes, then the frequency of beak types will
change, because birds with beaks more suited
to the available food will be more successful
over time.
The data of this lab
the
hypothesis because there was a difference in bird
beak distribution
DONE

Answers

answer:

supported, when fruit was removed

explanation:

the data of this lab supported the hypothesis because there was a difference in bird beak distribution when fruit was removed

the second question:

which possible outcome below would not have supported the hypothesis?

answer:

if generation 3 had flock distributions similar to those shown in the graph below

Hypothesis has to do  with the explanation that can be applied to a particular situation.

What is a hypothesis?

The term hypothesis has to do  with the explanation that can be applied to a particular situation. The hypothesis is often based upon a close observation.

The data is not shown here. However, the data does confirm or disprove a hypothesis as the case may be.

Learn more about hypothesis: https://brainly.com/question/10103458?

#SPJ5

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

I NEED HELP ASAP!!!! BRAINLIEST AND 50 POINTS!!!! Cycles in nature involve the recycling of matter. Which of the following processes is a key part of the water (hydrological) cycle? a
transpiration
b
combustion
c
photosynthesis
d
decomposition

Answers

Cycles in nature involve the recycling of matter the following processes is a key part of the water (hydrological) cycle the photosynthesis.

What is the importance of water cycle?

The water cycle is a critical ecological procedure that continues the share of water in the earth's ecosystem and ecosystems. The water cycle entails the cyclic motion of water from water our bodies and groundwater into the ecosystem via plants, which play a position in this cycle through photosynthesis and transpiration.

Photosynthesis in concerned withinside the water cycle as it helps transpiration and makes use of water as a reactant.

Read more about the hydrological:

https://brainly.com/question/5187046

#SPJ1

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

2. A unique characteristic of the banyan tree is that roots grow down from its
branches into the ground. The tree can appear to have several trunks. What
advantage does this root characteristic give the banyan tree over other trees?
A. The roots provide shelter for ground-dwelling animals, which carry nutrients
to the tree.
B. The banyan can grow near the equator, because aboveground roots are
more protected from the sun.
C. The banyan can only grow in humid climates, because aboveground roots
are more likely to dry out and die during droughts.
D. The banyan can grow in areas prone to hurricanes and typhoons because
the roots make the tree more stable in high winds.

Answers

Answer:

D. The banyan can grow in areas prone to hurricanes and typhoons because

the roots make the tree more stable in high winds.

Explanation:

According to this question, banyan tree posseses a unique characteristic in which roots grow down from its branches into the ground making the tree appear to have several trunks. This type of root is called STILT OR PROP roots.

The major function of this stilt roots is to provide additional support for the plant during adverse conditions. Hence, a major advantage that this root characteristic give the banyan tree over other trees is that it confers resilience upon the banyan tree, making it able to grow in areas prone to hurricanes and typhoons because the roots make the tree more stable in high winds.

Other Questions
ASAP Which inequality is shown in the graph Subtract 8 from 5 times a number. The result is 4 less than 3 times the number. Whats the value of 2/3 * 1/8 Explain why ruminants, cecal fermenters, and monogastrics have such different abilities for digesting forages. Two persons (each on a skateboard) are initially standing still and facing each other before pushing off of each other. One person (50 kg) moves backwards at 1.1 m/s. Calculate the velocity of the second person (65 kg). The school cafeteria sold 283 slices of pizza and 66 apples what is the ratio of the number of slices of pizza sold to the number of apples sold? A.283:66 B.283:195 C.283:129D.283:261PLEASE HELPPPP I will give brainly try your hardest which protection guaranteed by the bill of rights allows the students to protest I showed her the house _____________. (clause) 323.23 which is the digit in the hundreds Find the value of A in the following expression x + x - 2Ax + A has remainder 8 when divided by x - 2 Analyze the map below and answer the question that follows.A map of New Zealand's North Island. An arrow points to a river that starts near Auckland, travels south, and ends in the middle of the island.Image courtesy of the CIA World FactbookWhich of the following rivers is shown on the map above?A.the Murray RiverB.the Darling RiverC.the Waikato RiverD.the Sunderland RiverPlease select the best answer from the choices providedABCD 1.In the early 1900s, Thomas Hunt Morgan was among the first scientists to contribute to the chromosome theory of heredity. Morgans investigations into heredity in fruit flies led him to propose that the event represented in the diagram sometimes occurs.Which statement about the event represented in the diagram is valid? Who were indentured servants?O A. People who had a contract to work in exchange for transportationOB. Slaves who came from only one of the Western EuropeanO c. People who were forcibly taken from their homes and sold asand expensescountriesslavesOD. People who were enslaved because of a court action against them The meteorologist says that it is hot outside. The weather characteristic being described is __________.A. air pressureB. humidityC. precipitationD. temperaturePlease select the best answer from the choices providedABCD Answer I know the answer Im just making sure if Im correct, thanks. Plug in -5 for every x. Find a current news article (within one week) related to business or technology. Your article can be from a newspaper, theInternet, or a magazine. You should then use the attached organizer to record information from your article.2. Using the information from your organizer, write a summary of your current event article. The summary should include: the article headline the name of the source of the article who the article is about what the article is about where the events take place and when the events take place 2-3 important events or information that help the audience understand whatyour article is about an explanation of why you chose the article please do not say you selected itbecause it was interesting. Instead address why the information is important,how you feel about it, what action you think should be taken, or what youwould do to solve the problem. **This is very important and should be atleast 3-4 sentences.3. Neatly complete the Current Events Report form. You may type your final report ifyou prefer.4. Staple your Current Events Report form and article together to be turned in.5. Be prepared to read your summary to the class and to answer any relevant questions.PART 1:Current Events Organizer(This does not need to be turned in. This is for planning purposes only)A good newspaper article always includes the 5 Ws. When writing your summary,be sure to include the following: Article Headline: ________________________________________________________ Name of your source; newspaper, website, magazine (underlined):___________________________________________________________________________ What is the article about?:____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ Where does it take place?: ________________________________________________ When does it take place?: _________________________________________________ Other important details:____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ Why did you choose this article? (Do not say, Because it was interesting.Instead, address why the information is important, how you feel about it, whataction you think should be taken, or what you would do to solve the problem.)**This is very important and should be at least 3-4 sentences.____________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________TURN IN PART 2: Name ______________________________ Date _________________________Current Events ReportArticle Title: _______________________________________________________________Source: ____________________________________________________________________Article Date: __________________________________News Type: World United States Local SportsWeather/Technology/Economy/PoliticsSummary:________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ Indirect characterization requires readers to _____what a character is like.A. inferB. retellC. explainD. question More than half of the population is engaged in agriculture in all of the following regions exceptA China. Western EuropeCIndiaAfricaDPlease select the best answer from the choices provided.A Britain passed many of their laws, or acts, before the revolution to What is the correct name for H3AsO3 Steam Workshop Downloader