Answer:
what
Explanation:
plz answer correctly. thank you.
Answer:
Mitosis and cytokinesis
Explanation:
Answer:
see below
Explanation:
1) A- Interphase and mitosis
2) Interphase
Organize these rock layer from youngest to oldest
Breccia
Conglomerate
Dolostone
Shale
From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale, and as per geology, the principle of superposition states that in a sequence of layered rocks, the youngest layer is on top and the oldest layer is at the bottom.
What are rock layers?Breccia is the youngest layer in the sequence. Breccia is a coarse-grained sedimentary rock made up of angular fragments of other rocks that have been cemented together. It is formed through a process called brecciation. Conglomerate is also a coarse-grained sedimentary rock, but unlike breccia, its fragments are rounded and well-worn, indicating that they have been transported over a distance by water or wind before being deposited and cemented, and dolostone is older than both breccia and conglomerate. Shale is the oldest layer in the sequence.
Hence, From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale.
Learn more about the rock layers here.
https://brainly.com/question/19598172
#SPJ2
when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?
Answer:
These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures
Explanation:
This happened through a lateral transfer of genes.
We can arrive at this answer because:
Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.
More information:
https://brainly.com/question/848637?referrer=searchResults
A change in pH has the greatest impact on which life proces
Answer:
Aquatic Organisms
If the pH of water is too high or too low, the aquatic organisms living within it will die. pH can also affect the solubility and toxicity of chemicals and heavy metals in the water ¹². The majority of aquatic creatures prefer a pH range of 6.5-9.0, though some can live in water with pH levels outside of this range.
Explanation:
Adding more OH- ions increases the pH, making the substance more basic. Increasing the pH will increase the number of OH- ions, so the equilibrium will shift to the left. Decreasing the pH will increase the number of H3 O+ ions; they'll ''use up'' the OH- ions, thus shifting the equilibrium to the right.
How does thermal energy impact the lower layers of atmosphere?
Answer:
Explanation:
Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere
what is the name of the tiny air sacs in your lungs?
Answer:
alveoli
Explanation:
list three ways that organisms use energy
Answer + Explanation:
Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.
I need help with this the 3 blanks where it says answer
Answer:
C will pair with G
then C will pair with G
write G and C
Explanation:
because Adanine(A) always pairs with thymine(T) and cytosine(C) with guanine(G) an easy way to remember this is by Apple Tree and Car Garage.
hope this helps :)
what hormones are responsible for inducing and regulating labor
why do multicellular organisms have emergent properties
Answer:
They have more genes than unicellular organisms.
Explanation:
They show properties that can only result from the interaction of many cells.
Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:
Answer:
y is there so much letters?
Glycogen is a complex carbon hydrates found in animals true or false?
Answer:
true
Explanation:
Explanation:
i think true i think please mark me brainlist thank you
what are the two major anatomical subdivisions of the nervous system?
Answer: The nervous system has two main parts:
The central nervous system is made up of the brain and spinal cord.
The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.
Explanation:
tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?
Answer:
Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.
Explanation:
help
Facilitated diffusion uses -----------------to help aid some substances across the cell membrane.
Facilitated diffusion uses transport proteins to help aid some substances across the cell membrane.
Facilitated diffusion is a passive transport process that enables the movement of specific molecules across the cell membrane with the assistance of transport proteins. While simple diffusion allows small, non-polar molecules to pass directly through the lipid bilayer of the cell membrane, facilitated diffusion comes into play when larger molecules or molecules with charges need to cross.
Transport proteins act as gateways or channels in the cell membrane. They are selective and only allow specific molecules to pass through. There are two main types of transport proteins involved in facilitated diffusion: channel proteins and carrier proteins.
Channel Proteins: These proteins form pores or channels in the cell membrane, allowing certain molecules, such as ions or water, to pass through. Channel proteins are highly specific and only allow certain substances to cross.
Carrier Proteins: These proteins undergo a change in shape to "carry" molecules across the membrane. When a specific molecule binds to the carrier protein, it triggers a change in the protein's shape that transports the molecule across the membrane. Once the molecule is released on the other side, the carrier protein returns to its original shape.
Facilitated diffusion is a crucial process for maintaining the balance of ions and molecules inside and outside the cell. It's important for the transport of nutrients, ions, and other essential molecules that may be too large or polar to diffuse directly through the lipid bilayer. The involvement of transport proteins ensures that only specific substances are transported, preventing unwanted molecules from entering or leaving the cell. Overall, facilitated diffusion is a highly regulated process that contributes to the homeostasis of the cell and the overall functioning of the organism.
To learn more about Facilitated diffusion, here
https://brainly.com/question/17132249
#SPJ3
I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology
Answer:
guess we were in the same boat I have
Explanation:
Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today
whats the answer ugh
Answer:
Phalanges: long bones
Sternum: flat bone
Vertebrae: Irregular bone
What does costal cartilage connect?
Answer:
a. Ribs to the sternum
Explanation:
Answer:
Ribs to the sternum
Explanation:
Give me an example of seedless vascular plants...
Mosses,Hornworts,Liverworts
Explanation:
Seedless vascular plants embrace ferns,Horsetails and club mosses.
Answer:
mosses,liverworts
Explanation:
where does pyruvate oxidation occur in eukaryotic cells
Answer:
mitochondrial matrix
Explanation:
Answer:
Pyruvate is produced during glycolysis in the cytoplasm, but pyruvate oxidation occurs in the mitochondrial matrix (in eukaryotes).
please give me crown thank you
Explanation:
in an otherwise normal cell, what happens if one mistake is made during dna replication?
Answer:
Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.
Explanation:
1. When “cleaning” a cadaver, what is removed to better see defined muscles?
When cleaning a cadaver, a professional will remove the fascia in order to better see defined muscles.
The fascia is a thin layer of connective tissue that wraps muscles. It is membraneous and extends throughout the entire body. Among the many functions of the fascia are:
Protectionisolation CompartmentalizationOf its functions, the last it's perhaps the most relevant to this question. It divided the muscles into groups. This is one of the main reasons that in order to see and properly study the muscles of a cadaver, the professional must remove the fascia.
To learn more visit:
https://brainly.com/question/262544?referrer=searchResults
Answer:
deep fascia
Explanation:
Which of the following elements is not a metalloid?
Answer:
gallium
Explanation:
Name given to the two new cells formed at the end of cell division.
Answer:
Diploid cells
Explanation:
The daughter cells from mitosis are called diploid cells. Diploid cells have two complete sets of chromosomes.
what is the transfer of energy in the form of electromagnetice waves
Answer: Electromagnetic radiation.
Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.
easy question - giving brainly if correct !!
Answer:
i think its C
Explanation:
i would go with c
_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules
Answer:
Chemosynthesis
Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.
that is the answer
Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.
What is photosynthesis?Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.
During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.
Learn more about photosynthesis, here:
https://brainly.com/question/29764662
#SPJ5
which muscle group relates best with the term midline?
The oblique is the muscle group that best relates with the term midline.
The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:
The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.
Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.
Learn more here: https://brainly.com/question/19486604
what are some reasons implicit stereotypes might differ from explicit stereotypes?
Answer:
Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.
Explanation:
Please rate, thank me, have a good day
Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.
What are stereotypes?A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.
Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.
Learn more about stereotypes, here:
https://brainly.com/question/2070574
#SPJ2
which muscle is used when giving your grandmother a kiss on the cheek?
Sternocleidomastoid
Explanation: