Umm soo I kinda need help with math

Umm Soo I Kinda Need Help With Math

Answers

Answer 1

Answer:

Option A.

Step-by-step explanation:

We are asked to add these 2 expressions.

First, we should know how to combine like terms.

What is combining like terms?

Combining like terms is adding 2 or more numbers, or variables that are alike.

[tex]-\frac{4}{5} t+\frac{5}{3} s \ + -3 - \frac{7}{5} s+2t=?[/tex]

Let's first begin by combining s and t. We can combine like terms for these two variables.

[tex]-\frac{4}{5} t + 2t = \frac{6}{5} t \ \checkmark[/tex]

[tex]\frac{5}{3} s \ + \frac{7}{5} s \\Which \ can \ also \ be \ represented \ as...\\\frac{25}{15} s \ - \frac{21}{15} s = \frac{4}{15} s \ \checkmark[/tex]

-3 doesn't have any like terms, meaning it'll stay as -3.

[tex]\frac{6}{5} t + \frac{4}{15} s - 3[/tex]

Therefore, our answers matches with Option A.


Related Questions

Please answer with full solutions and only answer if you know!

Answers

Answer:

  a)  even

  b)  4th differences: -72

  c)  minimum: 0, maximum: 4. This function has 0 real zeros.

  d)  -1377

  e)  -288

Step-by-step explanation:

You want to know a number of the characteristics of the function f(x) = -3x⁴ +6x² -10:

whether even or oddwhich finite differences are constantnumber of zerosAROC on [2, 7]IROC at x=3

a) Even/Odd

A function is even if f(x) = f(-x). The graph of an even function is symmetrical about the y-axis. An even polynomial function will only have terms of even degree.

The exponents of the terms of f(x) are 4, 2, 0. These are all even, so we can conclude the function is an even function.

We can also evaluate f(-x):

  f(-x) = -3(-x)⁴ +6(-x)² -10 = -3x⁴ +6x² -10 ≡ f(x) . . . . . the function is even

b) Finite differences

We can look at values of x on either side of x=0. The attachment shows function values and finite differences for x = -3, -2, ..., +3.

The fourth finite differences are constant at -72. (We expect this value to be -3·4!, the leading coefficient times the degree of the polynomial, factorial.)

c) Number of zeros

A 4th-degree polynomial will always have exactly four zeros. They may be complex, rather than real. Complex zeros will come in conjugate pairs, so the number of real zeros may be 0, 2, or 4; a minimum of 0 and a maximum of 4.

This polynomial function has no real zeros. The four complex zeros are approximately ...

  ±1.18864247 ±0.64255033i

d) AROC on [2, 7]

The average rate of change on the interval [a, b] is given by ...

  AROC = (f(b) -f(a))/(b -a)

For [a, b] = [2, 7], this is ...

  AROC = (((-3(7²) +6)7² -10) -((-3(2²) +6)2² -10)/(7 -2)

  = ((-147 +6)(49) -(-12 +6)(4)) / 5 = (-6909 +24)/5 = -6885/5 = -1377

The average rate of change on [2, 7] is = -1377.

e) IROC at x=3

The derivative of the function is ...

  f'(x) = -3(4x³) +6(2x) = 12x(-x² +1)

  f'(3) = 12·3(-3² +1) = 36(-8) = -288

The instantaneous rate of change at x=3 is -288.

A researcher found that for the years 2013 to 2019, the equation,
y=-0.4(x-3)2 +42) models the average gas mileage of new vehicles sold in
Switzerland, where is the number of years since 2013 and is the average gas
mileage, in miles per gallon (mpg).
During what year was the average gas mileage for new vehicles sold in Switzerland
the greatest?

Answers

Using equation of parabola in vertex form the year in which the average gas mileage for new vehicles sold in Switzerland the greatest is 2016.

What is the equation of a parabola in vertex form?

The equation of a parabola with vertex (h, k) is given by

y = a(x - h)² + k

Now a researcher found that for the years 2013 to 2019, the equation, y = -0.4(x - 3)² + 42 models the average gas mileage of new vehicles sold in Switzerland, where is the number of years since 2013 and is the average gas mileage, in miles per gallon (mpg).

To determine during what year was the average gas mileage for new vehicles sold in Switzerland the greatest, we notice that the equation is the equation of a parabola in vertex form where (h, k) is the vertex.

Comparing y = a(x - h)² + k with y = -0.4(x - 3)² + 42 we have that

a = -0.4, h = 3 and k = 42

So, the vertex is at (h, k) = (3, 42)

Since a = -0.4 < 0, (3,42) is a maximum point

So, y is maximum when x = 3

Since this is 3 years after 2013 which is 2013 + 3 = 2016.

So, the year in which the average gas mileage for new vehicles sold in Switzerland the greatest is 2016.

Learn more about equation of a parabola in vertex form here:

https://brainly.com/question/30593645

#SPJ1

The figure is shown composed of a rectangle and a hexagon. The length of each side of the hexagon is 2 cm determine the area of the shaded region.

Answers

The answer of the given question based on the rectangle and a hexagon , the area of the shaded region is approximately 10.51 cm².

What is Area?

Area is  measure of  size of  two-dimensional surface or shape, like  a square, circle, or triangle. It is typically expressed in square units, like square meters (m²) or square feet (ft²).

To find the area of the shaded region in the figure, we need to find the area of the rectangle and the area of the hexagon, and then subtract the area of the hexagon from the area of the rectangle.

The rectangle has a length of 8 cm and a width of 2 cm, so its area is:

A(rectangle) = length x width = 8 cm x 2 cm = 16 cm²

The hexagon has a side length of 2 cm, so we can divide it into 6 equilateral triangles with side length 2 cm. Each of the  triangles has  area of an;

A(triangle) = (sqrt(3)/4) x side² = (sqrt(3)/4) x 2² = (2sqrt(3))/4 = sqrt(3)/2

The area of the hexagon is therefore:

A(hexagon) = 6 x A(triangle) = 6 x sqrt(3)/2 = 3sqrt(3)

A(shaded) = A(rectangle) - A(hexagon) = 16 cm² - 3sqrt(3) cm² ≈ 10.51 cm²

Therefore, the area of the shaded region is approximately 10.51 cm².

To know more about Equilateral triangle visit:

https://brainly.com/question/2456591

#SPJ1

math help someone pls answer 7thgrade math question

Answers

Answer:

128

Step-by-step explanation:

Answer: 128

Step-by-step explanation:

Remember the order of operations in this problem:

8² x (2 + 6) / 4

8² x (8) / 4

64 X 8 /4

512 / 4

= 128

Hope this helps!

In the inequality 3>2,if you mulutiply boyh sides by a positive number do you have to reverse the direction of the inequity sign

Answers

Multiplying or dividing both sides by a positive number leaves the inequality symbol unchanged.

The inequality symbols and > are defined in this pamphlet, along with examples of how to work with expressions containing them.

The following guidelines should be followed when changing or rearranging statements that involve inequalities:

Rule 1: An inequality symbol remains unchanged when the same amount is added to or subtracted from both sides.

Rule 2: Adding or subtracting a positive number from both sides does not change the inequality symbol.

Rule 3: Reversing the inequality by multiplying or dividing both sides by a negative number. It follows that  changes to > and vice versa.

Learn more about inequality at:

brainly.com/question/28823603

#SPJ4

Question 2. A water tank has the shape of an inverted circular cone with base radius2mand height.4m. If water is being pumped into the tank at a rate of2 m3/min, find the rate at which the water level is rising when the water is3mdeep. (Volume of cone,V=31​πr2h) Question 3. A street light is mounted at the top of a15fttall pole. A man6fttall walks away from the ole with a speed of5ft/secalong a straight path. How fast is the tip of his shadow moving when he is oft from the pole. (Hint: Use properties of similar triangles)

Answers

The rate at which the water level is rising when the water is 3m deep is 0.159 m/min.  The rate at which the tip of his shadow is moving when he is 40ft from the pole is 3ft/sec. The volume of a cone is given by V = 1/3πr^2h.

We are given that the base radius is 2m and the height is 4m. We are also given that the rate at which water is being pumped into the tank is 2 m^3/min. We need to find the rate at which the water level is rising when the water is 3m deep.

To find the rate at which the water level is rising, we need to take the derivative of the volume with respect to time. This gives us:

dV/dt = (1/3)π(2r)(dr/dt)(4) + (1/3)π(2^2)(dh/dt)

We know that dV/dt = 2 and r = 2, so we can plug these values into the equation and solve for dh/dt:

2 = (1/3)π(2)(2)(dr/dt)(4) + (1/3)π(2^2)(dh/dt)

Solving for dh/dt gives us:

dh/dt = (6 - 4π(dr/dt))/(4π)

We are given that the water level is 3m deep, so we can plug this value into the equation for the volume of a cone and solve for r:

V = (1/3)πr^2h

3 = (1/3)πr^2(3)

r = √(3/π)

We can now plug this value of r into the equation for dh/dt and solve for dr/dt:

dh/dt = (6 - 4π(√(3/π))(dr/dt))/(4π)

Solving for dr/dt gives us:

dr/dt = (6 - 4π(dh/dt))/(4π√(3/π))

We can now plug this value of dr/dt back into the equation for dh/dt and solve for dh/dt:

dh/dt = (6 - 4π((6 - 4π(dh/dt))/(4π√(3/π))))/(4π)

Solving for dh/dt gives us:

dh/dt = 0.159 m/min

The street light is mounted at the top of a 15ft tall pole and the man is 6ft tall. The man is walking away from the pole with a speed of 5ft/sec along a straight path. We need to find the rate at which the tip of his shadow is moving when he is 40ft from the pole.

We can use the properties of similar triangles to relate the height of the pole, the height of the man, the distance of the man from the pole, and the length of the shadow. Let x be the distance of the man from the pole and y be the length of the shadow. Then we have:

15/x = 6/(x + y)

Cross-multiplying gives us:

15(x + y) = 6x

Simplifying gives us:

9x = 15y

Taking the derivative of both sides with respect to time gives us:

9(dx/dt) = 15(dy/dt)

We are given that dx/dt = 5ft/sec, so we can plug this value into the equation and solve for dy/dt:

9(5) = 15(dy/dt)

Solving for dy/dt gives us:

dy/dt = 3ft/sec

To learn more about cone here:

https://brainly.com/question/28109167#

#SPJ11

Write an equation
perpendicular to y =
2/5x+ 4 with a
y-intercept of -3

Answers

Answer:

y = (-5/2)x - 3

Step-by-step explanation:

To find an equation of a line that is perpendicular to the given line and passes through the point (0, -3), we need to use the fact that perpendicular lines have opposite reciprocal slopes.

The given line has a slope of 2/5, so the slope of the line perpendicular to it is:

-1 / (2/5) = -5/2

This means that the equation of the perpendicular line has the form:

y = (-5/2)x + b

where b is the y-intercept we want to find.

Since the line passes through the point (0, -3), we can substitute these values into the equation and solve for b:

-3 = (-5/2)(0) + b

b = -3

Therefore, the equation of the line perpendicular to y = 2/5x + 4 with a y-intercept of -3 is:

y = (-5/2)x - 3

solve the quadratic inequality. write the final answer using interval notation x^(2 )-2x-35>0

Answers

The  interval notation  of x^(2 )-2x-35>0  is (-∞,-5)∪(7,∞).

To solve the quadratic inequality x^(2)-2x-35>0, we first need to find the roots of the quadratic equation x^(2)-2x-35=0. We can do this by factoring the equation:

(x-7)(x+5)=0

The roots of the equation are x=7 and x=-5. Now, we can use these roots to determine the intervals where the inequality is true. We can do this by testing values in each interval:

- For x<-5, let's test x=-6: (-6)^(2)-2(-6)-35=1>0, so the inequality is true in this interval.
- For -57, let's test x=8: (8)^(2)-2(8)-35=29>0, so the inequality is true in this interval.

To know more about interval notation click on below link:

https://brainly.com/question/29531272#

#SPJ11

a. Simplify the polynomial expressions and write in standard form. b. Classify by degree and number of terms. 1. \( a^{3}\left(a^{2}+a+1\right) \) 2. \( \left(3 x^{2}-4 x+3\right)-(4 x-10) \) a. i b.

Answers

polynomial expression of degree 2 with 3 terms.

a. i. \( a^{3}\left(a^{2}+a+1\right) = a^{5}+a^{4}+a^{3} \)


ii. \( \left(3 x^{2}-4 x+3\right)-(4 x-10) = 3 x^{2}-7 x-7 \)


b. i. \( a^{5}+a^{4}+a^{3} \) is a polynomial expression of degree 5 with 3 terms.


ii. \( 3 x^{2}-7 x-7 \) is a polynomial expression of degree 2 with 3 terms.

Learn more about polynomial expression

brainly.com/question/30842300

#SPJ11

1. Find the center of mass of the solid bounded by x = y 2 and the planes x = z, z = 0, and x = 1 if the density is rho(x, y, z) = k ∈ R is constant
2. The electric charge distributes over the disk x 2 + y 2 ≤ 1 such that the charge density at any point (x, y) is rho(x, y) = x + y + x 2 + y 2 (in coulombs per square meter). Find the total charge Q on the disk.
3. Find the center of mass of the triangular region with vertices (0, 0), (2, 0) and (0, 2) if the density is given by rho(x, y) = 1 + x + 2y

Answers

1) The center of mass of the solid bounded by x = y^2 and the planes x = z, z = 0, and x = 1  the center of mass of the solid is (1/3, 2/15, 1/3). 2) The total charge on the disk is 4/3 coulombs. 3) The center of mass of the triangular region is (2/3, 2/3).


Center of Mass = (∫xyzρdV)/(∫ρdV).

Here, V is the volume of the solid. Since the density is constant, we can pull it out of the integral:

Center of Mass = k*(∫xyzdV)/(∫dV).

We can now use the volume formula for the solid which is V = ∫xyzdxdyz. Plugging this in the above formula, we get:

Center of Mass = k*[(∫x∫ydxdyz)/(∫dxdyz)]

Evaluating the integrals, we get the x coordinate of the center of mass to be (1/3), the y coordinate to be (2/15) and the z coordinate to be (1/3). Thus, the center of mass of the solid is (1/3, 2/15, 1/3).

2. To find the total charge Q on the disk x^2 + y^2 ≤ 1 such that the charge density at any point (x, y) is rho(x, y) = x + y + x^2 + y^2 (in coulombs per square meter), we need to use the following formula:

Q = ∫∫rho(x, y)dxdy

Evaluating the integral, we get Q = (1/3) + (1/3) + (1/3) + (1/3) = 4/3. Thus, the total charge on the disk is 4/3 coulombs.

3. To find the center of mass of the triangular region with vertices (0, 0), (2, 0) and (0, 2) if the density is given by rho(x, y) = 1 + x + 2y, we need to use the following formula:

Center of Mass = (∫xyρdA)/(∫ρdA).

Here, A is the area of the triangle. Evaluating the integral, we get the x coordinate of the center of mass to be (2/3) and the y coordinate to be (2/3). Thus, the center of mass of the triangular region is (2/3, 2/3).

To learn more about  Center of Mass here:

https://brainly.com/question/17088562#

#SPJ11

Find three consecutive integers such that the third integer is equal to twice the first increased by five.

Answers

Answer:

Let's call the first of the three consecutive integers "x".

According to the problem, the third integer (which is the one after the first two) is equal to twice the first increased by five. We can express this algebraically as:

third integer = 2x + 5

Since the three integers are consecutive, the second integer must be one more than the first, and the third must be one more than the second. So, the second integer can be expressed as:

second integer = x + 1

And the third integer is:

third integer = (x + 1) + 1 = x + 2

Now we can set these two expressions for the third integer equal to each other, since they both represent the same value:

2x + 5 = x + 2

Simplifying and solving for x, we get:

x = -3

So the first of the three consecutive integers is -3. The second is one more than the first, which is -3 + 1 = -2. And the third is one more than the second, which is -2 + 1 = -1. Therefore, the three consecutive integers are -3, -2, and -1.

find the remainder when the polynomial 7x^4 -3x is divided by x-1

Answers

The remainder when 7x⁴ - 3x is divided by x - 1 is 4.

Describe Pοlynοmial?  

knοwn as indeterminates) and cοefficients, which are cοmbined using the οperatiοns οf additiοn, subtractiοn, and multiplicatiοn. A pοlynοmial can have οne οr mοre variables, but each term in the pοlynοmial must have nοn-negative integer expοnents οn the variables. The degree οf a pοlynοmial is the highest pοwer οf its variables with a nοn-zerο cοefficient.

Fοr example, the pοlynοmial 3x² - 2x + 5 has a degree οf 2, with the term 3x² being the highest degree term. The cοefficient οf the term 3x^2 is 3, and the cοefficient οf the term -2x is -2.

Pοlynοmials are used in a variety οf mathematical applicatiοns, including algebra, calculus, and geοmetry. They are used tο represent mathematical functiοns, tο apprοximate cοmplex curves, and tο sοlve equatiοns. Sοme cοmmοn οperatiοns οn pοlynοmials include additiοn, subtractiοn, multiplicatiοn, divisiοn, and factοring.

Tο find the remainder when the pοlynοmial 7x⁴ - 3x is divided by x - 1, we can use pοlynοmial lοng divisiοn οr synthetic divisiοn.

7x³ + 7x² + 7x + 4

x - 1 | 7x⁴ + 0x³ - 3x² + 0x + 0

     - (7x⁴ - 7x³)

           7x³ - 3x²

           - (7x³ - 7x²)

                 4x² + 0x

                 - (4x² - 4x)

                        4x

                        - (4x - 4)

                             4

Therefore, the remainder when 7x⁴ - 3x is divided by x - 1 is 4.

To know more about division visit:

brainly.com/question/29631184

#SPJ9

A mortgage loan of $250,000 for 30 years has an annual interest rate of 3% applied mortily What is the monthly mortgage payment?

Answers

The monthly mortgage payment for a 30-year mortgage loan of $250,000 with an annual interest rate of 3% is about $1,054.63.

What is monthly mortgage payment?

A monthly mortgage payment is the amount of money paid each month to repay a mortgage loan. The payment is typically made up of principal the amount borrowed and interest the cost of borrowing the money and may also include additional amounts for taxes and insurance.

We can use the formula for the monthly mortgage payment, which is:

M = P * r * (1 + r)^n / ((1 + r)^n - 1)

Where

M is the monthly mortgage paymentP is the principal (loan amount)r is the monthly interest rate (annual interest rate divided by 12)n is the total number of monthly payments (30 years * 12 months per year = 360)

First, we need to convert the annual interest rate to a monthly interest rate:

r = 3% / 12 = 0.0025

Next, we can plug in the values:

M = 250000 * 0.0025 * (1 + 0.0025)^360 / ((1 + 0.0025)^360 - 1)

We can simplify this expression and find that the monthly mortgage payment is approximately $1,054.63.

Therefore, the monthly mortgage payment for a 30-year mortgage loan of $250,000 with an annual interest rate of 3% is about $1,054.63.

Learn more about monthly mortgage payment here : brainly.com/question/28146849

#SPJ1

help please!!!!!!!!!!!!!

Answers

Answer:

Step-by-step explanation:

A line that is parallel to the first line will have the same slope, so:

m = -3

X1 and y1 are basically the coordinates where the new line intersects, which is x1 = -1, and y1 = 6

Point-slope form:

y - 6 = -3(x - (-1))

y-6 = -3(x+1)

Slope-intercept form:

y - 6 = -3x - 3

y = -3x + 3

Hope this helps!

Answer:

Step-by-step explanation:

(-1,6) + (-3x + 4) = (-4x,10). I don't know if this is really correct but that's all that I really know how and what to do, so I hope I at least kind of helped a little bit.

I need help from a baddie

Answers

Answer:

on what?

Step-by-step explanation:

How do you get rid of an inner bully?

5 Ways to Stop that Inner Bully

Become aware of what you are saying to yourself. ...

Replace this with mindful attention to your feelings. ...

Realize you are not alone in your suffering. ...

Use soothing self-talk. ...

Access Your Wise Mind.

#19 F.1
Match each function on the left with the ordered pairs on the right.
y = -8x + 2
y = -4x + 2.
y = 7x + 7.
y = -7x 5.
-
• (-4, 23)
(-9, 74)
(2,-6)
• (9, 70)

Answers

The correct match of each ordered pair with each function is:

(-9, 74) for y = -8x + 2

(2,-6) for y = -4x + 2

(9, 70) for y = 7x + 7

(-4, 23) for y = -7x - 5

How to Match a Function with its Ordered Pair?

To match each function with the correct ordered pair, we need to substitute the x-values from the ordered pairs into each function and see which one gives the corresponding y-value.

Substitute the x value of (-9, 74) into y = -8x + 2:

y = -8(-9) + 2

y = 74

Substitute the x value of (2,-6) into y = -4x + 2:

y = -4(2) + 2

y = -6

Substitute the x value of (9, 70) into y = 7x + 7:

y = 7(9) + 7

y = 70

Substitute the x value of (-4, 23) into y = -7x - 5:

y = -7(-4) - 5

y = 23

Therefore, the correct matching is:

(-9, 74) for y = -8x + 2

(2,-6) for y = -4x + 2

(9, 70) for y = 7x + 7

(-4, 23) for y = -7x - 5

Learn more about the order pair of a function on:

https://brainly.com/question/24880873

#SPJ1

Use a calculator to approximate the measure of the acute angle A to the nearest tenth of a degree. sin A = 0.9659

a. 60.3 Degrees
b. 56 Degrees
c. 75 Degrees
d. 55.5 Degrees

Answers

Answer:

OPTION C

Step-by-step explanation:

There are 3 sides in a triangle. 2 of them are legs, and one of them is the Hypotenuse. "Sin" refers to Opposite/Hypotenuse.

To find A given a sine value, we must use inverse sin. I would suggest using desmos for this, but you need to switch to degrees in the online caluclator.

So the Equation is: [tex]sin^{-1} (0.9659)[/tex]

After plugging that into desmos, we get 74.994 degrees. Because that is not one of the answer, I'm assuming we must round our answer to the nearest whole number. In that case, your answer is 75 degrees, or OPTION C

Jeremiah and his brother are having a competition to see how many vegetables they can eat in a week. Jeremiah’s mom is rewarding the brothers for their efforts: at the end of the week, she’s going to give them an amount of prize money that is 4 times the sum of the number of vegetables they each eat. By the end of the week, Jeremiah had eaten 15 servings of vegetables. His mom paid him and his brother $100 Who ate more vegetables, Jeremiah or his brother? By how many?

Answers

Answer:

Jeremiah ate more, by 5 servings more

Step-by-step explanation:

$100 is 4 x number of vegetable servings

100/4 = 25 number of total servings

If Jeremiah ate 15 servings, his brother ate 25-15 =10

Servings Jeremiah 15, brother 10

FIND THE GREATEST COMON FACTOR AND THE LEAST COMON MULTIPLE FOR 12,18,24

Answers

Answer: LCM is 72. GCF is 6.

1. Solve the system of equations using addition
and/or subtraction with multiplication method.
Select the best answer with the format (x, y).
6x + 4y = 12
-6x+6y=-72
O (6, -6)
O (13, 1)
O (3,5)
(12, 12)
no solution
infinite solutions

Answers

The value of (x,y) is ( 6, -6) (optionA)

What is Simultaneous equation?

Simultaneous equations are two or more algebraic equations that share variables e.g. x and y . They are called simultaneous equations because the equations are solved at the same time. For example, below are some simultaneous equations: 2x + 4y = 14, 4x − 4y = 4. 6a + b = 18, 4a + b = 14.

6x+4y = 12 equation 1

-6x +6y = -72 equation 2

add equation 1 and 2

10y = - 60

y = -60/10

y = -6

substitute -6 for y in equation 1

6x +4(-6) = 12

6x -24 = 12

6x = 12+24

6x = 36

x = 36/6 = 6

therefore the value of (x,y) = ( 6, -6)

learn more about Simultaneous equation from

https://brainly.com/question/148035

#SPJ1

need help finding side length. asap pls

Answers

The missing side in the triangle has a length of 9.899.

What is the property of an isosceles triangle?

In an isosceles triangle, the two sides are equal and the angles opposite to the two equal sides are also equal.

In the figure, ∠RQS = ∠RSQ =45°

Thus, it is an isosceles triangle with sides RQ=RS= 7

What is Pythagoras' theorem?

According to Pythagoras' theorem for a right-angled triangle:

Base² + Height²= Hypotensuse²

In the given figure: Base = 7 and Height = 7,

Thus, QS²= RQ² + RS²

          QS² = 7² + 7²

           QS = √98

                 =9.899    

Learn more about Pythagoras' theorem here:

https://brainly.com/question/343682

#SPJ1

Which measurements could represent the side lengths in feet of a right triangle?

14 ft, 14 ft, 14 ft

10 ft, 24 ft, 26 ft

3 ft, 3 ft, 18 ft

2 ft, 3 ft, 5 ft

Answers

Option 4: 2 feet, 3 feet, and 5 feet – constitutes a right angle since 2² + 3² = 4 + 9 = 13 and 13 = 5², making it.

What is a Class 7 triangle?

A triangle is a geometry with three vertices and three sides. The internal angle of the triangle, which really is 180 degrees, is built. The inner triangle angles are implied to sum to 180 degrees. It has the fewest sides of any polygon.

The Pythagorean theorem states that the square of a hypotenuse's length (the side exact reverse the right angle) in a right triangle is the product of a squares of the durations of the remaining two sides. Only the last option—2 feet, 3 feet, and 5 feet—can represent the second derivative of a right triangle because it satisfies this requirement.

Let's check each option:

Option 1: 14 feet, 14 feet, 14 feet - As all three are equal, this doesn't qualify as a right triangle and the Pythagoras theorem cannot be met.

Option 2: 10 feet, 24 feet, and 26 feet - Because 10² + 24² = 100 + 576 = 676, which is equivalent to 26², this is a right triangle. The fact that this option is a multiple of the well-known Polynomial triple (3, 4, and 5) implies that we can scale all of the corresponding sides by a common factor to produce an infinite number of right triangles with all these side lengths. As a result, this option doesn't really represent an original right triangle.

Option 3: 3 ft, 3 ft, 18 ft - This does not constitute a right triangle because the cube of the hypotenuse's length (18² = 324) does not equal the total of the squares of a shorter side (3² + 3² = 18).

To know more about Triangle visit:

https://brainly.com/question/17335144

#SPJ1

Answer:

2 feet, 3 feet, and 5 feet

Step-by-step explanation:

got it right on my test

the volume of a cylinder is 1078 cm3 and it's height 7cm find the radius of the base​

Answers

Answer:

r=7

Step-by-step explanation:

Cylinder Area

= πr² x h

1078 = 22/7 x r² x 7

1078/22 = r²

49=r²

r=7

Hey, guys-is this a function? Can you also please explain why with your answer? Thank you for your help, been a long day.

Answers

Yes, the graph represents a function.

What is a function?

A relation is a function if it has only One y-value for each x-value.

The given ordered pairs from the given graph are (-7, 3), (-3, -3), (0,1), (2, 4), (3, -1), (5, -6)

The given graph represents a relation.

Since each value of x has unique y value.

So the given graph represents a function.

Hence, yes the graph represents a function.

To learn more on Functions click:

https://brainly.com/question/21145944

#SPJ1

The net of a square pyramid is shown below: Net of a square pyramid showing 4 triangles and the square base. The square base has side lengths of 2 inches. The height of each triangle attached to the square is 3 inches. The base of the triangle is the side of the square. What is the surface area of the solid? (5 points) 16 square inches 24 square inches 28 square inches 32 square inches

Answers

4(3)(2)/2 + 2² = 12 + 4 = 16

Need to know what matches with what and showing how you got the answer. Thanks.

Answers

Answer:

1-B
2-E

3-D

4-A

5-C

Step-by-step explanation:

-4x + 3y = 3

3y = 4y + 3

y = 4/3 y + 1 => slope is 4/3, y-intercept is (0,1)

Equation 1 matches with Letter B

12x - 4y = 8

4y = 12x - 8

y = 3x - 2 => slope is 3, y-intercept is (0,-2)

Equation 2 matches with Letter E

8x + 2y = 16

2y = -8x + 16

y = -4x + 8 => slope is -4, y-intercept is (0,8)

Equation 3 matches with Letter D

-x + 1/3 y = 1/3

1/3 y = x + 1/3

y = 3x + 1 => slope is 3, y-intercept is (0,1)

Equation 4 matches with Letter A

-4x + 3y = -6

3y = 4x = -6

y = 4/3 x - 2 => slope is 4/3, y-intercept is (0,-2)

Equation 5 matches with Letter C

⭐ Please consider brainliest! ⭐

The answers to you questions are—
1=b
2=e
3=d
4=a
5=c

Nationally, about 11% of the total U.S. wheat crop is destroyed each year by hail.† An insurance company is studying wheat hail damage claims in a county in Colorado. A random sample of 16 claims in the county reported the percentage of their wheat lost to hail.
17 7 11 9 10 20 13 13
8 8 23 21 11 9 10 3
The sample mean is x = 12.1%. Let x be a random variable that represents the percentage of wheat crop in that county lost to hail. Assume that x has a normal distribution and σ = 5.0%. Do these data indicate that the percentage of wheat crop lost to hail in that county is different (either way) from the national mean of 11%? Use α = 0.01.

Answers

The answer is no, these data do not indicate that the percentage of wheat crop lost to hail in that county is different (either way) from the national mean of 11%.

The sample mean is x = 12.1% and the population mean is μ = 11%. We want to test if there is a significant difference between the sample mean and the population mean. We can use a t-test to compare the means.

The null hypothesis is H0: μ = 11%, and the alternative hypothesis is Ha: μ ≠ 11%.

The t-statistic is calculated as:

t = (x - μ) / (σ / √n)

where x is the sample mean, μ is the population mean, σ is the standard deviation, and n is the sample size.

Plugging in the values, we get:

t = (12.1 - 11) / (5.0 / √16)
t = 1.1 / (5.0 / 4)
t = 0.88

Using a t-table with degrees of freedom (df) = 16 - 1 = 15 and α = 0.01, we find the critical value to be 2.947. Since the absolute value of the t-statistic (0.88) is less than the critical value (2.947), we fail to reject the null hypothesis. This means that there is not enough evidence to suggest that the percentage of wheat crop lost to hail in that county is different from the national mean of 11%.

Therefore, the answer is no, these data do not indicate that the percentage of wheat crop lost to hail in that county is different (either way) from the national mean of 11%.

Know more about mean here:

https://brainly.com/question/30112112

#SPJ11

Knowledge Check Questior Write an equation in slope-intercept form for the line with slope (2)/(3) and y-intercept -6.

Answers

The equation in slope-intercept form for the line with slope (2)/(3) and y-intercept -6 is:

y = (2) / (3)x - 6.

The equation in slope-intercept form for a line is y = mx + b, where m is the slope and b are the y-intercept. Since the slope is (2)/(3) and the y-intercept is -6, we can substitute these values into the equation to get:

y = (2)/(3)x + (-6)

Simplifying this equation gives us:

y = (2)/(3)x - 6

For more such questions on Slope, visit:

brainly.com/question/3605446

#SPJ11

please answer this fast ​

Answers

Answer:

p^(2(s-t)^2)/(s+t)

Step-by-step explanation:

We can simplify this expression by using the properties of exponents:

((p^r)/(p^s))^(r+s) ((p^2)/(p^t))^(s+t) ((p^t)/(p^r))^(r+t)

= (p^(r+s-s))^r (p^(2s-2t))^s (p^(t-r+r))^t / (p^(r+s-r))^r (p^(2t-2s))^s (p^(r-t+t))^t

= p^r p^(2s-2t)s p^t / p^r p^(2t-2s)s p^t

= p^r / p^r * (p^(2s-2t))^(s/(s+t)) / (p^(2t-2s))^(s/(s+t))

= p^r / p^r * p^((2s-2t)s/(s+t)) / p^((2t-2s)s/(s+t))

= p^0 * p^(2s^2-2st-2ts+2t^2)/(s+t)

= p^(2s^2-2st-2ts+2t^2)/(s+t)

= p^(2(s-t)^2)/(s+t)

Therefore, ((p^r)/(p^s))^(r+s) ((p^2)/(p^t))^(s+t) ((p^t)/(p^r))^(r+t) simplifies to p^(2(s-t)^2)/(s+t).

Solve the compound linear inequality gr to the nearest tenth whenever appropria 1.4<=9.2-0.8x<=6.9

Answers

The solution to the compound linear inequality 1.4 ≤ 9.2 - 0.8x ≤ 6.9 are the values of x in the interval [2.9, 9.8].

To solve the compound linear inequality, we need to isolate the variable on one side of the inequality. We can do this by following the same steps as we would when solving a regular equation, but remembering to flip the inequality sign if we multiply or divide by a negative number.

1.4 ≤ 9.2 - 0.8x ≤ 6.9

First, we'll subtract 9.2 from all sides of the inequality:

-7.8 ≤ -0.8x ≤ -2.3

Next, we'll divide all sides by -0.8 to isolate the variable. Remember to flip the inequality signs since we're dividing by a negative number:

9.75 ≥ x ≥ 2.875

Finally, we'll write the solution to the nearest tenth in interval notation:

[2.9, 9.8]

So, the solution to the compound linear inequality are all values of x, which is greater than or equal to 2.9 but less than or equal to 9.8, or x is in the interval [2.9, 9.8].

Learn more about compound linear inequality here: https://brainly.com/question/29195276.

#SPJ11

Other Questions
Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers?