Two sides of a triangle have lengths of 120 cm and 95 cm.
Which could NOT be the length of the third side?
A. 25 cm
B. 70 cm
C. 95 cm
D. 210 cm
IM GIVING BRAINLIEST

Answers

Answer 1

Answer: the answer is D = 210cm


Related Questions

Please help! I need answers for both questions it’s very confusing!

Answers

Answer:

for number 5 its:

-15 -8 8/9 -3.3

and for number 6 its:

-3.3 -8 8/9 and -15

also sorry if its wrong

When it seems the negative number get bigger, they’re actually getting smaller. For example -13 is greater than -20. Plus, the absolute value would always be positive.


The answer to number 1 would be:

-15 < -8 8/9 < -3.3


The answer to number 2 would be:


15 < -3.3 < -8 8/9



I hope this helped, and have an awesome day! <3

Which of the following would not be a line in solving the equation:
7x-8-5x = 52
12x = 60
12x = 44
12x - 8 = 52
x = 5

Answers

Answer:

Step-by-step explanation:

Let's actually solve the equation.  By doing so we should readily see which of the given equatins are not part of the solution.

7x - 8 - 5x = 52 becomes 2x - 8 = 52 if we consolidate the x terms.  Next, we consolidate the constant terms on the right, obtaining 2x = 60.

Then x = 30 is the solution.

12x = 60 would not be part of the solution.

12x = 44 would not either.

12x - 8 = 52 would not either.

x = 5 would not be part of the solution.

Again:  The solution is x = 30.

plzzzzz help i really need it guys thxxxxxxxx!

Answers

Answer:

11. m=-1/4 b=5 equation is y=-1/4x+5

12.m=4/3 b=0 equation is y=4/3x

Step-by-step explanation:

Suppose that a family has an equally likely chance of having a cat or a dog. If they have two pets, they could have 1 dog and 1 cat, they could have 2 dogs, or they could have 2 cats.

What is the theoretical probability that the family has two dogs or two cats?
Describe how to use two different coins to simulate which two pets the family has.
Flip both coins 50 times and record your data in a table like the one below.

Result Frequency
Heads, Heads
Heads, Tails
Tails, Heads
Tails, Tails
Total 50
Based on your data, what is the experimental probability that the family has two dogs or two cats?
If the family has three pets, what is the theoretical probability that they have three dogs or three cats?
How could you change the simulation to generate data for three pets?

Answers

The theoretical probability that the family has two dogs or two cats is 1/3.

(branliest will be appreciated)

Are you an equation because you are driving me crazy...

Answers

Sheeeeeeeeeeeeeeeeesh, whats the snap???

Step-by-step explanation:

it's been 2 hours and no one answered my question what the heck

Answers

Answer:

Ask it again and more people will have a chance to see it

Step-by-step explanation:

HELP ME don't put a link i will report you <3
only answer the box that is yellow

Answers

Answer:

Step-by-step explanation:

Answer:

the answer is 9

because 8 8/9 is first

1 plus 8 8/9 is 9

Question of
Two sides of a trangle have the following measures 7, 10 Find the range of possible measures for the third side.

Answers

Answer:

3 < x < 17

Step-by-step explanation:

Given 2 sides of a triangle then the third side x is in the range

difference of 2 sides < x < sum of 2 sides , that is

10 - 7 < x < 10 + 7

3 < x < 17

The Smiths spend 8% of their budget on entertainment. Their total budget this year is $2,000 more than last year, and this year they plan to spend $3,920 on entertainment. What was their total budget last year?

Answers

Answer:

4.8

Step-by-step explanation:

Joel has a 41 in board leaning up against a wall the board hits the wall 40 inch above the ground how far from the wall is the base of the board.​

Answers

Answer:

9

Step-by-step explanation:

41^2 - 40^2 = 81

The square root of 81 is 9. I hope this helps.

Which inequality is true?

Helpp due now

Answers

Answer:

b is true

Step-by-step explanation:

i hope this helps :)

name the solid figure formed by the net

Answers

Answer:

A

Step-by-step explanation:

I'm not exactly sure what this question is asking? This is all information that is given. I don't really need an answer and I could just figure out the rest from there-

Answers

Answer:

i think it wants you to find how mnay cubits the pyramid is- but like how are you supposed to do that with the info given hdjbfsd sorry shawty i would ask a teacher on this one :(

Step-by-step explanation:

Find the volume of the cube in inches 3^ below. Then select the correct units
when entering your answer.

4 in.
4 in.
4 in.

Answers

The answer should be 64 in^3

hope this helps!

Brittany bought 3 bracelets and 2 necklaces for $21. Each bracelet cost $5. The necklaces were all the same price. What is the cost for 1 necklace?

Answers

Answer:

The cost for 1 necklace is $3.

Step-by-step explanation:

With the information provided, you can say that the amount spent in bracelets and necklaces is equal to the price per bracelet for the number of bracelets plus the price per necklace for the number of necklaces, which is:

c=3x+2y, where:

c is the total cost

x is the price per bracelet

y is the price per necklace

Now, you can say that c=21 and x=5 and solve for y to find the price per necklace:

21=(3*5)+2y

21=15+2y

21-15=2y

6=2y

y=6/2

y=3

According to this, the answer is that the cost for 1 necklace is $3.

Debby used a garden hose to fill up a 4-gallon bucket in just 1/6 of a minute. At what rate does water flow through the hose?​

Answers

Answer:

24 gallons

Step-by-step explanation:

write 19/41 in lowest forms

Answers

Answer:

19/41

Step-by-step explanation:

this fraction cannot be simplified since 19 is a prime number.

jane leaves her bicycle at 8:00 AM, traveling at an average speed of 15mph. her brother frank leaves home in his car at 10:30 AM, traveling the same route as Jane at an average speed of 40 mph. at what time will they meet? i will give brainliest

Answers

Answer: 11:00

Step-by-step explanation:

Answer: 11:00

Step-by-step explanation:

Each quadrilateral below is a parallelogram . find the missing measures .

Answers

Answer:

AD = 8

DC = 15

m∠A = 112°

m∠B = 68°

m∠C = °

Step-by-step explanation:

If we're working with parallelograms, we can assume that each line and it's opposite are perfectly parallel.

To find AD, all you need to do is look to the opposite line, BC. Since This is a parallelogram, AD = BC, so AD is 8.

To find DC, you do the exact same. Find the opposite line that it is parallel to, in this case that's AB, and since AB = DC, you know that DC = 15.

To find m∠A, let's look at m∠D. Since m∠D = is 68°, We can use that knowledge to find m∠A. Since the two angles are right beside each other on the same line, together they would equal 180° if you added them up. But since you don't know what m∠A is, you just have to subtract 68 from 180.

180 - 68 = 112.

To find m∠B, We simply look back to m∠D. Since m∠B is directly opposite to m∠D, That means they have the same value, 68°.

And finally, to find m∠C, we do the same thing we did to find m∠B. m∠C is directly across from m∠A - we have already found m∠A, and we know that it is 112°. Therefore, m∠C is 112° as well.

PLEASE HELP

Is th function shown a linear function?

EXPLAIN PLZZ

NO LINK​

Answers

It doesn’t curve or bend so yes this is a linear function.

A triangular pyramid has a volume of 48 in3. The base edge is 9 in and the base height is 4 in. Find the height of the pyramid.

Answers

Answer:

8 in

Step-by-step explanation:

First of all we have to find the area of the base triangle.

For do this we can use this formula:

A = (base edge x base height)/2

A = (9 x 4)/2 = 18 in^2

The formula for find the volume of a pyramid is:

V= Base area x height)/3

So the height can be find in this way

3 x  V = base area x height

height = (3 x V)/base area

height = (3 x 48)/18 = 8 in

Answer:

pretty sure it is 8in I think

Please please I beg you

Answers

Answer:

2x+2

hope it helped:))))))))

Answer:

2x + 2

Step-by-step explanation:

f(x) + g(x)

= 9 - 3x + 5x - 7 ← collect like terms

= 2x + 2

un refresco tiene una concentración de 3.8 x 10-4 de iones H+. determina el valor de PH de ese refresco​

Answers

Answer:

El pH del refresco es 3.42.

Step-by-step explanation:

Se puede calcular el pH del refresco usando la siguiente fórmula:

[tex]pH = -log([H^{+}])[/tex]

En donde:

[H⁺]: es la cocentración de los iones H⁺ de la solución

Entonces, el pH es:

[tex]pH = -log([H^{+}]) = -log(3.8\cdot 10^{-4}) = 3.42[/tex]

El resutlado obtenido nos permite concluir que ese refresco es ácido.

Por lo tanto, el pH del refresco es 3.42.

Espero que te sea de utilidad!

Usando su fórmula, se encuentra que el valor de PH de ese refresco​ es dado por 3.42.

Cual es la fórmula para el valor de PH?

Es dada por:

[tex]pH = -\log{H^{+}}[/tex]

Onde [tex]H^+[/tex] es la concentración.

En este problema, hay que la concentración es de [tex]H^+ = 3.8 \times 10^{-4}[/tex], por eso:

[tex]pH = -\log{H^{+}}[/tex]

[tex]pH = -\log{3.8 \times 10^{-4}}[/tex]

[tex]pH = 3.42[/tex]

El valor de PH de ese refresco​ es dado por 3.42.

Puede-se aprender mas sobre el valor de PH en https://brainly.com/question/16146414

I need the Answers to this giving brainliest to the person who does not send me a unknown link and actually does the work

Answers

which question do you need to be answered? do you want all of them?

Answer: Look below!

Step-by-step explanation:You can use the Calc below in the pictures

1. √2/2

2. -√2/2

Proof it works!

Need help ASAP please help

Answers

It is B because we wanna find what line goes over the dots better.

What is the solution to this system of linear equations?

Answers

Answer: To solve a system of linear equations graphically we graph both equations in the same coordinate system. The solution to the system will be in the point where the two lines intersect. The two lines intersect in (-3, -4) which is the solution to this system of equations.

Step-by-step explanation: hope this helps

9=7+a
a+8=b+5
what is b​

Answers

Answer:

b=5

Step-by-step explanation:

9=7+a

-7

2=a

a+8=b+5

10=b+5

-5

5=b or b=5

A rectangular tank with length 50 cm and width 30 cm contains 36 litres of water. Find the depth of the water.

Answers

Answer:

24cm

Step-by-step explanation:

Given data

Length=50cm

Width= 30cm

Volume = 36liters

=36000cm^3

We know that the expression for volume is

V= L*W*H

substitute

36000=50*30*H

36000= 1500*H

H= 36000/1500

H= 24cm

Hence the height is 24cm

Can someone please help me with math.

Answers

11 is c
14 is d
19 is c

Click an item in the list or group of pictures at the bottom of the problem and, holding the button down, drag it into the correct position in the answer box. Release your mouse button when the item is place. If you change your mind, drag the item to the trashcan. Click the trashcan to clear all your answers.
Indicate the equation of the given line in standard form.

The line that contains the point Q( 1, -2) and is parallel to the line whose equation is

y - 4 = 2/3 (x - 3)

Answers

Answer:

The equation of the line is;

3y = 2x-8

Step-by-step explanation:

Firstly, we need the to get the slope of the given line

To do this, we will write the equation of the line in the standard form

the standard form

is;

y = mx + b

where m is the slope and b is the y-intercept

y -4 = 2/3(x-3)

y -4 = 2x/3 - 2

y = 2x/3 -2 + 4

y = 2x/3 + 2

with respect to the given equation, the slope of the line is 2/3

Mathematically, when two lines are parallel, the slopes of the line are equal

So now, we want to find the equation of the line that has a slope of 2/3 and passes through the point (1,-2)

so;

y = 2x/3 + b

So substitute the values of (1,-2)

1 for x and -2 for y

-2 = 2/3(1) + b

-2 = 2/3 + b

b = -2 - 2/3

b = (-6-2)/3 = -8/3

So the equation of that line is;

y = 2/3x - 8/3

Multiply through by 3

3y = 2x - 8

Other Questions
giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased 5. The following are energy releasing phase changes EXCEPTA. Condensation B. Freezing C. Deposition D. Sublimation Can someone help please what are some quotes that show romeo's actions/attitudes in romeo and juliet?i need 5 in total, please help In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine need help please12(4 + 8) + 12 Will mark brainliestCould you help me right this in my own words?The Metropolitan Museum of Art was established in 1870 by a group of American citizensbusinessmen and financiers as well as leading artists and thinkers of the daywho wanted to create a museum to bring art and education to the American people. On this day, in 1870, the museum was officially organized and soon after acquired its first work of art: a Roman sarcophagus. Anju had 3 (3 / 4) cup of sugar . She used 1 (2 / 3 )cup of sugar to bake a cake . How mush sugar does anju have lift ? Ashley needs to drive 17 miles to work. So far, she has driven 7.2 miles. How many more miles must she drive?