To the nearest tenth of a mile per hour, what is the pontoon's average speed in still water?

Responses

A.4.0 miles per hour


B.5.0 miles per hour



C.5.2 miles per hour



D.5.7 miles per hour

Answers

Answer 1

Answer:

Step-by-step explanation:

We can use the formula:

average speed = (speed downstream + speed upstream) / 2

We are given the speed downstream is 8 miles per hour and the speed upstream is 2 miles per hour. Therefore,

average speed = (8 + 2) / 2 = 5 miles per hour

So the answer is (B) 5.0 miles per hour to the nearest tenth.

Answer 2
The answer is b 5.0 miles per hour

Related Questions

Bob's Gift Shop sold 550 cards for Mother's Day. One salesman, Arun, sold 2% of the cards sold for Mother's Day. How many cards did Arun sell?

Answers

Answer:

55 cards

Step-by-step explanation:

Suppose a company has fixed costs of $49,400 and variable cost per unit of
4
9
x + 222 dollars,
where x is the total number of units produced. Suppose further that the selling price of its product is
2148 −
5
9
x dollars per unit.
(a) Find the break-even points. (Enter your answers as a comma-separated list.)
x =



(b) Find the maximum revenue. (Round your answer to the nearest cent.)
$

(c) Form the profit function P(x) from the cost and revenue functions.



Find maximum profit.
$

(d) What price will maximize the profit? (Round your answer to the nearest cent.)
$

Answers

(a) The break-even points are approximately 1,581 and 2,809 units produced.

(b)  The maximum revenue is approximately $2,088,931.47.

(c) P(x) = -5/9x² + 919x - 49,400

(d) The price that will maximize the profit is approximately $1,829.17 per unit.

What is the algebraic equations?

An algebraic expression is when we use numbers and words in solving a particular mathematical question.

(a) To find the break-even points, we need to find the values of x at which the total revenue equals the total cost. The total revenue is the product of the selling price and the number of units sold, while the total cost is the sum of the fixed cost and the variable cost per unit multiplied by the number of units sold. Thus, we have:

Total revenue = Selling price × Number of units sold = (2148 - 5/9x)x

Total cost = Fixed cost + Variable cost per unit × Number of units sold = 49,400 + (49x/9 + 222)x

Setting the total revenue equal to the total cost, we get:

2148x - 5/9x² = 49,400 + (49x/9 + 222)x

Multiplying both sides by 9, we get:

19332x - 5x² = 445,110

Simplifying, we get:

5x²- 19332x + 445,110 = 0

Using the quadratic formula, we get:

x = (19332 ± sqrt(19332² - 4(5)(445,110))) / (2(5))

x ≈ 2808.6 or x ≈ 1581.4

Hence, the break-even points are approximately 1,581 and 2,809 units produced.

(b) The revenue function is given by:

R(x) = (2148 - 5/9x)x

To find the maximum revenue, we can take the derivative of the revenue function with respect to x, set it equal to zero, and solve for x:

R'(x) = 2148 - 10/9x = 0

x = 19332/10 ≈ 1933.2

Substituting this value of x into the revenue function, we get:

R(1933.2) ≈ $2,088,931.47

Hence, the maximum revenue is approximately $2,088,931.47.

(c) The profit function P(x) is given by:

P(x) = R(x) - C(x) = (2148 - 5/9x)x - (49,400 + (49x/9 + 222)x)

Simplifying, we get:

P(x) = -5/9x² + 919x - 49,400

(d) To find the maximum profit, we can take the derivative of the profit function with respect to x, set it equal to zero, and solve for x:

P'(x) = -10/9x + 919 = 0

x = 8265

Substituting this value of x into the profit function, we get:

P(8265) ≈ $1,077,927.78

Therefore, the maximum profit is approximately $1,077,927.78.

To find the price that will maximize the profit, we need to substitute the value of x into the selling price function:

Selling price = 2148 - 5/9x = 2148 - 5/9(8265) ≈ $1,829.17

Hence, the price that will maximize the profit is approximately $1,829.17 per unit.

To learn more about algebraic equations, Visit

https://brainly.com/question/4344214

#SPJ1

In cricket, one over consists of 6 balls being bowled. Determine the number of overs bowled if 120 balls are bowled. it form (2)​

Answers

Based on the proportionate ratios of 1:6, the number of overs bowled if 120 balls are bowled is 20.

What is proportion?

Proportion describes two ratios equated to each other.

Proportional values are like fractional values and can be depicted in percentages or fractions.

The ratio of one over and balls bowled = 1:6

This implies that for every 6 balls being bowled, one goes over.

Proportionately, for 120 balls bowled, the number of overs will be = 20 (120/6 x 1)

Thus, if one over consists of 6 balls being bowled, proportionately, the number of overs bowled if 120 balls are bowled is 20.

Learn more about proportions at https://brainly.com/question/1496357.

#SPJ1

Which shows the function y=3x+12 in factored form and identifies the zero of the function?

Answers

The function y=3x+12 in factored form is (3x+12) and the zero of the function is -4.

What is a linear function?

A linear function is a polynomial of degree 1, or a mathematical expression that describes a relation between two variables. It is often written in the form y = mx + b, where m is the slope, x is the independent variable, and b is the y-intercept.

The factored form of a linear equation is the same as the standard form of the equation, with the exception that the coefficients of the variables are each expressed as a product of their prime factors. In the case of y=3x+12, the factored form is (3x+12). The zero of the function (also known as the root of the equation) is the value of the variable that will result in a value of 0 for the equation. To find the zero of the function, we need to set the equation equal to 0 and solve for the value of x. When we set y=0, we get 3x+12=0, which can be solved to get x=-4. Therefore, the zero of the function is -4.

The function y=3x+12 in factored form is (3x+12) and the zero of the function is -4.

For more questions related to polynomial,

https://brainly.com/question/11536910

#SPJ1

What is the mathematical expression for twice a number by k?

Answers

Answer: less then

Step-by-step explanation: Less than means subtraction, whereas more than means addition. · Saying twice a number means that you are multiplying that number by 2.

QUESTION 9
Consider the following argument: If Sarah-Beth applies a post-colonial reading to the required text, Sara-Beth impresses
her professor and earns an A for the class. Sarah-Beth impresses her professor and earns an A for the class. So, Sarah-
Beth applies a post-colonial reading to the required text. This argument is
a. valid
b. invalid
O c. true
d. false
O e. None of the above

Answers

b.invalid i know trust

write the slope intercept form of the equation of the line described.


through: (5, 0) perp to y= -5/3x

Answers

The slope-intercept form of the equation of the line through (5, 0) and perpendicular to y = -5/3x is y = 3/5x - 3.

What is the slope-intercept form of a linear equation, and how can we determine the equation of a line perpendicular to another line?

The slope-intercept form of a linear equation is y = mx + b, where m is the slope and b is the y-intercept. This form is useful for graphing lines and solving problems involving linear relationships.

To determine the equation of a line perpendicular to another line, we use the fact that the slopes of perpendicular lines are negative reciprocals of each other. In other words, if the slope of one line is m, then the slope of a line perpendicular to it is -1/m.

Calculate the slope-intercept form:

We are given that the line we are looking for passes through the point (5, 0) and is perpendicular to the line y = -5/3x. To find the equation of the line, we need to determine its slope and y-intercept.

The slope of the given line is -5/3, so the slope of the line perpendicular to it is:

-1/(-5/3) = 3/5

Therefore, the slope of the line we are looking for is 3/5.

Next, we can use the point-slope form of the equation of a line to find the equation of the line:

y - y1 = m(x - x1)

where m is the slope and (x1, y1) is a point on the line. We can substitute m = 3/5 and (x1, y1) = (5, 0) to get:

y - 0 = 3/5(x - 5)

Simplifying this equation, we get:

y = 3/5x - 3

which is the slope-intercept form of the equation of the line we were looking for.

Therefore, the slope-intercept form of the equation of the line through (5, 0) and perpendicular to y = -5/3x is y = 3/5x - 3.

To know more about slope intercept form of straight line visit:

brainly.com/question/29146348

#SPJ9

The length of a radius of a circle, measured in feet, is represented by the expression z + 3.6. The diameter of the circle is 11 4/5 ft.

What is the value of z?

Enter your answer as a decimal or mixed number in simplest form in the box.

Answers

Answer:

Step-by-step explanation:

The diameter of the circle is twice the length of the radius, so we can write:

2r = d

where r is the radius and d is the diameter.

Substituting the given diameter of 11 4/5 ft, we get:

2r = 11 4/5 ft

To find the length of the radius, we can divide both sides by 2:

r = (11 4/5) / 2

r = 5 9/10 ft

We also know that the length of the radius is z + 3.6, so we can set up the equation:

z + 3.6 = 5 9/10

Subtracting 3.6 from both sides, we get:

z = 5 9/10 - 3.6

z = 2 3/10

Therefore, the value of z is 2 3/10 or 2.3 as a decimal.

Answer: The correct answer is 2.3

Step-by-step explanation: Answer confirmed correct on test so no worries

An architect designs a rectangular flower garden such that the width is exactly two-thirds of the length. If 320 ft of antique picket fencing are to be used to enclose the garden for the length and width of the garden.

Answers

Answer:

The length of the garden would be 480 ft and the width would be 320 ft.

Step-by-step explanation:

A survey of 520 adults aged 18-24 year olds was conducted in which they were asked what they did last Friday night. It found:

172 watched TV
156 ate pizza
38 watched TV and ate pizza, but did not hang out with friends
36 watched TV and hung out with friends, but did not eat pizza
40 hung out with friends and ate pizza, but did not watch TV
38 watched TV, hung out with friends, and ate pizza
63 did not do any of these three activities
How may 18-24 year olds (of these three activities) only hung out with friends last Friday night?

Your Answer:

Answers

To find out how many 18-24 year olds only hung out with friends last Friday night, we need to subtract the number of people who engaged in other combinations of activities from the total number of people surveyed:

Total surveyed = 520

Watched TV only = 172 - 38 - 36 - 38 = 60

Ate pizza only = 156 - 38 - 36 - 40 = 42

Watched TV and ate pizza = 38

Did not do any of these three activities = 63

Therefore, the number of 18-24 year olds who only hung out with friends last Friday night can be calculated as follows:

Only hung out with friends = Total surveyed - (Watched TV only + Ate pizza only + Watched TV and ate pizza + Did not do any of these three activities)

Only hung out with friends = 520 - (60 + 42 + 38 + 63)

Only hung out with friends = 217

Therefore, 217 out of the 520 18-24 year olds surveyed only hung out with friends last Friday night.

find the measure of gpy​

Answers

The value of ∠ GPY, given the angle measures on the figure, can be found to be 118 °

How to find the angle ?

The angles ∠ GPY and ∠ KPR are congruent, which means that they are the same.

The angle ∠ GPY can therefore be found by equating both angles to themselves:

8 p + 94 = 5 p + 103

Collect like terms ;

8 p - 5 p = 103 - 94

3 p = 9

p = 9 / 3

p = 3

The value of ∠ GPY is therefore :

= 5 ( 3 ) + 103

= 15 + 103

= 118 °

Find out more on angles at https://brainly.com/question/25716982

#SPJ1

15 POINTS

Identify the zeros in the given graph

{-3,-1,4,1}

{-3,-1,1}

{-3,-4,1}

{-3,1}

Answers

Answer:

-3, 1

Step-by-step explanation:

these are points where the curve cuts the x-axis

at this point the value of y=0

HELP ASAP NO ROCKY
-
-
-
-
NO LINKS

Answers

Answer:

A. the graph of the function does not form a straight line.

Step-by-step explanation:

What is the total cost of a $713 tablet computer that is on sale at 11% off if the local sales tax rate is 7%?
The total cost of the tablet is S
(Round to two decimal places as needed.)

Answers

The total cost of the tablet is $684.48

How to calculate the total cost of the tablet?

The first step is to write out the parameters given in the question

The cost of the tablet computer is $713

The tablet computer is on sale at 11%

Next is to multiply the total cost by the sales percent

11/100 × 713

= 0.11 × 713

= 78.43

= 713 - 78.43

= 634.57

The local sales tax rate is 7%

= 7/100 × 713

= 0.07 × 713

= 49.91

The total cost can be calculated as follows

= 49.91 + 634.57

= 684.48

Hence the total cost of the tablet is $684.48

Read more on cost here

https://brainly.com/question/29060376

#SPJ1

There are 5 positive integers with the mean +5, the median = 5, and the mode = 8. What is the range of this data?

Answers

In response to the query, we have that So, depending on the precise equation choice of five positive numbers, the data range might be 5, 6, or 7.

What is equation?

In a math equation, two assertions are connected by the equals sign (=), which denotes equivalence. A mathematical assertion used in algebraic equations establishes the equivalence of two mathematical statements. For instance, in the equation 3x + 5 = 14, the equal sign creates a space between the values 3x + 5 and 14. To comprehend the relationship between the two sentences written on opposing sides of a letter, utilise a mathematical formula. The logo and the specific programme typically correspond. An illustration would be 2x - 4 = 2.

The five positive integers will be denoted as a, b, c, d, and e.

We know that c must equal 5, since the median is 5.

The three integers we now have add up to 15 (a + b + c = 15).

We may write the equation as follows since the mean is 5:

(a + b + c + d + e)/5 = 5

a + b + 18 = 25

a + b = 7

a = 1, b = 6, c = 5, d = 8, e = 8

a = 2, b = 5, c = 5, d = 8, e = 8

a = 3, b = 4, c = 5, d = 8, e = 8

Range = 8 - 1 = 7

Range = 8 - 2 = 6

Range = 8 - 3 = 5

So, depending on the precise choice of five positive numbers, the data range might be 5, 6, or 7.

To know more about equation visit:

https://brainly.com/question/649785

#SPJ1

Your teacher has requested that two rows of strips be placed around the entire room what is the total length of strips that is required

Answers

The Length of wooden strip based on the information is 106 cm.

How to calculate the length

The perimeter of a shape is simply the total length of the boundary that the shape has. It should be noted that in this case, it's gotten by adding all the length that the shape has.

Length of wooden strip = Perimeter of a rectangular table.

= 2(Length+Breadth)

= 2(32+21)

= 2(53)

= 106 cm

Length of wooden strip is 106 cm.

Learn more about perimeter on:

https://brainly.com/question/19819849

#SPJ1

What is the length of the wooden strip required to frame a photograph of length and breadth 32 cm and 21 cm respectively?

MTH 115 Lesson 8 Practice Problems
Answer Key


1. A credit card charges 23% APR and a minimum of 2.5%. If you pay the minimum on a balance of $450 what would the decrease in your balance be? Round to the nearest cent $2.63.


2. A month has 30 days in it. You post a payment of $600 on the 15th of the month. The Balance was $2000 before the payment. What is the interest on the average daily balance if the APR is 23%? $32.58

3. The monthly payment on a house loan is $876. The purchase price of the house was $125,000. If you pay this for 30 years how much interest did you pay? $190,360


4. A house costs $275,000. The rate is 7.3% with monthly payments for 30 years. What is the payment? Round to the nearest dollar. $1885

Answers

1. The decrease in the balance would be $11.25 2. The interest on the average daily balance would be $28.77. 3. The total interest paid would be $214,960. 4. The payment would be $1,978.

Describe Interest?

Interest refers to the amount of money that is charged or earned for the use of borrowed money. It is a fee paid by a borrower to a lender for the use of funds, or a payment received by a depositor from a bank for the use of their money.

Interest rates are typically expressed as a percentage of the principal amount and can be fixed or variable, depending on the terms of the loan or investment. The interest rate charged on a loan is determined by a number of factors, including the creditworthiness of the borrower, the length of the loan, and prevailing market conditions.

1. The decrease in the balance would be $11.25.

Calculation:

Minimum payment = 2.5% of $450 = $11.25

New balance after paying the minimum = $450 - $11.25 = $438.75

The decrease in the balance would be $450 - $438.75 = $11.25.

2. The interest on the average daily balance would be $28.77.

Calculation:

The balance for the first 14 days of the month = $2000

The balance for the last 16 days of the month = $1400

Average daily balance = (14 * 2000 + 16 * 1400) / 30 = $1666.67

Interest for the month = 0.23 / 12 * $1666.67 = $28.77

3. The total interest paid would be $214,960.

Calculation:

No. of payments = 30 * 12 = 360

Total amount paid = $876 * 360 = $315,360

Total interest paid = $315,360 - $125,000 = $190,360

4. The payment would be $1,978.

Calculation:

Monthly interest rate = 7.3% / 12 = 0.6083%

Number of payments = 30 * 12 = 360

Payment = $275,000 * 0.006083 / (1 - (1 + 0.006083)^-360) = $1,977.54 (rounded to nearest dollar: $1,978)

To know more about rate visit:

https://brainly.com/question/13324776

#SPJ1

Can u do number 15 plsssssss

Answers

Answer:

y=x+5 x=3

Plug 3 into x

y=3+5

5+3=8

Step-by-step explanation:

The square below has 9X. Find the area of the square remaining after a circle of radius is 6X is removed from the square in other words find the area of the shaded region in factored form 

Answers

The area of the shaded region in factored form is 9x^2(9 - 4π)

How to find the area of the shaded region in factored form

From the question, we have the following parameters that can be used in our computation:

Square length = 9x

Radius of circle = 6x

The area of the square is given by (side length)^2.

Since the square has 9x as a side length, its area is:

Area 1 = (9x)^2 = 81x^2

For the circle, we have

Area 2 = π(6x)^2

Area 2 = 36πx^2

The area of the shaded region is the area of the original square minus the area of the circle, which is:

Shaded = 81x^2 - 36πx^2

Factorize

Shaded = 9x^2(9 - 4π)

Hence, the area is 9x^2(9 - 4π)

Read more about area at

https://brainly.com/question/22972014

#SPJ1

"The graph of y=−3x+62

Answers

Answer:

-1/3x + 62/3

Step-by-step explanation:

Interchange the variables:  y = -3x + 62

Swap the sides:  -3y + 62

Move constant:  -3y + 62 = x

Divide and simplify:  -3y = x - 62

Answer: -1/3x + 62/3

Please help me with my answer.  I'm stuck and really need help on it.

Answer:

-3 = slope, 62 = y intercept

Step-by-step explanation:

1. Barbara has been keeping track of her long-
distance minutes. Her weekly totals for four weeks
are 48, 115, 62, and 35 minutes. What is Barbara's
weekly average, in minutes, over the four-week
period?

Answers

Barbara's weekly average for the four-week period is 65 minutes.

What is the average?

The average, also known as the arithmetic mean, is a measure of central tendency that represents the typical value of a set of numbers. It is calculated by adding up all the numbers in the set and then dividing the sum by the total number of numbers.

To find Barbara's weekly average for the four-week period, we need to add up her weekly totals and divide the sum by 4 (since there are four weeks in the period):

Average = (48 + 115 + 62 + 35) / 4

= 260 / 4

= 65

Therefore, Barbara's weekly average for the four-week period is 65 minutes.

To learn more about the average, visit:

https://brainly.com/question/130657

#SPJ1

Kabir has three fuel containers. One has a capacity of 7 litres,
one has a capacity of 4 litres and one has a capacity of 3 litres.
The 7 litre container is full, the other two containers are empty.
None of the containers has a measurement scale.
How can Kabir transfer the fuel so that two of the containers contain
a volume of 2 litres each, and the other contains a volume of 3 litres,
vithout having to estimate?

Answers

The solution is, the capacity of the largest container that can fill the tanks an exact number of times is, 44 litres.

What is CGF?

In mathematics, the greatest common divisor of two or more integers, which are not all zero, is the largest positive integer that divides each of the integers. For two integers x, y, the greatest common divisor of x and y is denoted {\displaystyle \gcd}.

here, we have,

We subtract the remainders from the amounts.

447 - 7 = 440

577 - 5 = 572

669 - 9 = 660

Now we need the GCF of 440, 572, 660

440 = 2³ × 5 × 11

572 = 2² × 11 × 13

660 = 2² × 3 × 5 × 11

GCF = 2² × 11 = 44

The greatest common factor is 44.

Answer: 44

Check:

447/44 = 10 reminder 7

577/44 = 13 remainder 5

669/44 = 15 remainder 9

To learn more about GCF, refer to:

brainly.com/question/219464

#SPJ1

Find the sum of the following arithmetic series:

Answers

Answer:

19107

Step-by-step explanation:

First, we need to find the common difference (d), which we can find by subtracting two consecutive terms.  Thus, we can do d = 1 - (-3) = 4.

Now, we need to know how many terms are in the arithmetic series.  We can find the number using nth term formula, which is

[tex]a_{n}=a_{1}+(n-1)*d[/tex], where a1 is the first term, n is the term position (e.g., 1st, 2nd).

Although we don't know the term position of 389, we can still plug it into the formula and solving for n will reveal it's term number and the total number of sums in the sequence:

[tex]389=-3+(n-1)*4\\392=(n-1)*4\\392=4n-4\\396=4n\\99=n[/tex]

Now, we can find the sum using the sum formula, which is

[tex]S_{n}=n/2*(a_{1}+a_{n})[/tex]

Sn can become S99 since there are 99 terms and we can let an = a99, which we know is 389.

Now, we must solve for S99:

[tex]S_{99}=\frac{99}{2}*(-3+389)\\ S_{99}=\frac{99}{2}*(386)\\ S_{99}=19107[/tex]

Use implicit differentiation to find an equation of the tangent line to the curve at the given point.
x2+y2=(2x2+2y2−x)2,(0,1/2)

Answers

As a result, y = -x + 1/2 is the equatiοn οf the tangent line tο the curve x² + y² = (2x² + 2y² - x)² at the pοsitiοn (0,1/2).

What is equatiοn?

An equatiοn in mathematics is a claim that twο mathematical expressiοns are equivalent. An equatiοn has an equal sign, typically has οne οr mοre factοrs, and can be sοlved fοr by applying algebraic οr numerical techniques. Equatiοns are used tο represent real-wοrld phenοmena, resοlve issues, and make predictiοns in many branches οf mathematics, science, and engineering.

given:

We must first use implicit differentiatiοn tο determine the derivative οf the curve in οrder tο determine the equatiοn οf the tangent line tο the curve at the pοsitiοn (0,1/2).

By taking the derivative οf the equatiοn's twο sides with regard tο x, we arrive at:

dy/dx = 2x + 2y

(2x² + 2y²- x) * (4x - 1) (4x - 1)

When we sοlve fοr dy/dx and simplify this equatiοn, we get:

[(1 - 4x)(2x + 2y)] Equals dy/dx / [4(2x² + 2y² - x) - 2y(1 - 4x)]

The slοpe οf the tangent line at the pοint (0,1/2) can nοw be calculated by plugging in the numbers x = 0 and y = 1/2:

dy/dx = [(1 - 4(0))

(2(0) + 2(1/2))] / [4(2(0)² + 2(1/2)² - 0) - 2(1/2)(1 - 4(0))] = -1

Therefοre, the tangent line's slοpe at the pοsitiοn (0,1/2) is negative οne. We can use the pοint-slοpe fοrm οf a line tο determine the equatiοn οf the tangent line:

where (x1,y1) is the tangency pοint and m is the inclinatiοn οf the tangent line. When we enter the numbers we have, we οbtain:

y - 1/2 = -1(x - 0) (x - 0)

When we simplify this sοlutiοn, we οbtain:

y = -x + 1/2

As a result, y = -x + 1/2 is the equatiοn οf the tangent line tο the curve x² + y2 = (2x² + 2y² - x)² at the pοsitiοn (0,1/2).

To know more about equation visit:

brainly.com/question/649785

#SPJ1

Jake gets to a party at to'dock having alredy baned off 25 calories throughout his normal day. After dancing at the party. he checked! and burned off 85 total for the day by 9o'clock.

Answers

The calories burned per hour is 30 calories per hour

How to determine the calories burned per hour

From the question, we have the following parameters that can be used in our computation:

Calories at 7 = 25 calories

Calories at 9 = 85 calories

Using the above as a guide, we have the following:

Rate = Difference in calories/Difference in time

Substitute the known values in the above equation, so, we have the following representation

Rate = (85 - 25)/(9 - 7)

Evaluate

Rate = 30

Hence, the rate is 30 calories per hour

Read more about unit rate at

https://brainly.com/question/26059245

#SPJ1

Mr. Gaspar wants to store a 12-foot-long pipe
in a tool closet. The closet has the shape of a
right rectangular prism with the dimensions
shown. Will the pipe fit? Show your work.

Answers

The longest pipe can fit in the prism is 11.7 ft, so, 12 ft long pipe does not fit.

What is the Pythagoras theorem?

The Pythagoras theorem which is also referred to as the Pythagorean theorem explains the relationship between the three sides of a right-angled triangle. According to the Pythagoras theorem, the square of the hypotenuse is equal to the sum of the squares of the other two sides of a triangle.

From the given figure,

By considering base of the prism, we get

c²=6²+6²

c²=72

c=6√2 ft

Now, d²=c²+8²

d²=72+64

d²=136

d=√136

d= 11.7 ft

Hence, the longest pipe can fit in the prism is 11.7 ft, so, 12 ft long pipe does not fit.

To learn more about the Pythagoras theorem visit:

brainly.com/question/21926466.

#SPJ1

Using the graph determine the coordinates of the zeros of the parabola

Answers

Answer:

-5 and -The zeros of a parabola are the points on the parabola that intersect the line y = 0 (the horizontal x-axis). Since these points occur where y = 0,

Emails arrive randomly on Oliver's computer at an average rate of 1.46 per hour. Stating a necessary assumption, find the probability that between 9.00am and 11.30am Oliver receives: (i) no emails​

Answers

The probability that Oliver will receive no emails in between 9.00am and 11.30am is 2.599%.

What is Poisson Distribution?

Poisson Distribution is defined as a discrete distribution which measures the likelihood of happening an event in a certain period of time.

The formula for Poisson distribution is,

P(x) = (e^(-λ) λˣ) / x!

Given that,

Average rate of arrival of emails in an hour = 1.46 per hour

Between 9.00 am and 11.30 am, there are 2.5 hours.

Average rate of arrival of emails in 2.5 hours = 2.5 × 1.46

                                                                           = 3.65

So, λ = 3.65

x = 0  (since no emails.)

P(0) = (e^(-3.65) (3.65)⁰) / 0!

      = e^(-3.65)

      = 0.02599

      = 2.599%

Hence the probability is 2.599%.

Learn more about Poisson Distribution here :

https://brainly.com/question/17280826

#SPJ9

Jack has 7 yards of rope. He wants to cut it into pieces of different sizes. Jacks needs 84 inches of rope to tie some packages and 4 feet of rope for another project. Does Jack have enough rope? Explain.

Answers

Jack has enough rope for both projects.

What is multiplication?

Multiplication is a type of mathematical operation. The repetition of the same expression types is another aspect of the practice.

For instance, the expression 2 x 3 indicates that 3 has been multiplied by two.

Given:

Jack has 7 yards of rope.

He wants to cut it into pieces of different sizes.

Jack needs 84 inches of rope to tie some packages and 4 feet of rope for another project.

First, we need to convert all the measurements to the same units.

Let's convert yards to inches and feet to inches:

7 yards = 21 feet = 252 inches

4 feet = 48 inches

Now, let's add up the lengths of rope that Jack needs:

84 inches + 48 inches = 132 inches

So Jack needs a total of 132 inches of rope.

Since 132 inches is less than the total length of rope that Jack has (252 inches).

Therefore, he does have enough rope for both projects.

To learn more about multiplication;

https://brainly.com/question/19634536

#SPJ1

Every year Marla collects
acorns. If she collects 1,378
acorns each year for 7
years, how many acorns will
she have?

Answers

Answer:

9,646

Step-by-step explanation:

1378 acorns x 7 years = 9,646 acorns

Other Questions
How did covid affect school kids in Afrikaans 15. \( x=-5, \quad x=4, \quad x=-\frac{1}{2} \) factored form standard form 16. \( x=3, \quad x=-7, \quad x=0 \) (multiplicity of 2) factored form standard form\[ \text { 17. } x=\frac{2}{3} \text { what smaller 5.75 or 9/7 When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part.