Answer:
Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies
5. What does Grover give Percy?
Answer:
Explanation:
Grover gives Percy a present in a shoebox and it's the horn that Percy snapped off of the head of the Minotaur.
Answered by the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!
HOPE THIS HELPED!!
Help Me pls?!?!??? Plsssss
Answer:
its b
Explanation:
I remember I did this
If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?
Answer:
Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.
Explanation:
hope this helps:)
Help plzzzz!!!!!!!???!!!!!
What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!
Answer:
Tiktaalik roseae
Explanation:
The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.
The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.
Which of the following best describes Darwin's (and Wallace's) theory of evolution?
Question 1 options:
Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.
The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.
Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island
The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.
Answer:
4
Explanation:
The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.
Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.
You can learn more about the natural selection here:
https://brainly.com/question/23929271
#SPJ2
What helps meteorologists to forecast the weather?
Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists
Answer:
Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.
Please help with this I’m being timed
Answer:
cell inhibitors
Explanation:
edge
If the carrot population increased, the rabbit population would:
NO LINK ANSWERS
A. increase
B. decrease
C. remain the same
Answer:
The rabbit population would remain the same as the increase in number of carrots doesn't determine / effect the population of rabbits.
Hope my answer helps !
Answer:
i believe the answer is c) remain the same
Explanation:
i say this because food availability wouldn't necessarily cause the population to grow (there would need to be an environmental change for this to happen.)
and the population wouldn't decrease because there would be an abundance of food and since starvation is one of the main causes of population decrease (along with over-crowding.)
good luck :)
i hope this helps
**please let me know if this was incorrect**
have a nice day!
True or false
processing maintains quality control .
Answer:
True
(I am not 100% sure because the question is very short with no context, but I believe it to be true)
Why are archaea in a different domain from bacteria?
A. They are multicellular, but bacteria are unicellular.
B. They are thought to have separate paths of evolutionary
development
C. They are able to perform endosymbiosis, but bacteria are not.
D. They have no similar characteristics.
Answer:B
Explanation:
Archaea is in a different domain from bacteria because they are thought to have separate paths of evolutionary development. Therefore, the correct statement is option B.
What are the differences between archaea and bacteria domains?Archaea and bacteria are both prokaryotic organisms, but archaea are more closely related to eukaryotes than bacteria. Archaea have unique lipid membrane and cell wall components that are different in composition than those found in bacteria.
These differences suggest that archaea and bacteria evolved to have separate paths of evolutionary development early in the history of life on Earth and then classified into Archaea and Bacteria domains.
Based on the phylogenetic tree constructed by researchers, the tree has classified life into three domains which are Archaea, Bacteria, and Eukarya These domains are based on their fundamental genetic and biochemical differences.
Therefore, archaea and bacteria are in a different domain because they followed separate paths of evolutionary development.
Learn more about the archaea domain here:
https://brainly.com/question/31089143
#SPJ5
BRAINIEST ANSWER!
HELP :))
Answer:
True
Explanation:
Don't know tell me if I'm wrong
Answer:
True
Explanation:
Actually it destroyed a LOT more than that...
Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information
B. disrupting meiosis and the synthesis of amino acids into a sequence
C. producing the inorganic molecules needed for normal cell growth
D. directing the synthesis of proteins necessary for proper cell function
D. directing the synthesis of proteins necessary for proper cell function
I hope this helps a little.
which statement best describes an example of selective breeding?
Answer: the answer is A
Explanation:
Use the images below to answer the question. 2. What makes all of the samples different from each other?
Answer:
Shape and structure.
Explanation:
The difference in shape and structure of these pictures is responsible for the difference from each other. The organisms present in these pictures are different in their size, shape and composition of their body. Some are small and some are large, some are living while the others are non-living, some are very hard whereas the others are soft and fleshy. So the organisms present in these samples are different from each other in a variety of ways i.e. size, shape and body structure.
Which type of bleed would typically be more urgent to treat—venous or arterial?
Answer:
Arterial bleeding is more dangerous than venous bleeding. The arteries carry blood from the body and back into the heart. If the arteries become damaged and start to bleed out, an individual can suffer loss of life within five minutes if the bleeding is severe and if no medical attention is received.
where does mold come from?
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
which problem do you think contributes most to water scarcity?
Answer:
Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.
-WWF
how do radiation, conduction, and convection affect the atmosphere?
Answer:
Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.
Explanation:
#KEEP LEARNING
WILL GIVE BRAINLIEST TO BEST ANSWER NO LINKS Select the correct answer.
In 2002, Colorado was suffering from extreme drought. Which technology will help Colorado reduce the effects of future droughts?
A.
building sea walls
B.
building levees
C.
building dams
D.
building storm shelters
Answer:
Building dams is the technology that will help Colorado reduce the effects of future droughts.
Explanation:
i dont know why people are putting links up insted of awnsers. Have a nice day :)
Answer:
C. Building dams
Explanation:
dams can store and reserve water for future use (resevoirs)
If your cells couldn't go through meiosis- how could this affect you?
Answer:
An organism would not be able to reproduce without meiosis.
Explanation:
Between meiosis and mitosis, meiosis is by far not as important. If you are a asexual organism, this would be NOT IMPORTANT whatsoever. If you are a sexual organism, this would LARGLY effect you. But on a world scale, this is NOT AS IMPORTANT.
This is because, without mitosis, you could not heal and would die much much younger since your cells could not be replaced. On the other hand, without meiosis, any organism that reproduces sexually would be unable to do so, which could lead to extinction in many, many species. This would not be harmful, however, to species that can also or mainly reporuduce asexually through budding, fragmenting, or sporing. So overall:
Organisms that produce sexually would go extinct.
This is the only real affect I can think of. Since meiosis does not produce any cells aside from reproductive cells. And asexual organisms produce reproductive cells through other means.
Ti⊂k∫∈s ω∅∅p
Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be
Answer: Gg
Explanation:
I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2
Answer: 1. ??? 2. I cannot read it
Answer:
What does it say?
Explanation:
true or false
Photosynthesis is part of an oak tree's niche.
Answer:
True, veryyyyy true
:))
How does acid rain (deposition) form and travel to effect the environment?
Answer:
The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes
Explanation:
In a sample of double stranded dna if 27% of the nitrogenous bases are thymine what percentage of nitrogenous bases are cytosine?
Answer:
73%
Explanation:
Given: 27%
To find: Percentage of nitrogenous bases are cytosine
Solve: [tex]\frac{27}{100}[/tex] × [tex]\frac{100}{1}[/tex]
Firstly, divide 100% by thymine and cytosine
[tex]\frac{100}{2}[/tex] = 50
Now, If it is 50 / 50, but thymine has 27 then subtract 27 from 100
100 - 27 = 73
So, the percentage of nitrogenous bases are cytosine 73%
PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2
Answer:
109kg? would hit the ground with more force
Explanation:
Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess
Volume of the large cube is 7.506 x 10 mm. The volume of each small cube is 2.78 X 104 mm'. How many small cubes make up the large cube?
Answer:
27
Explanation:
B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?
Here's li[tex]^{}[/tex]nk to the answer:
bit.[tex]^{}[/tex]ly/3tZxaCQ