The question is in the screenshot:

The Question Is In The Screenshot:

Answers

Answer 1

We can deduce that 3pi/4<5pi/3<2pi

The angle is in the 4th quadrant. To find the angle you just do:

[tex]2\pi -\frac{5\pi }{3}=\frac{\pi }{3}[/tex]

The answer to your question is B. I hope that this is the answer that you were looking for and it has helped you.


Related Questions

Determine the x-intercepts of each of the following functions. 2. y=x^2+5x−24 3. y=x^2−11x+10

Answers

The x-intercepts of y=x2+5x−24 can be determined by solving the equation 0=x2+5x−24. Using the quadratic formula, we can find that x = 6 and x = -4 are the two x-intercepts.

The x-intercepts of y=x2−11x+10 can be determined by solving the equation 0=x2−11x+10. Using the quadratic formula, we can find that x = 5 and x = -2 are the two x-intercepts.
To determine the x-intercepts of the given functions, we need to find the values of x that make y equal to 0. We can do this by factoring the equations and setting each factor equal to 0.

2. y = x^2 + 5x - 24
0 = x^2 + 5x - 24
0 = (x + 8)(x - 3)
x + 8 = 0 or x - 3 = 0
x = -8 or x = 3

The x-intercepts are (-8, 0) and (3, 0).
3. y = x^2 - 11x + 10
0 = x^2 - 11x + 10
0 = (x - 1)(x - 10)
x - 1 = 0 or x - 10 = 0
x = 1 or x = 10

The x-intercepts are (1, 0) and (10, 0).
You can read more about quadratic equation at https://brainly.com/question/1214333

#SPJ11

What are the solutions of the equation 0=x^2-9x+8

Answers

The solutions of the equation  0=x^2-9x+8 are x = 8 and x = 1

How to determine the solutions of the equation

From the question, we have the following parameters that can be used in our computation:

0=x^2-9x+8

Rewrite as

x^2 - 9x + 8 = 0

Expand the equation

So, we have the following representation

x^2 - 8x - x + 8 = 0

When the equation is factorized, we have

(x - 8)(x - 1) = 0

This gives

x - 8 = 0 and x - 1 = 0

Evaluate

x = 8 and x = 1

Hence, the solutions are x = 8 and x = 1

Read more about equations at

https://brainly.com/question/25841119

#SPJ1

I put a photo please help

Answers

The requried combined length of both trains is 900 meters or 900 km.

What is speed?

Speed is defined as when an object is in motion, the distance covered by that object per unit of time is called speed.

Here,
Let's first convert the given speeds from km/h to m/s to make the calculations easier.

Speed of the first train = 102 km/h = (102 x 1000) m/3600 s = 28.33 m/s

Speed of the second train = 30 km/h = (30 x 1000) m/3600 s = 8.33 m/s

Now, let's consider the relative speed of the two trains since they are moving in the same direction:

Relative speed = Speed of first train - Speed of second train

= 28.33 - 8.33

= 20 m/s

Let's assume that the length of the first train is x m and the length of the second train is y m.

Distance covered by first train in 45 seconds = (x + y) m

Speed of first train = Distance covered by first train / Time taken

= (x + y) / 45 km/s

We know that the speed of the first train is 20 m/s. So, we can write:

20 = [(x + y) / 45]

Solving for (x + y),

x + y = 900 m

Therefore, the combined length of both trains is 900 meters or 900 km.

Learn more about speed here:
https://brainly.com/question/7359669

#SPJ1

5
Use Scratchpad to fill in the missing dimensions on the figure.
9 ft.
ft.
ft.
2 ft.
3 ft.
10 ft.
5 ft.
Calculate the area of the figure.
The area of the figure is
4 ft.
ft²

Answers

The method for calculating the area of a figure depends on the type of figure.

How to calculate the area

Here are some common formulas for finding the area of different shapes:

Square: To find the area of a square, you multiply the length of one side by itself: Area = side x side or A = s²

Rectangle: To find the area of a rectangle, you multiply the length by the width: Area = length x width or A = lw

Triangle: To find the area of a triangle, you multiply the base by the height and divide by 2: Area = 1/2 x base x height or A = 1/2 bh

Circle: To find the area of a circle, you multiply pi (3.14) by the radius squared: Area = pi x radius^2 or A = πr^2

Trapezoid: To find the area of a trapezoid, you multiply the average of the bases by the height: Area = 1/2 x (base1 + base2) x height or A = 1/2 (b1 + b2)h

These are just some of the formulas for calculating the area of different shapes. Depending on the figure you're working with, you may need to use a different formula or combination of formulas to find the area.

Learn more about area on:

https://brainly.com/question/25292087

#SPJ1

Please help me answer this

Answers

Answer: I think B & C not super sure though

Describe the long run behavior of f(x)=5(2)x+1:
As x→−[infinity], f(x) =
As x→[infinity], f(x) =

Answers

The long run behavior of the function f(x)=5(2)x+1 is that it approaches 1 as x approaches negative infinity and it approaches infinity as x approaches positive infinity.

The long-term behavior of the function f(x)=5(2)x+1 can be discovered by examining how the function behaves as x gets closer to negative and positive infinity.

As x→−[infinity], f(x) = 5(2)^ -∞+1 = 5(0)+1 = 1

As x approaches negative infinity, the value of the function approaches 1.

As x→[infinity], f(x) = 5(2)^ ∞+1 = 5(∞)+1 = ∞

As x approaches positive infinity, the value of the function approaches infinity.

As a result, the function f(x)=5(2)x+1 behaves in the long run in such a way that it approaches 1 as x approaches negative infinity and infinity as x approaches positive infinity.

Learn more about behavior at https://brainly.com/question/22443880

#SPJ11

If a+x=b+y=c+z+1, where a,b,c,x,y, z are non-zero distinct real numbers. Then [[x,a+y,x+a],[y,b+y,y+b],[z,c+y,z+c]]

Answers

The value of the matrix is [[b+y-a,a+x-b,c+z+1-a],[a+x-b,b+y-a,c+z+1-b],[a+x-c-1,b+y-c-1,c+z]] when a+x=b+y=c+z+1, where a,b,c,x,y, z are non-zero distinct real numbers.

According to the given equation, a+x=b+y=c+z+1, where a,b,c,x,y, z are non-zero distinct real numbers, we can rearrange the equation to find the value of one of the variables in terms of the others. For example, we can rearrange the equation to find the value of x in terms of the other variables:

x = b+y-a = c+z+1-a

Similarly, we can rearrange the equation to find the value of y and z in terms of the other variables:

y = a+x-b = c+z+1-b

z = a+x-c-1 = b+y-c-1

Now, we can substitute these values into the given matrix to find the value of each element:

[[x,a+y,x+a],[y,b+y,y+b],[z,c+y,z+c]] = [[b+y-a,a+x-b,c+z+1-a],[a+x-b,b+y-a,c+z+1-b],[a+x-c-1,b+y-c-1,c+z+1-c-1]]

Simplifying the matrix, we get:

[[b+y-a,a+x-b,c+z+1-a],[a+x-b,b+y-a,c+z+1-b],[a+x-c-1,b+y-c-1,c+z]]

Therefore, the value of the matrix is [[b+y-a,a+x-b,c+z+1-a],[a+x-b,b+y-a,c+z+1-b],[a+x-c-1,b+y-c-1,c+z]] when a+x=b+y=c+z+1, where a,b,c,x,y, z are non-zero distinct real numbers.

Learn more about  real numbers

brainly.com/question/551408

#SPJ11

7. A realtor took $32,500 made on the sale of a home and placed it in a new account that earns
6% compounded annually. Find the total amount in the account after 5 years.

Please help!

Answers

Answer: The amount is $43492.35 and the interest is $10992.35.

Step-by-step explanation:

To find amount we use formula:

A = P(1+r/n)^nt

A = total amount

P = principal or amount of money deposited,

r = annual interest rate

n = number of times compounded per year

t = time in years

In this example we have

P=32,000 , R=6% , N = 1 T= 5 YEARS

After plugging the given information we have

A=32000(1+0.06/1)^1.5

A=32500*1.06^5

A=32500*1.338226

A=$43492.35

To find interest we use formula A=P+I , since A= 43492.35  P =32500  we have:

A=P+I

$43492.35 = 32500+I

I=$43492.35-32500

I=$10992.35

Richard’s Supplies sold 100 calculators in the month of August. Joseph’s Deals sold 30 calculators in the first week of October. A business consultant concluded that Richard's Supplies sells more calculators than Joseph's Deals. Explain why the statistic is misleading

Answers

The statistic that "Richard's Supplies sells more calculators than Joseph's Deals" based solely on the information given is misleading because it compares the total sales of one business for an entire month with the sales of another business for only one week.

What should be the most acceptable way to make the sales comparison in statistic?

It's possible that Joseph's Deals could sell more calculators than Richard's Supplies in a given week or even in the entire month of October, despite the fact that they only sold 30 calculators in the first week but we don't have enough information to compare the sales of these two businesses accurately.

In addition, we don't know if Richard's Supplies and Joseph's Deals are similar businesses with similar customer bases, pricing strategies, and marketing efforts. These factors could also affect their respective sales numbers.

In conclusion, to draw a meaningful comparison between the sales of these two businesses, we would need to gather more data about their sales over a longer period of time and under similar conditions.

Read more about statistic

brainly.com/question/12805356

#SPJ1

How many solutions does the system have?{ 2 x + 3 y =-6 3 x − 4 y = − 12

Answers

Therefore , the solution of the given problem of equation comes out to be which is (x, y) = (-60/17, 58/17).

How do mathematics equation work?

The same letter is frequently used in mathematical formulas to attempt to enforce unity between two claims. Mathematical expression equations, also referred to as assertions, are used to demonstrate the equality of many academic figures. Using y + 6 = 12 like an example, the normalise separates 12 but rather b + 6 in to the two pieces. The relationship between each sign variable and the amount of lines can be identified. A symbol's meaning typically runs counter to itself.

Here,

Elimination is one approach that could be used to solve the problem. So that the component of y in each equation is -12, we can do this by multiplying the first equation by 4 and the second equation by 3:

=> 4(2x + 3y = -6) -> 8x + 12y = -24

=> 3(3x - 4y = -12) -> 9x - 12y = -36

The two formulae combined give us:

=> 8x + 12y + 9x - 12y = -24 - 36

=> 17x = -60

=>x = -60/17

We can find y by substituting x into either equation:

=> 2(-60/17) + 3y = -6

=> 3(-60/17) - 4y = -12

When we simplify each solution, we obtain:

=> -120/17 + 3y = -6

=>-180/17 - 4y = -12

By y in each solution and solving, we obtain:

=> 3y = 174/17

=> y = 58/17

As a result, there is only one solution to the system, which is (x, y) = (-60/17, 58/17).

To know more about equation visit:

https://brainly.com/question/649785

#SPJ1

Let X (3, 0.02). Given Tx = 300 calculated by the Esscher Premium Principle with parameter 1, calculate h

Answers

The value of h is 99.969.

The Esscher Premium Principle is a method of calculating insurance premiums that considers the risk of an event occurring and the potential severity of the loss. The formula for the Esscher Premium Principle is:

Ex = ln(∑eαx Px)/α

Where Ex is the Esscher premium, α is the parameter, x is the loss amount, and Px is the probability of the loss occurring.

In this case, we are given X (3, 0.02), meaning that the loss amount is 3 and the probability of the loss occurring is 0.02. We are also given that the Esscher premium is 300 and the parameter is 1. Plugging these values into the formula, we get:

300 = ln(∑e1(3) 0.02)/1

Simplifying the equation, we get:

300 = ln(0.02e3)

Taking the natural logarithm of both sides, we get:

e300 = 0.02e3

Dividing both sides by 0.02, we get:

e300/0.02 = e3

Taking the natural logarithm of both sides again, we get:

300 - ln(0.02) = 3

Solving for h, we get:

h = (300 - ln(0.02))/3

h = 99.969

Therefore, the value of h is 99.969.

To know more about Esscher Premium Principle, refer here:

https://brainly.com/question/29412050#

#SPJ11

We measure three dimensional space with volume. Volume is how much three dimensional space something takes up. We usually measure it in cubic meters or cubic feet. ‪90 ft

Answers

We usually measure it in cubic meters or cubic feet. ‪90 ft³‬ is equal to ‪2,544.48 cm³‬.

What is length?

Length is a term used to describe the magnitude of a line, distance, or size. It usually refers to the measurement of something from end to end, such as the length of a river, the height of a building, or the size of a piece of fabric. Length is typically measured in units such as feet, meters, or even inches. It is an important concept in science, engineering, and mathematics. Length helps us to understand and quantify the size of objects and the space they occupy.

We can find the volume of any three dimensional object by using the formula V = l x w x h, where V is the volume, l is the length of the object, w is the width, and h is the height. This formula is applicable to all three dimensional shapes, including cubes, rectangles, prisms, cylinders, and so on.

To find the volume of a cylinder, we use the formula V = π x r² x h. Here, V is the volume, π is the constant pi, r is the radius of the cylinder, and h is the height. To find the volume of a sphere, we use the formula V = 4/3 x π x r³. Here, V is the volume, π is the constant pi, and r is the radius of the sphere.

We can also use volume to measure liquids or gases. We measure liquids in liters or milliliters, and gases in cubic meters or cubic feet. For example, 1 liter of water is the same as 1,000 milliliters of water.

Volume is an important concept in mathematics and is used to measure many different things. It is used to measure the size of objects, the volume of liquids and gases, and the amount of three dimensional space something occupies. Understanding volume and how to calculate it is an essential skill for anyone studying mathematics.

To know more about length click-
https://brainly.com/question/25292087
#SPJ1

Talia deposits $350 in her savings account. The account earns 2.5% simple interest per year. What is the balance in the account after 4 years?

Answers

Answer:385

Formulate and substitute:F=350+350rt

Calculate the product or quotient:350x1+0.1

Calculate the sum or difference:350x1.1

Calculate the product or quotient:385

Find the volume of the figure below in terms of pi.
A. 36pi
B: 288pi
C: 144pi
D: 864pi

Answers

Answer:   288pi   (choice B)

Work Shown:

[tex]V = \text{Volume of a sphere}\\\\V = \frac{4}{3}\pi*r^3\\\\V = \frac{4}{3}\pi*6^3\\\\V = \frac{4}{3}\pi*216\\\\V = \frac{4}{3}*216\pi\\\\V = 288\pi\\\\[/tex]

The answer would be B

Someone help pls, I need this answer fast

Answers

Answer:

Step-by-step explanation:

North Dakota is 34 times larger

                 Puerto Rico

North Dakota = 1.83x[tex]10^{5}[/tex]   [tex]Km^{2}[/tex]    

Puerto Rico =  5.33 x [tex]10^{3}[/tex]   [tex]Km^{2}[/tex]  

                       1.83 x [tex]10^{5}[/tex]

                       5.33 x [tex]10^3[/tex]        = 0.34 x [tex]10^2[/tex]

Evaluate the function at the indicated values. (If an answer is undefined, enter UNDEFINED.) g(x) = 8- x / 8+ 7 ; g(2), g(-8), g(1/2), g(a), g(a – 8), g(x^2 - 8) g(2) = 6/10 g(-8) = UNDEFINED g(1/2) = (8-(1/2) / 8+(1/2))
g(a) = (8-a) – (8+a)
g(a-8) = _________
g(x^2 – 8) = ________

Answers

The function values.

To evaluate the function g(x) = 8 - x / 8 + 7 at the indicated values, we need to substitute the values into the function and simplify.

g(2) = 8 - 2 / 8 + 7 = 6 / 15 = 2 / 5

g(-8) = 8 - (-8) / 8 + 7 = 16 / 15 = 16 / 15

g(1/2) = 8 - (1/2) / 8 + 7 = (15.5) / 15 = 31 / 30

g(a) = 8 - a / 8 + 7 = (15 - a) / 15

g(a - 8) = 8 - (a - 8) / 8 + 7 = (16 - a) / 15

g(x^2 - 8) = 8 - (x^2 - 8) / 8 + 7 = (16 - x^2) / 15

So, the function values are:
g(2) = 2 / 5
g(-8) = 16 / 15
g(1/2) = 31 / 30
g(a) = (15 - a) / 15
g(a - 8) = (16 - a) / 15
g(x^2 - 8) = (16 - x^2) / 15

Learn more about values

brainly.com/question/30781415

#SPJ11

O is the center of the regular octagon below. Find its perimeter. Round to the nearest tenth if necessary.

Answers

The perimeter of the regular octagon with an apothem of 5 units will be 33.14 units.

What is the perimeter of the regular polygon?

All the sides of the regular polygon are congruent to each other. The perimeter of the regular polygon of n sides will be the product of the number of the side and the side length of the regular polygon.

P = (Side length) x n

The Apothem of a regular octagon is 5 units. Then the side length of the regular octagon is given as,

tan (360° / (2 × 8)) = (n/2) ÷ 5

tan 22.5° = n / 10

n = 4.142

Then the perimeter is given as,

P = 8 x 4.142

P = 33.14 units

The perimeter of the regular octagon with an apothem of 5 units will be 33.14 units.

More about the perimeter of the regular polygon link is given below.

https://brainly.com/question/10885363

#SPJ1

Identify the following models as ARMA(p, q) models (watch out for parameter redundancy), and determine whether they are causal and/or invertible:


(a) xt =. 80xt-1 −. 15xt−2 + wt −. 30wt−1.


(b) xt = xt−1 −. 50xt−2 + wt − wt−1.


Answers

The first model (a) is an ARMA(1,2) model and is both causal and invertible, while the second model (b) is an ARMA(2,1) model and is also both causal and invertible.

What are Autoregressive (AR) models?

Autoregressive (AR) models are a type of statistical model that uses the past values of a variable to predict its future values. The main assumption of AR models is that the future values of the variable are correlated with its past values. They are used to analyze time series data and are commonly used in forecasting, price and demand prediction, and other time-dependent processes.

The first model (a) is an ARMA(1,2) model, which is a combination of an autoregressive (AR) and a moving average (MA) model. This model is both causal and invertible. Causal models are models that have a lag of only one period, while invertible models are those that have a lag of two or more periods. The second model (b) is an ARMA(2,1) model, which is a combination of an autoregressive (AR) and a moving average (MA) model. This model is both causal and invertible. Since the lags for both models are greater than one, both models are invertible.

For more questions related to Causal models

https://brainly.com/question/14974240

#SPJ1

A tank contains 12 litres of water in which is dissolved 24 grams of chemical A solution containing 4 grams per litre of the chemical flows into the tank at a rate of 4 litres per minute, and the well-stirred mixture flows out at a rate of 2 litres per minute. Determine the amount of chemical in the tank after 15 minutes.

Answers

The amount of chemical in the tank after 15 minutes is 154.14 grams.

To determine the amount of chemical in the tank after 15 minutes, we need to use the formula for the concentration of a solution:

C = m/V

Where C is the concentration of the solution, m is the mass of the chemical, and V is the volume of the solution.

Initially, the tank contains 12 litres of water and 24 grams of chemical A, so the initial concentration of the solution is:

C0 = 24/12 = 2 grams per litre

The solution flows into the tank at a rate of 4 grams per litre and 4 litres per minute, so the amount of chemical flowing into the tank per minute is:

4 grams per litre × 4 litres per minute = 16 grams per minute

The well-stirred mixture flows out of the tank at a rate of 2 litres per minute, so the amount of chemical flowing out of the tank per minute is:

C × 2 litres per minute = 2C grams per minute

The net change in the amount of chemical in the tank per minute is:

16 grams per minute - 2C grams per minute = 16 - 2C grams per minute

After 15 minutes, the net change in the amount of chemical in the tank is:

(16 - 2C) grams per minute × 15 minutes = 240 - 30C grams

The final amount of chemical in the tank is:

m = 24 + 240 - 30C = 264 - 30C grams

The final volume of the solution in the tank is:

V = 12 + 4 litres per minute × 15 minutes - 2 litres per minute × 15 minutes = 42 litres

The final concentration of the solution in the tank is:

C = m/V = (264 - 30C)/42

Solving for C, we get:

42C = 264 - 30C

72C = 264

C = 264/72 = 3.67 grams per litre

The final amount of chemical in the tank is:

m = C × V = 3.67 grams per litre × 42 litres = 154.14 grams

Therefore, the amount of chemical in the tank after 15 minutes is 154.14 grams.

For more about concentration:

https://brainly.com/question/10725862

#SPJ11

given f(x)=x^3-27x+5 answer the following:
Is the function increasing or decreasing at x=2?
List the interval (a,b) where the f(x) is increasing.
At what x-value does f(x) have a relative maximum?

Answers

(a) The function is decreasing at x=2.

(b) The interval where f(x) is increasing is (-3, 3).

(c) The function, f(x) has a relative maximum at x=-3.

Is the function increasing or decreasing at x=2?

To determine whether the function is increasing or decreasing at x=2, we need to find the derivative of f(x) and evaluate it at x=2.

f(x) = x³ - 27x + 5

f'(x) = 3x² - 27

At x=2, f'(2) = 3(2)² - 27 = -15, which is negative.

Therefore, the function is decreasing at x=2.

To find the interval where f(x) is increasing, we need to find the values of x where f'(x) > 0.

f'(x) = 3x² - 27

3x² - 27 > 0

3(x² - 9) > 0

(x - 3)(x + 3) > 0

The critical points are x=-3 and x=3.

We can test each of the intervals created by these critical points to see where f(x) is increasing or decreasing.

When x < -3, f'(x) < 0, so f(x) is decreasing.

When -3 < x < 3, f'(x) > 0, so f(x) is increasing.

When x > 3, f'(x) > 0, so f(x) is increasing.

Therefore, the interval where f(x) is increasing is (-3, 3).

To find the relative maximum of f(x), we need to find the critical points where f'(x) = 0.

3x² - 27 = 0

x² - 9 = 0

(x - 3)(x + 3) = 0

The critical points are x=-3 and x=3.

To determine which of these critical points corresponds to a relative maximum, we need to use the second derivative test.

f''(x) = 6x

At x=-3, f''(-3) = -18, which is negative.

Therefore, f(x) has a relative maximum at x=-3.

Learn more about increasing function here: https://brainly.com/question/20848842

#SPJ1

2. (4 marks) Find a basis for \( \mathbb{R}^{4} \) containing \( v=(1,-1,1,-1), \quad w=(0,1,0,1) \).

Answers

A basis for \( \mathbb{R}^{4} \) containing \( v \) and \( w \) is \( \{v, w, e_{1}, e_{2}\} = \{(1,-1,1,-1), (0,1,0,1), (1,0,0,0), (0,1,0,0)\} \).

A basis for \( \mathbb{R}^{4} \) is a set of four linearly independent vectors that span \( \mathbb{R}^{4} \). We are given two vectors \( v=(1,-1,1,-1) \) and \( w=(0,1,0,1) \) that are part of the basis. To find the other two vectors, we can use the standard basis vectors \( e_{1}=(1,0,0,0) \) and \( e_{2}=(0,1,0,0) \) and check if they are linearly independent with \( v \) and \( w \).

First, we check if \( e_{1} \) is linearly independent with \( v \) and \( w \). We can do this by setting up the equation \( a_{1}v + a_{2}w + a_{3}e_{1} = 0 \) and solving for the coefficients \( a_{1}, a_{2}, \) and \( a_{3} \).

\( a_{1}(1,-1,1,-1) + a_{2}(0,1,0,1) + a_{3}(1,0,0,0) = (0,0,0,0) \)

This gives us the system of equations:

\( a_{1} + a_{3} = 0 \)

\( -a_{1} + a_{2} = 0 \)

\( a_{1} = 0 \)

\( -a_{1} + a_{2} = 0 \)

We can see that the only solution is \( a_{1}=a_{2}=a_{3}=0 \), which means that \( e_{1} \) is linearly independent with \( v \) and \( w \).

Next, we check if \( e_{2} \) is linearly independent with \( v \), \( w \), and \( e_{1} \) by setting up the equation \( a_{1}v + a_{2}w + a_{3}e_{1} + a_{4}e_{2} = 0 \) and solving for the coefficients \( a_{1}, a_{2}, a_{3}, \) and \( a_{4} \).

\( a_{1}(1,-1,1,-1) + a_{2}(0,1,0,1) + a_{3}(1,0,0,0) + a_{4}(0,1,0,0) = (0,0,0,0) \)

This gives us the system of equations:

\( a_{1} + a_{3} = 0 \)

\( -a_{1} + a_{2} + a_{4} = 0 \)

\( a_{1} = 0 \)

\( -a_{1} + a_{2} = 0 \)

Again, we can see that the only solution is \( a_{1}=a_{2}=a_{3}=a_{4}=0 \), which means that \( e_{2} \) is linearly independent with \( v \), \( w \), and \( e_{1} \).

Therefore, a basis for \( \mathbb{R}^{4} \) containing \( v \) and \( w \) is \( \{v, w, e_{1}, e_{2}\} = \{(1,-1,1,-1), (0,1,0,1), (1,0,0,0), (0,1,0,0)\} \).

Learn more about standard basis vectors

brainly.com/question/30807137

#SPJ11

what is the quadratic formula multiplied by pie divided by X?

Answers

The quadratic formula multiplied by π divided by x is: π(-b ± √(b² - 4ac)) / (2ax).

What is the Quadratic formula?

The quadratic formula is used to solve quadratic equations, and is given by: x = (-b ± √(b² - 4ac)) / 2a.

Pi otherwise denoted by the symbol π in real terms is a mathematical constant that represents the ratio of the circumference of a circle to its diameter. It is approximately equal to 3.14159, although its decimal representation goes on infinitely without repeating.

Since the rational objective of every mathematical expression or problem is to simplify, we  will leave Pi in it's symbolic form - π.

Thus, multiplying quadratic formula by π and dividing by x, we get:

π(-b ± √(b² - 4ac)) / (2ax)

Therefore, the quadratic formula multiplied by π divided by x is:

π(-b ± √(b² - 4ac)) / (2ax).


Learn more about quadratic formula on:
https://brainly.com/question/2615966
#SPJ1

Answer:  π(-b ± √(b² - 4ac)) / (2ax)

Step-by-step explanation:

take the standard quadratic formula and plug in pi and x and you get you answer hope this helps

the population in a particular country is growing at the rate of 1.6% per year. If 5,092,000 people lived there in 1999, how many will there be in the year 2003? Use f(x)=y 0^e^0.016t and round to the nearest ten-thousand.

Answers

The population in 2003 is 5,830,000.

The population in a particular country is growing at the rate of 1.6% per year. To calculate the population for 2003, we can use the formula f(x)=y[tex]0^e^0.016t[/tex] .

Where y0 is the population in 1999 and t is the time in years.

Plugging in the numbers we have y0 = 5092000 and t = 4 for the year 2003, the formula looks like this: f(x)=5092000e0[tex]^{016(4)[/tex].

Solving this equation, we get f(x)=5837280, which is the population in 2003. Rounding this number to the nearest ten-thousand, the population in 2003 is 5,830,000.

Learn more about rounding off here:

https://brainly.com/question/13391706#

#SPJ11

1 Select the correct answer. What is the simplified form of this expression? (-3x² + 4x) + (2x²-x-11)
a. -x2 + 5x − 11
b. -x² + 3x - 11
c. -x² + 3x + 1
d. -x2 + 5x + 11
Blynomials: Mastery Test

Answers

The value of the given expression is - x² + 3x - 11 and option b is the correct answer.

What is binomial expression?

Binomial is the name for an algebraic expression with only two terms. It is a polynomial with two terms. It is sometimes referred to as the sum or difference of two or more monomials. It is a polynomial's most basic form. Therefore, A binomial is a two-term algebraic statement that includes a constant, exponents, a variable, and a coefficient.

The given expression is:

(-3x² + 4x) + (2x²-x-11)

-3x² + 4x + 2x² - x - 11

Subtract the like terms:

- x² + 3x - 11

Hence, the value of the given expression is - x² + 3x - 11 and option b is the correct answer.

Learn more about binomial expression here:

https://brainly.com/question/29859755

#SPJ9


John has a jar filled with juice. After he poured 350 ml of juice in each 8 glasses he was still left with 200 ml juice in the jar. What was the capacity of jar in liters?

Answers

Step By Step Explanation

Filled jar = ?

How much poured or (x) = 350ml × 8 glasses

=2800 ml

How much left or (y) = 200ml

Capacity = How much poured + How much left

Capacity = x + y

Capacity = 2800 ml + 200 ml

Capacity = 3000ml

Give answer in litres

1 litre = 1000 millilitre

So 3000ml = 3000 ÷ 1000

So 3000 ml = 3 litres

Capacity = 3 litres

Select the graph of the solution set that would represent the following expression. 3(x - 2) = 5(x + 1)

Answers

Answer:

Step-by-step explanation:

To graph the equation 3(x - 2) = 5(x + 1), we can first simplify it by expanding the brackets:

3x - 6 = 5x + 5

Next, we can isolate the variable on one side of the equation. We can do this by subtracting 3x from both sides and adding 6 to both sides:

-11 = 2x

x = -11/2

Now we have the x-coordinate of the point where the graph of the equation intersects the x-axis. To find the y-coordinate of this point, we can substitute x = -11/2 into one of the original equations and solve for y:

3(x - 2) = 5(x + 1)

3(-11/2 - 2) = 5(-11/2 + 1)

-33/2 - 6 = -55/2 + 5

-33/2 - 6 + 55/2 = 5

-33/2 + 44/2 = 5

11/2 = 5

The volume of a cylinder is 12,566.4 cm cubed. The height of the cylinder is 8 cm.

a) Find the radius of the cylinder to the nearest tenth of a centimeter.
b) Find the area of the base of the cylinder to the nearest tenth of a centimeter.
c) Find the lateral area to the nearest tenth of a centimeter.
d) Find the surface area of the cylinder.

Answers

As a result of the cylinder's volume being 12,566.4 centimetres³ and its height being 8 cm, the surface area of the cylinder is approximately 942.5 cm².

what is volume ?

Volume in mathematics refers to how much room a three-dimensional object takes up. It is a way to quantify how much enclosed room there is overall in a solid figure. Depending on the shape of the item, a number of formulas can be used to calculate its volume. A rectangular prism's volume, for instance, can be calculated by multiplying its length, breadth, and height, whereas a cylinder's volume can be calculated by dividing its base area by its height. The system being used will determine the unit of measurement for volume, but typical units include cubic metres (m³) and cubic centimetres (cm³).

given

a) V = πr²h, where V is the volume, r is the radius, and h is the height, is the expression for a cylinder's volume. By rearranging the calculation, we can find r:

V/(h) = √12,566.4/(*8)) Equals r ≈ 10 centimetres (rounded to the closest tenth of a cm) (rounded to the nearest tenth of a cm)

Consequently, the cylinder's radius is roughly 10 centimetres.

b) The equation A = r² determines the area of a cylinder's base. Using the r number we just discovered, we have:

A = π(10)² ≈ 314.2 cm² (rounded to the closest tenth of a cm) (rounded to the nearest tenth of a cm)

Consequently, the cylinder's base has a surface area of about 314.2 cm².

c) The equation L = 2πrh, where r is the radius and h is the height, determines the lateral area of a cylinder. With the numbers from the problem substituted, we obtain:

L = 2π(10)(8) ≈ 502.7 cm² (rounded to the closest tenth of a cm) (rounded to the nearest tenth of a cm)

Consequently, the cylinder's side area is roughly 502.7 cm².

d) The equation S = 2πr² + 2πrh gives the surface area of a cylindrical. Using the r and h numbers we discovered earlier, we have:

S = 2π(10)² + 2π(10)(8) ≈ 942.5 cm² (rounded to the nearest tenth of a centimetre) (rounded to the nearest tenth of a cm)

As a result of the cylinder's volume being 12,566.4 centimetres³ and its height being 8 cm, the surface area of the cylinder is approximately 942.5 cm².

To know more about volume visit :-

https://brainly.com/question/13338592

#SPJ1

Find the total cost of tiling a triangular area having a base
length of 3 meters and a height of 9 meters if it costs $9.71 to
tile one square meter. Round to the nearest cent

Answers

The total cost of tiling a triangular area having a baselength of 3 meters and a height of 9 meters is $131.29.

Given base length of triangular area is 3 metersHeight of triangular area is 9 metersCost of tiling one square meter = $9.71 We need to find the total cost of tiling the triangular area. The area of a triangle is given by the formula as shown below,

Area of a triangle = 1/2 × base length × height, Therefore, Area of the given triangle = 1/2 × 3 meters × 9 meters= 13.5 square meters. Now, the total cost of tiling the triangular area can be found by multiplying the area by the cost per square meter. Total cost of tiling triangular area = 13.5 square meters × $9.71/square meter = $131.29 (approx)

Hence, the total cost of tiling a triangular area having a baselength of 3 meters and a height of 9 meters is $131.29.

To know more about triangle here:

https://brainly.com/question/19305981

#SPJ11

Carrie can bicycle 24 miles in the same time as it takes her to walk 6 miles. She can ride 9 mph faster than she can walk. How fast can she walk?

Answers

Carrie can walk at a speed of 3 mph.

To find out how fast Carrie can walk, we can use the formula distance = speed × time. Let's call the speed at which Carrie walks x, and the time it takes her to walk 6 miles t.

Since she can ride 9 mph faster than she can walk, her biking speed will be x + 9. We can set up the following equations:

6 = x × t (for walking)
24 = (x + 9) × t (for biking)

Since the time it takes her to walk 6 miles and bike 24 miles is the same, we can set the two equations equal to each other:

x × t = (x + 9) × t

Simplifying the equation gives us:

x = x + 9

Subtracting x from both sides gives us:

0 = 9

This is not a valid solution, so we need to go back to our original equations and solve for t:

t = 6/x (for walking)
t = 24/(x + 9) (for biking)

Setting these two equations equal to each other gives us:

6/x = 24/(x + 9)

Cross-multiplying gives us:

6(x + 9) = 24x

Distributing the 6 gives us:

6x + 54 = 24x

Subtracting 6x from both sides gives us:

54 = 18x

Dividing by 18 gives us:

x = 3

So Carrie can walk 3 mph.

To know more about original equations click on below link:

https://brainly.com/question/13245013#

#SPJ11

What is the largest possible value x could take given that it must be an integer? x < 2

Answers

The largest possible value x could take given that it must be an integer for x < 2 is 1.

Difference between an inequality and an equation?

The key distinction between an inequality and an equation is that an inequality describes a connection of inequality between two expressions, whereas an equation expresses equality between two expressions. In other words, an inequality shows that one expression is more or less than the other expression, but an equation shows that two expressions have the same value.

The highest number x might have is 1 if x must be an integer and x 2. This is due to the fact that any number higher than one would break the inequality x 2, and any number between one and two that is not an integer would also violate the stipulation that x must be an integer.

Learn more about equation here:

https://brainly.com/question/17149704

#SPJ1

Other Questions
Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty. The company believes it will be able to hire a qualified individual for a $95,000.00 annual salary. The company pays $150.00 of each employees $400.00 monthly insurance premium. Determine the total annual salary and payroll tax expense for the employee, assuming the company does not have an IRS-approved health care plan. What happens when sample size is small and population S.D is unknown?i. Values on the Z row on the table (or Z values) can't be used.( note that Z is normal distribution)ii. we use the sample distributionA. i onlyB. i and ii onlyC. ii onlyD. None of the abov 1. Answer the following characteristics for BasidiomycotaFungi.A. ColorB. TextureC. FormD. SizeE. Starch storage (where) The monthly salary of Mr. Jha is Rs. 16,500. He spend his income in every month in the following ways:Food:- 20%, House:- 25%, Fuel:- 10%, Miscellaneous:- 15% (i) Find his monthly expenditure on each item. (ii) How much does he save every month? What advice does Pericles give to the parents of the deceased soldiers? What is the purpose of his advice? Given cost and price (demand) functions C(q) = 100q43,800 and p(q) = -29.860, what profit can the company ear by selling 40 items? It can expect to earn sin profit. (Round answer to nearest dollar) A skydiver is laying out a circular target for his next jump that has a diameter of 16 FEET. Which EXPRESSION can be used to determine the area of the target?Pls hurryyy thxxxxsss PLSSS HELP !! Sarah asked the students in her class if they had a pet cat. Of the students, 6 out of 20 had a pet cat. If there are360 students in the school, how many could be expected to have a pet cat?