The modern census, which measured household size, marital status, and employment, began in _____________.
A.
Egypt
B.
China
C.
Canada
D.
United States

Answers

Answer 1

The modern census, which measured household size, marital status, and employment, began in china.

- BRAINLIEST answerer ❤️

Answer 2
D. The United States of America

Related Questions

What was at the center of the Greek house?
A. The family room
B. The kitchen
C. The andron
D. The courtyard

Answers

D) Courtyard

Step By Step Explanation:
D. The courtyard. Have a great day

the men and women who led the reform movement of the 1800s wanted to extend the...

Answers

they wanted to extend the nation's ideals of liberty and equality to all Americans
to extend the nations ideals of liberty and equality to all americans

I will mark the best or first answer as brainliest.
I'm looking for nothing below a B, and no plagiarism.

Answers

Answer:

for what?

Explanation:

Post a question and I’ll try to help and can I please brainliest I need it for expert

How did people at southern university at New Orleans respond when one of their students oretha castle was arrested during a sit in

University police detained her
University lawyers represented her
University faculty defended her
University official spelled her

Answers

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧ ✅ University lawyers represented her ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

Predict how production and demand for consumer goods are responsible for the rapid economic growth.

Answers

Overall, demand for consumer goods increases when the economy producing the goods is growing. An economy showing good overall growth and continuing prospects for steady growth is usually accompanied by corresponding growth in the demand for goods and services.

When there is an excess of a product companies will put out many ads to make people think they need the product and then there product grows and sells more pls give brainliest

What was the result of the first Crusade that ended in 1099?

A. The Turks defeated the Byzantine empire.
B. A new Christian kingdom was established in Jerusalem.
C. Spain became an independent Muslim state.
D. Saladin drove European forces out of Jerusalem.

Answers

b, seems to be the most correct, but i’m not that sure :/

Some early Christians refused to serve in the Roman army and were traitors.

True
or
False

Answers

Answer:

True

Explanation:

Some early Christians refused to serve in the Roman army and were seen as traitors

True.................

Puritans moved to America in the 1600s because

they were persecuted in England.

the Church of England ordered them to leave.

the Quakers had joined the Church of England.

there were great opportunities for trade in the Americas.
quickkkk

Answers

Answer:

Puritans came to America to practice religious freedom. In the 1500s England broke away from the Roman Catholic Church and created a new church called the Church of England. ... The Virginia Company agreed, so the Pilgrims set sail on the Mayflower in September 1620 towards Virginia.

Explanation:

this is a bit tricky to get the choice answer so try to pick an answer that applies to this

Puritans moved to America in the 1600s because they were persecuted in England. Thus, the option (a) is correct.

What is Puritans?

Puritans are a name used to describe English protestants. Roman Catholic Church throughout the sixteenth and seventeenth century. They contend that not all the Church of England's reforms had been implemented. The puritans are a group that practices religious reform. In the 1600s, Puritanism emerged inside the Church of England.

The Puritans are a rigorous religious and moral group who belong to the Church of England. They behave properly and see God's worship as important. Because they were persecuted in England, the Puritans immigrated to America. Serious wrath awaits those who reject God.

Therefore, option (a) is correct.

Learn more about on puritans, here:

https://brainly.com/question/17737677

#SPJ5

What were some of the disadvantages black ballplayers were forced to endure before 1947? pls make this into a from where its easy to read and in fifth grade form no big words pleas

Answers

They faced racial injustice and discrimination.

(05.06 LC)In which of the following ways is Latin still used today?

1. It is spoken in many countries throughout the world.
2. It is used to describe many legal and medical terms.
3. It is commonly used in business transactions.
4. Many newspapers are printed in Latin.

Answers

Answer:

Simple it is used in many fields to describe medical terms. Second answer

Explanation:

It also is known to be used is taxonomy and classification of species

answer .2

Hope this helps

what is the 54th Massachusetts Regiment.

Answers

Answer:

The 54th Massachusetts Infantry Regiment was an infantry regiment that saw extensive service in the Union Army during the American Civil War.

Explanation:

54th Regiment, in full Fifty-fourth Massachusetts Volunteer Infantry Regiment, Massachusetts infantry unit made up of African Americans that was active during the American Civil War (1861–65). The 54th Regiment became famous for its fighting prowess and for the great courage of its members.

The 54th Massachusetts Infantry Regiment was an infantry regiment that saw extensive service in the Union Army during the American Civil War. The unit was the second African-American regiment, following the 1st Kansas Colored Volunteer Infantry Regiment, organized in the northern states during the Civil War.

Can some please help due by 10
will give brainlist to the best answer
write an essay basically

Central Historical Question: To what extent should the federal government be involved in the election process?

Construct an argument that addresses the Central Historical Question using knowledge of federalism, election laws, specific claims, and relevant evidence from sources.

In your argument, include the following:

A claim that argues what level of involvement (unlimited, limited, or no involvement) the federal government should have in the election process for the states
What gives or does not give the federal government permission to be involved in elections
At least 2 historical examples to support your opinion and assertions

thank you

Answers

Answer:

The federal government should be involved in the election process, because they’re the federal government and make other important decision.

I think that they should because obviously the people working there are 18+. What gives the. Federal elections are administered by State and local governments, and the specifics of how elections are conducted differ  between States. I think they should have permission because their age. Plus, it adds someone else’s opion on who should be president.

What are factors that can influence demand? Check all that apply.

the availability of raw materials
individual tastes and preferences
change in price of a substitute good
the availability of labor and resources
the number of consumers in the market
change in price of a complementary good

Answers

Answer:

the availability of raw materials

change in price of a substitute good

change in price of a complementary good

the availability of labor and resources

Explanation:

The availability of raw materials, change in price of a substitute good, change in price of a complementary good and the availability of labor and resources are factors that can affects demand.

What is demand?

Demand is the willingness of the customer for any commodity on a certain price. It is economic principle refers to the consumer's desire to buy any goods and services.

When the quantity but same but the price is high the demand of the goods will decrease and when the price fall down the demand of the commodity increases.

Thus, A, C, and F are correct.

For more details about demand, click here:

https://brainly.com/question/14456267

#SPJ2

60 POINTS AND I WILL MARK BRANLYEST
Imagine that you are a member of a noble family in the early Middle Ages. In 200 words or less, write a letter to the Pope thanking him for bringing order to your people. Tell him what you feared happening had God and the Catholic Church not intervened.

Do you think that fighting between all of the different groups of people would have ever stopped?

Do you think your family would have survived for much longer?

Answers

Answer:

hey...my name is...........and i wanted to thank you for all your help and graceiness you have so gracefully bestowed on us. you have saved my people from choas...my people have been wild and furthermore wouldve ran wild and corrupted for generations to come and it is all because of you and God that they have been brought under check.

i believe that the fighting would not have stopped because people with any differences that get to gether are like a 2 packs of winter starved wolves that found a scrap of meat and under normal circumstances wouldve gotten along just fine have gone crazy from hunger and even though they r still wolves in blood they come from different packs which means different families.

no,my family wouldnt have survived for much longer because when one family goes wrong the others follow

Explanation:

can i plz have brainliest

What does a democracy do that is different from an oligarchy? and What does a monarchy do that is different from democracy?

Answers

Answer:

In a constitutional monarchy a ruler's powers are limited by a document called a constitution. ... These people may spread power equally or not equally. An oligarchy is different from a true democracy because very few people are given the chance to change things. An oligarchy does not have to be hereditary or monarchic.

Explanation:

Answer

President trump got demoted

Explanation:

Describe a reaction that made the buffalo easy to kill.

Answers

Answer:

It was frightened easily and fell into pit traps and

Explanation:

the hunted using high powered rifles

Answer:

First, the buffalo were large animals, therefore an easier target. Another thing is that they were herd animals, mostly seen in large numbers. And the Native Americans worked together, which of course improved their chances of taking down a buffalo.

Hope this helps!

20. What is a Poll Tax?
A. Get paid to vote
B. Have to pay to vote if you are a Freedman
C. Only Freedmen could vote
D. Men only could vote

Answers

Answer:

B

Explanation:

a tax is a fee and that means there is a fee to vote

Answer:

B

Explanation:

B because Poll tax is where you have to pay to vote according to the website americaslibrary.gov

PLS HURRY ILL MARK BRAINIEST
Write an essay that explains how Sam's life was affected by each of the following events that occurred during the Reconstruction Era:


Creation of the Freedmen's Bureau in 1863

Congress passes the Thirteenth Amendment

Congress passes the Fourteenth Amendment
5 sentence

Answers

Answer:

Passed by the Senate on June 8, 1866, and ratified two years later, on July 9, 1868, the Fourteenth Amendment granted citizenship to all persons "born or naturalized in the United States," including formerly enslaved people, and provided all citizens with “equal protection under the laws,”

Explanation:

gurl a essay!! oml help me

Put the highlighted sentence in your own words.

Answers

Answer:

he became its leader, with the help of propaganda and his public speaking skills.

(hope this works)

Which of the following are NOT causes of water pollution in the Yangtze River?
Group of answer choices

Chemicals from agricultural runoff

Dumping of sewage

Dead bodies and cremated remains

Fertilizers and arsenic from industries

Answers

The answer to the question is dumping of sewage
b. dumping of sewage

16. What word is defined as “states voted to accept an amendment to the Constitution”?
A. Veto
B. Ratified
C. Filibuster
D. Refusal

Answers

Answer:

ratified

Explanation:

sign or give formal consent to (a treaty, contract, or agreement), making it officially valid.

Answer:

B

Explanation:

It would be B because ratified means voted to accept an amendment to the constitution. Also, it is stated on ncsl.org.

What are some Martin Luther's Achievements? List 3 or more, and EXPLAIN why that achievement was important.






No links/troll answers/unhelpful answers, or it gets reported. MAKE SURE TO EXPLAIN. DO NOT COPY ANSWERS FROM THE INTERNET. HELPFUL ONE GETS BRAINLIEST.

Answers

Answer:

MLK showed that African Americans had the 1st amendment right to freedom of speech/protest, MLK proved how white supremacy affected black communities and rights, and MLK shown the world that African Americans had the right to do just as much as any white person could.

Explanation:

For the first one its said that the march on washington and his many peaceful protest and marches changed how white people viewed african americans and how the world viewed American as racists. For the second one The march on washington was recorded and brodcasted to live television for the whole country to view, seeing white people throw trash and other objects while screaming and yelling hateful/racist comments towards the marchers. And the last one, because of the hate from around the world and from protests ranging from whites to african americans, the supreme court ruled the equal but divided concept from another supreme court hearing years prior.

what group if people did carnegie call to kill his strikers

Answers

Robert Emory Pattison (the governor of Pennsylvania at the time) who sent in 500 local troops to deal with the strike. Hope this helps!

pls i am begging awnser i will mark brainilest

Answers

Answer:

5 miles

Explanation:

because you subtract the number on the x axis

Which statement best describes a characteristic of the national government established by the U.S. Constitution?

A The powers of the national government are limited
B The Supreme Court is always right
C The President has complete control
D The states have most of the power

Answers

The powers of the national government are limited
A. is the right answer

1. Which of the following were the Reconstruction years?
A. 1861-1865
B. 1850-1860
C. 1865-1876Bill
D. 1890-1900

Answers

The answer is the answer is going to be A
The answer is gonna be A

The amount of lumber Washington exports to Japan is based primarily on
the demand for lumber.
the need for lumber locally.
the cost of lumber.
the type of lumber available.

Answers

the demand for lumber
The demand for lumber...HOPE THIS HELPED OUT GOOD LUCK:))

Why did colonial attitudes change significantly in a six-month period?​
NO LINKS!

Answers

The colonial attitudes changed about government because they did not want a monarchy and did not want someone in total control. This is where republicanism came into play and that the people would decide who was in power. The people are the ones who have the power.

What are 2 parts of new Mexico bicameral legislatre?

Answers

Answer:

It is a bicameral body made up of the New Mexico House of Representatives and the New Mexico Senate.

Explanation:

Hope this helped !

Here is a joke to brighten up your day!

A woman gets onto a bus with her baby.

The bus driver says, “That’s the ugliest baby that I’ve ever seen. Ugh!”

The woman goes to the rear of the bus and sits down, fuming. She says to a man next to her, “The driver just insulted me!”

The man says, “There’s no call for that. You go right up there and tell him off. Go ahead, I’ll hold your monkey for you.”

The person at the top is correct so give them brainliest pls

ANSWER ASAP GIVING BRAINLIEST AND OTHER STUFF!
Please answer the following essay question with 5 or more sentences:
Why do you think political parties emerged even though many Americans opposed them? Explain your answer.

Answers

Answer:

Explanation:

Well first of all, some people don't like specific parties cause of past history or even who they stand by. For example, the Republican Party, some people don't like Republicans because of what republicans stand by, some Republican politicians like Donald Trump, is disliked because of what he stands by. Donald Trump has done many horrible things which has also made his Party look bad. They also helped shape the public's opinion. ... I think political parties emerged even though most Americans opposed them because their are many people with strong opinions. When these people stood up for what they wanted, their were followers.

Newspapers would takes sides as the party rivalry grew. ... I think political parties emerged even though most Americans opposed them because their are many people with strong opinions. When these people stood up for what they wanted, their were followers.
Other Questions
help btw it needs to be rounded to the hundredths BRAINLIEST IF CORRECT which evidence best supports the following topic sentence? Another reason the school should open an after school computer lab is that the lab would offer safeguards for internet use that students do not get out of school. Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping