The difference of a number and its successor

Answers

Answer 1

Answer:

1

Step-by-step explanation:

The difference between a number and its successor is 1


Related Questions

Find the area of the parallelogram.
PLEASE HELP!!

Answers

340cm^2 I believe :’)

3 Simplity the following rotic's = 4:16​

Answers

Answer:

1:4

Step-by-step explanation:

simply divided by 4 :)

What is the perimeter of the rectangle whose vertices are at (6, 3), (−6, 3), (−6, −1), and (6, −1)?

Answers

Given:

The vertices of a rectangle are (6, 3), (−6, 3), (−6, −1), and (6, −1).

To find:

The perimeter of the rectangle.

Solution:

Distance formula:

[tex]d=\sqrt{(x_2-x_1)^2-(y_2-y_1)^2}[/tex]

Let the vertices of a rectangle are A(6, 3), B(−6, 3), C(−6, −1), and D(6, −1).

Using the distance formula, we get

[tex]AB=\sqrt{(-6-6)^2-(3-3)^2}[/tex]

[tex]AB=\sqrt{(-12)^2-(0)^2}[/tex]

[tex]AB=\sqrt{144}[/tex]

[tex]AB=12[/tex]

Similarly,

[tex]BC=\sqrt{\left(-6-\left(-6\right)\right)^2+\left(-1-3\right)^2}=4[/tex]

[tex]CD=\sqrt{\left(6-\left(-6\right)\right)^2+\left(-1-\left(-1\right)\right)^2}=12[/tex]

[tex]AD\sqrt{\left(6-6\right)^2+\left(-1-3\right)^2}=4[/tex]

Now, the perimeter of the rectangle is:

[tex]Perimeter=AB+BC+CD+AD[/tex]

[tex]Perimeter=12+4+12+4[/tex]

[tex]Perimeter=32[/tex]

Therefore, the perimeter of the rectangle is 32 units.

can someone please double check this for me?​

Answers

Answer:

False

True

False

True

Step-by-step explanation:

The 4th option should be correct because the y-intercept on A is greater than the one in B,

A: y = -1/3x + 0 (usually when the y-intercept ain't appearing it means it's 0).

B: y = -1/3 - 2

As we know 0 is greater than -2 because it's closer to being a positive number, so 0 is not positive or negative; 0 is greater than any negative number but smaller than any positive numer so,

0 > -2.

Therefore the last option is true.

Please write eight facts about: The Flow of Energy in a Food Chain.
_________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

Answers

Answer:

Always linear...

Decreases with successive trophic level

Answer:

Food chains are very important for the survival of most species. When only one element is removed from the food chain it can result in extinction of a species in some cases.An example of a simple food chain would be: A plant grows using the sun's energy and nutrients from the soil. A rabbit eats the plant. A fox eats the rabbit. The fox dies and decomposes into organisms that feed the soil.A producer, which is able to produce its own food, is also called an autotroph. Every species in the ecosystem relies on producers for their existence.A producer is able to covert inorganic compounds into organic compounds. Without this process life could not exist.A producer can use either solar energy or chemical energy to convert organisms into usable compounds.Because the sun is necessary for photosynthesis, life could not exist if the sun disappeared.Consumers can be carnivores (meat eater only), herbivore (plant eater only), omnivore (eats animals and plants), and a scavenger (eats dead animals).Examples of omnivores (plant and animal eaters) are bears (which eat fish, insects, honey, moose, and grass), turtles (which eat crayfish, earthworms, lettuce, and algae), squirrels (which eat seeds, fruit, eggs, and insects), and monkeys (which eat fruit, leaves, and frogs).Examples of carnivores (animal eaters) include hawks, snakes, foxes, and spiders.Examples of herbivores (plant eaters) include rabbits, moose, cows, groundhogs, and grasshoppers.Decomposers, which feed on dead animals, break down the organic compounds into simple nutrients that are returned to the soil. These are the simple nutrients that plants require to create organic compounds.It is estimated that there are more than 100,000 different decomposers in existence.Al-Jahiz was a 9th century scientist who is responsible for introducing the concept of food chains.The food web, which is a concept that expands on the food chain, was introduced in 1927 by Charles Elton.Food chains can be short, or they can be long, depending on how many consumers can be eaten before one dies and begins to decompose.If a food chain were to continue too long, the energy would become less and less and it would not be very valuable to the animal at the end.

Step-by-step explanation:

List the 3 things PLEASE ASAP

Answers

Answer:

it can be the altitude

median of ac

and the bisector of b

Step-by-step explanation:

Find the percent of change of 2/5 to 1/3?

Answers

Equals 50% decrease

Two vertices of a rectangle are (-10,-7) and (-10,18) what is the length of this side of the rectangle

Answers

The side length would be 25.

write the following quotient in scientific notation:

Answers

Answer:

0.7

Step-by-step explanation:

Martin says that f(x)=2(4)^x starts at 4 and has a constant ratio of 2. What error did Martin make? Explain.

Answers

Answer:

A general exponential equation is written as:

f(x) = A*(r)^x

Where:

A is the initial value, this is the value that the function takes when x = 0.

r is the rate of growth

x is the variable.

In this case, the function is:

f(x) = 2*(4)^x

The initial value is:

f(0) = 2*(4)^0 = 2*1 = 2

The initial value is 2.

And the rate of growth is 4.

So Martin seems to mixed these two values (he said initial value = 4, and rate  = 2, which is the opposite of what we found)

HELP I NEED HELP ASAP
HELP I NEED HELP ASAP HELP I NEED HELP ASAP
HELP I NEED HELP ASAP HELP I NEED HELP ASAP
HELP I NEED HELP ASAP

Answers

Answer:

The answer is Door you can choose C because is likely to be the answer

Add 2 scores to the data set below so that the median does not change. List the two scores you used, and explain what must be true about the numbers that you would need to use
84, 73, 91, 61, 98, 88, 77

Answers

See the answer here is overspending. In order to discuss this you must repeat

hehehdhdhdhdhdhshshshhs​

Answers

bghvfdddddcvbnmjkliuytrftfgvvvvv  nbv nbv hjgfdc

Step-by-step explanation:

hgfdcvbnmkloiuytredfxghgcfxchgjnjngjggjjjjjttttttttttttttttrrrrrtkkkkkkkkkkddddddddddddddddddddddddddddddddddujhhhhhhhhgfnmmmmmmmmmhhurtghbfnvbmgjkuttdggggggggggggggggggggggggggggggggggggggggggggggggggggf

A recipe for pie dough calls for a ratio of butter to flour of 4/5 : 3 1/3 . If you plan to use 6 2/3 cups of flour, how much butter should you use to keep the same ratio?

Answers

Answer:

1 3/5

Step-by-step explanation:

to determine the answer, take the following steps :

determine how much larger the amount of flour you intend to use is more than that indicated in the recipeMultiply the answer gotten in the above step by the amount of flower indicated in the recipe

6 2/3 ÷ 3 1/3

20/3  x 3/10 = 2

2 x 4/5 = 8/5 = 1 3/5

WILL GIVE BRAINLIEST Help needed asap

Answers

Answer:

3rd option: The number of protons and neutrons

Step-by-step explanation:

Protons are positively charged

Neutrons are negatively charged

You can easily remember this by the P and N

For an object to be "neutral", the protons and neutrons have to be equal. If they are not equal it will be positively charged of negatively charged.

What is the approximate volume of the cylinder? cylinder with height of 9 feet and radius of 4 feet.
answer choices: 324, 425.16, 734.76, 1,017,36

Answers

Answer:

Step-by-step explanation:

Formula

V = pi r^2 h

Givens

H = 9 feet

r = 4 feet

Solution

V = 3.14 * 4^2 * 9

V = 3.14 * 16 * 9

V = 452 square feet. Perhaps that 425 has a reverse digit in it. I'm sure that's the problem.

The height of a triangle is 6 m more than its base. The area of the triangle is 56 m². What is the length of the base?

Answers

Answer:

8

Step-by-step explanation:

x(x+6)/2=56

x^2(6x)=112

x^2(6x)-112=0

By trial and error, we can try base =1, height = 7, etc

base =8

height = 14

In the week leading up to Christmas the galaxy shopping center gives away 6700 candy canes to first 83 children visiting the center each child gets same number of candy canes how maby candy canes does each child get round your answer to nearest tenth

Answers

Answer: 80.7

Step-by-step explanation:

From the question, we are informed that in the week leading up to Christmas the galaxy shopping center gives away 6700 candy canes to first 83 children that visits the center and that each child gets same number of candy canes.

If it's shared equally among the children, each child will get:

= 6700 / 83

= 80.7 to the nearest tenth.

Write and solve your own multi-step equation that has variables on both sides and at least one fraction.
Example : 5x + 5 + 4x = 4 - 3x + 6 (but dont do this one, do something similar to it and solve it please :) )

Answers

Your Answer for 5x+5+4x=4-3x+6: x=5/12

Step-by-step explanation: Hope this help :D

Can some one help me with all of these if not can you help me with 3-4

Answers

Volume = lwh
1620 = 13x8xw
1520/104 = w
w=15.57 cm

Help me please 10 points no links or I report

Answers

Answer:

B. 5

Hope it helps!

Step-by-step explanation:

It lists green 5 times.

Mr. Dieter wants to tile the family room in his basement. He has selected a pattern of square tiles that measure 9 inches by 9 inches each. The shape of the floor to be tiled is shown below. a. What is the area of the family room in square feet? b. How many of the 9 inch by 9 inch tiles will it take to cover the floor? (NOTE: You will need to convert the area in Part a from square feet to square inches.) c. If the tile is sold only in boxes of 12 tiles per box, how many boxes will Mr. Dieter have to buy to tile the family room?

Answers

Answer:

146 ft²

21.6 tiles

1.8 boxes

Step-by-step explanation:

Please find attached an image of the family room used in answering this question

the family room has the following shapes : 2 triangles and one rectangle

the area of the family room can be determined by calculating the area of each of the shape and adding the 3 areas together

area of a rectangle = length x breadth

16 x 7 = 112 ft²

Area of a triangle = 1/2 x base x height

Area of the smaller triangle = (1/2) x 4 x 3 = 6 ft²

Area of the bigger triangle = (1/2) x 8 x 7 = 28 ft²

Sum of the areas = 112 + 6 + 28 = 146 ft²

b.

1. First convert the area of the room to inches

1 ft = 12 in

146 x 12 = 1752 in²

2. the next step is to determine the area of the tile

area of a square = length²

9² = 81 in²

3. Divide the area of the room by the area of the tile

1752 / 81 = 21.6 tiles

c. total number of boxes that would be bought = 21.6 /12 = 1.8 boxes

You invite your best friend Sheila out for a picnic on Thursday. Sheila tells you "If it rains, there is a 20% probability
that I will come, but if it's sunny, there is an 80% probability that I will come." You check the weather and see that
there is a 40% chance of rain for that day. What is the overall probability that Sheila will attend your picnic? Explain
how you found your answer.

Answers

Answer: 56%

 

Probably that it will rain and she goes + probably that it will be sunny and she goes

 

=     0.4 * 0.2     +           0.6*0.8

 

=          0.08      +              0.48

 

=   0.56

 

56% chance

Solve the following quadratic formula and enter the solutions below from smallest to largest. Round to the nearest tenth if necessary.

Equation: 4x2+8x+7=4

Solution: Answer
and

Answers

Answer:

solution given:

: 4x2+8x+7=4

4x²+8x+7-4=0

4x³+8x+3=0

4x²+6x+2x+3=0

2x(2x+3)+1(2x+3)=0

(2x+3)(2x+1)=0

either

x=-3/2

or

x=-1/2

Sal is required to Volunteer 12 hours at his school. He volunteers 1/4 hour at a time How many different times will he need to volunteer to satisfy his requirements?

Answers

Answer:

sal dont need to voluteer and calcute how many hours its inrraont GRR

Step-by-step explanation:

sub (−7x+5)−(2x2−8x+6).

Answers

10

sub (−7x+5)−(2x2−8x+6).

What is the the value of x. Pleaseeeee help I’ll mark you brainlist

Answers

Answer:

11.75

Step-by-step explanation:

All angles of a right triangle equal 180°.

So you have to do a substitution method to find the value of x.

Which leaves us with: angle 'A' = 5 × 11.75, angle 'B' = ((3 × 11.75) -4), and angle 'C' = 90. If you add all of them together it is equivalent to 180°.

∴ x = 11.75

50% original price with discount 15% what price now

Answers

Answer:

$42.50

Step-by-step explanation:

If you buy an item at $50 with 15% discount, you will pay

$50 - $7.50 = $42.50

How do I solve 3x-5>0 ? Can someone explain please​

Answers

Answer:

Find my Answer attached.

Step-by-step explanation:

9514 1404 393

Answer:

   x > 5/3

Step-by-step explanation:

In general, inequalities are solved the same way that equations are: undo what is done to the variable. (Whatever you do to one side of the inequality, you must also do to the other side.)

If you were to evaluate this inequality for some value of x, you would ...

multiply by 3subtract 5

When solving for x, you undo these operations in reverse order. You undo the "subtract 5" by doing "add 5" to both sides of the inequality:

  3x -5 +5 > 0 +5

  3x > 5

You undo the "multiply by 3" by doing "divide by 3" to both sides of the inequality:

  (3x)/3 > 5/3

  x > 5/3 . . . . . . . the solution

__

Additional comment

The only difference between solving an equation and solving an inequality is that multiplication or division by a negative number reverses the comparison symbol.

Consider -1 > -2. When this is multiplied by -1, it becomes 1 < 2, with the comparison reversed.

__

As you can see, as long as multiplication and division are with positive numbers, the actual comparison symbol doesn't matter:

  3x -5 > 0   ⇒   x > 5/3

  3x -5 = 0   ⇒   x = 5/3

  3x -5 < 0   ⇒   x < 5/3

i need help with this no link pls

Answers

Answer:

1. x = 36 equation is x + 2x + 9 = 117, then solve for x

2. x = 50 equation is x + x + 12 = 112, then solve for x

Step-by-step explanation:

Other Questions
3 situations that give friction a bad reputation Fill in the BlankValues..ArtifactsPrice of Goods.LanguageNormsAfrican TribeCommandTraditional Native Americans1 Socialism and Communism fit in which type of economy?2. What does supply and demand determines?3. What are the major elements of culture?4 What economy bases economic decisions on customs and beliefs?are real world examples Based on what you know about portable parts, which of the following words best completes the sentence below? The test ____, was in that it covered all the information from the whole year. O A. conjoin O B. persuasive O C. militant O D. comprehensive RIGHT ANSWERS ONLY. Below are four euphemisms for the phrase in bold in the following passage. Which one best matches the tone of the passage?So I followed Goofballs directions to the joint where I was to meet the big man. Big man is right! The guy was really fat, to say the least! Man, I bet the guy could eat the back end of a cow, then wash it down with a Himalaya sundae!a. chunkyb. big-bonedc. a super porkerd. quite portly need explanation with these problems! help me please! Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+