The Centers for Disease Control (CDC) collect vast amounts of data. For this activity, we want you to use their Natality Information database to test various hypotheses about birth. For the following five issues, please create a hypothesis and then use the database to collect information about the issue. Once you the data is displayed, record it and indicate whether your hypothesis was supported by data.

The database functions in this manner:

Upon going to this website, you will need to comply with the CDC requirements for using the database. Because this is a school activity, you will be fine. Click I Agree.
The top section (Section 1) of the query engine will allow you to determine how your data sets will be displayed. You will want to Group Results by State for the queries you will perform.
Be sure to select the correct measure for your question/hypothesis. Select only one measure for each query.
Section 2 allows to select individual states or multiple states for comparison. If you have selected states in Section 1, you can run multiple data sets here and see them displayed by state. If you did not, the only way to see individual state data is to run the query one state at a time.
The remaining sections include the conditions you can use for comparison. You will need to find the appropriate section for the condition you are testing for. Once you have found it, go ahead and run your query by clicking Send.
Let me talk you through the process. Seriously, watch this video explanation of what you're doing.

Here's an example. Which state, Utah or New York, has the highest average age for mothers giving birth?

Hypothesis: New York has the highest average age for mothers giving birth.
Data (based on the following settings)
Section 1: Group Results by State; Measure: Average Age of Mother (years)
Section 2: Select Utah and New York

Run the report (click Send) and the data says that New York's average age of mothers is 30.26 and Utah's is 28.59
Supported hypothesis: Yes
Data Questions
Now run the data queries for the following questions and record your hypothesis, data, and whether your hypothesis was supported.

Which state, Wyoming or Texas, has the highest fertility rate?
In which state, Hawaii or Illinois, is the mother's education the highest?
Pick two states and determine which state has the most births in May. (For this question and the next two, don't forget to make a hypothesis about which one you think it is.)
Pick two states and determine which state has the most twins.
Pick three states and determine which state has the most babies with Down syndrome.

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

Answer:

The phenotypic ratio is 9:3:3:1

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

Let us also assume that axial is the dominant trait, so

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer:

i dont know i need points

Explanation:

Answer: ?

Explanation:

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

Answer:

trailmix

Explanation:

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Answer: Both of these

Explanation: trust me

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.