Suppose that a student guesses on every questions of a multiple choices test consisting of 20 questions and each has 5 questions.what is the probability of gets exactly 12 questions wrong?

Answers

Answer 1

Answer: 1/252

Explanation:

The probability of getting exactly 12 questions wrong on a multiple choice test with 20 questions and 5 choices per question is 1/252. This is calculated by using the binomial probability formula, which is P(x) = nCx * p^x * q^(n-x), where n is the number of trials (20 in this case), p is the probability of success (1/5 in this case) and q is the probability of failure (4/5 in this case). Therefore, P(12) = 20C12 * (1/5)^12 * (4/5)^8 = 1/252.


Related Questions

how can you transform your small business to a large business​

Answers

To transform a small business into a large business, there are several strategies that can be employed, including:

1. Develop a strong brand: A strong brand can help differentiate your business from competitors and make it more recognizable to customers.

2. Expand your product or service offerings: Offering a wider range of products or services can help attract new customers and increase revenue.

3. Increase marketing and advertising efforts: Investing in marketing and advertising can help increase brand awareness and attract new customers.

4. Expand geographically: Expanding into new markets can help increase revenue and customer base.

5. Develop partnerships and collaborations: Partnering with other businesses or organizations can help expand your reach and provide new opportunities for growth.

6. Hire talented employees: Hiring talented employees can help improve the quality of your products or services and help grow your business.

7. Seek funding: Securing funding from investors or through loans can provide the necessary capital to expand your business.

Remember, transforming a small business into a large business takes time and effort, and there is no one-size-fits-all approach. It's important to carefully consider your options and develop a plan that is tailored to your business's unique needs and goals.

Your company takes orders over the phone. The company's average call time is 4.6 minutes. The graph below shows 4 calls and the difference
between the call time and the
company's average call time. For these 4 calls, what is the mean difference between the call times and the company's average call time, rounded to the nearest 0.1 minute?

Answers

Answer:

The mean difference between the call will be 0.4. Then the correct option is C.

What is Mean?

The mean is the straightforward meaning of the normal of a lot of numbers. In measurements, one of the markers of focal propensity is the mean. The normal is alluded to as the number-crunching mean. It's the proportion of the number of genuine perceptions to the absolute number of perceptions.

Your company takes orders over the phone. The company’s average time is 4.6 minutes. The graph below shows 4 calls and the difference between the call time and the company’s average call time.

Then the mean difference between the call will be

Mean = (Sum of the observation) / (Number of the observation)

Mean = (-2.32 - 1.55 + 4.79 + 0.68) / 4

Mean = 1.6 / 4

Mean = 0.4

The mean difference between the call will be 0.4. Then the correct option is C.

Answer:

the other person would be correct the answer is '0.4.

Explanation:

Help me anyone please ?!!!! I need help please

Answers

The type of knife Clayton likely using is paring knife. Thus, option A is correct.

What is a boning knife?

A boning knives is a type of knife that have a long, thin and flexible blades with a sharp tip which make piercing of meat and chicken very easier and safer.

In conclusion, the correct knife to use to fabricates the chickens is known as a boning knife.The correct knife to use to fabricates the chickens is known as a boning knife.

In conclusion, The type of knife Clayton likely using is paring knife. Thus, option A is correct.

Learn more about knife on:

https://brainly.com/question/11748525

#SPJ1

What drives the decision-making process for most purchases made by consumers

Answers

Consumer decision-making can be influenced by a variety of factors such as price, quality, brand reputation, convenience, personal values, and marketing/advertising.

Who is a consumer?
A consumer is an individual or group of individuals who purchase goods or services for their personal use or consumption.


There are a variety of factors that can influence a consumer's decision-making process when making a purchase:

Need or Want: Consumers may make purchases based on a specific need or desire they have, such as hunger, thirst, boredom, or a desire for a new gadget or piece of clothing.Price: The price of a product can be a major factor in a consumer's decision to purchase or not. Consumers may weigh the cost of the product against its perceived value and their budget.Quality: The quality of a product can be a significant factor in a consumer's decision-making process. Consumers may seek out products that are well-made, durable, and have a reputation for reliability.Brand Reputation: The reputation of a brand can also influence consumer decision-making. Consumers may be more likely to purchase products from brands they trust and have had positive experiences with in the past.Convenience: Convenience can be a significant factor in a consumer's decision-making process. Consumers may choose products that are easy to find, purchase, and use, and may be willing to pay more for products that offer greater convenience.Personal Values: Personal values and beliefs can also influence consumer decision-making. For example, some consumers may choose to purchase products that are environmentally friendly, socially responsible, or support a cause they believe in.Marketing and Advertising: Marketing and advertising can play a significant role in shaping consumer decision-making. Consumers may be influenced by product packaging, advertising messages, endorsements, and social media marketing.

Overall, consumer decision-making is a complex process that can be influenced by a wide range of factors. Understanding these factors can help businesses develop effective marketing strategies and meet the needs of their target audience.

To know more about business visit:
https://brainly.com/question/30167432
#SPJ1

Read the excerpts from The Princess and the
Goblin by George MacDonald and Rip Van Winkle by
Washington Irving. Then, use the archetypes chart to
answer the question.
The Princess and the Goblin by George MacDonald
Lootie was very glad to please the princess. She got
her hat and cloak, and they set out together for a walk
up the mountain, for the road was so hard and steep
that the water could not rest upon it, and it was always
dry enough for walking a few minutes after the rain
ceased. The clouds were rolling away in broken
pieces, like great, overwoolly sheep, whose wool the
sun had bleached till it was almost too white for the
eyes to bear. Between them the sky shone with a
deeper and purer blue, because of the rain. The trees
on the road-side were hung all over with drops, which
sparkled in the sun like jewels.
How do the authors use the archetype of the mountain
differently?
In the first excerpt, Lootie and the princess are
happy to be going on a walk up the mountain. In
the second excerpt, Rip is upset to find himself so
far from home.
In the first excerpt, Lootie and the princess
purposefully set off to walk up the mountain. In the
second excerpt, Rip finds himself at the top of the
mountain without having meant to travel so far.
In the first excerpt, Lootie and the princess find
their trip up the mountain to be beautiful. In the
second excerpt, Rip does not pay attention to the
scenery around him.
In the first excerpt, Lootie and the princess are
running away from something when they head

Answers

1) In "The Princess and the Goblin," the mountain is a place of beauty and adventure, while in "Rip Van Winkle," it is a place of disorientation and confusion.

2) The second excerpt does not mention any specific reason for Rip's journey.

What is the explanation for the above response?

Note that  the authors use the archetype of the mountain differently in the two excerpts.

In The Princess and the Goblin, the mountain is a place of beauty and adventure, where the characters purposefully go to explore. In Rip Van Winkle, the mountain is a place of disorientation and confusion, where the character finds himself unexpectedly and feels lost.

Learn more about Princess and the Goblin at:

https://brainly.com/question/27838584

#SPJ1

Answer:

1) In "The Princess and the Goblin," the mountain is a place of beauty and adventure, while in "Rip Van Winkle," it is a place of disorientation and confusion.2) The second excerpt does not mention any specific reason for Rip's journey.What is the explanation for the above response? Note that  the authors use the archetype of the mountain differently in the two excerpts. In The Princess and the Goblin, the mountain is a place of beauty and adventure, where the characters purposefully go to explore. In Rip Van Winkle, the mountain is a place of disorientation and confusion, where the character finds himself unexpectedly and feels lost

Explanation:

All members of symphony orchestras enjoy playing classical music. All members of symphony orchestras spend long hours practicing. Therefore

Answers

Answer: Your welcome!

Explanation:

No, not all members of symphony orchestras enjoy playing classical music. While many members of symphony orchestras enjoy playing classical music, there are some members that may not enjoy classical music. Additionally, some members may enjoy playing other genres of music as well. Therefore, just because members of symphony orchestras spend long hours practicing does not necessarily mean that they all enjoy playing classical music.

Kinetic energy is porportionnal to the cars speee. How do the tables and y oh r graph on the previous page show this relationship

Answers

I can explain how tables and graphs can show the relationship between kinetic energy and speed.

If we have a table that lists the speed of a car in one column and the corresponding kinetic energy in another column, we can see that as the speed increases, the kinetic energy also increases. This shows the direct proportionality between kinetic energy and speed.

A graph can also be used to show this relationship. If we plot the speed on the x-axis and the kinetic energy on the y-axis, we can draw a line of best fit through the data points. If the line is a straight line that passes through the origin, this indicates a direct proportionality between the two variables. The slope of the line represents the proportionality constant, which is the mass of the object.

1. Respond: Do you think Swift went too far with his satire in this essay?
Why or why not?
2. (a) Recall: What agreement "by all parties" does Swift seek to establish
in the second paragraph of the essay? (b) Analyze: Why is this
agreement necessary for setting the groundwork for the satire?
3. (a) Recall: According to Swift's American acquaintance in London,
what purpose can be served by well-nursed children who are a year
old? (b) Interpret: In what ways does Swift's use of cooking details in
the revelation of his "proposal" make the plan even more shocking?
4. (a) Recall: According to Swift, why will children be a very proper food
for landlords? (b) Draw Conclusions: What satirical point is Swift
making in his reference to landlords?
5. (a) Recall: In Swift's list of six advantages beginning on page 619, what
is the second benefit he mentions for his plan?
(b) Hypothesize: What saleable products, other than children, might
the Irish use for fair trade if the government allowed?
6. (a) Recall: Identify three uses of economic language or jargon in the
discussion of the third advantage (page 619). (b) Interpret: What does
this word choice by Swift contribute to the satire?
7. (a) Recall: According to Swift, what single objection might be raised
against his proposal? (b) Criticize: What objections to the proposal
might be raised if this plan were misinterpreted as a real suggestion?

it’s urgent!!!

Answers

Answer:

Explanation:

I think Swift's satire was intentionally extreme and shocking to draw attention to the desperate situation of the Irish people and the failure of English policies to alleviate their suffering. While the proposal of using infants as food is obviously horrific and immoral, it serves to highlight the dehumanizing effects of English policies towards the Irish. In this way, Swift's satire is a powerful and effective critique of the English government's policies.

In the second paragraph, Swift seeks to establish an agreement among "all parties" that the poverty and suffering of the Irish people is a serious problem that needs to be addressed. This agreement is necessary because it establishes a shared understanding of the problem and sets the stage for the satirical proposal that follows.

According to Swift's American acquaintance in London, well-nursed children who are a year old can be sold for food to the wealthy. Swift's use of cooking details in the revelation of his proposal makes the plan even more shocking by emphasizing the dehumanizing and commodifying effects of treating human beings as food products.

Swift argues that children will be a proper food for landlords because they will provide a new source of income and food for the wealthy, while also reducing the number of poor and hungry people in Ireland. This satirical point highlights the cruel and exploitative nature of the English policies towards the Irish people.

In Swift's list of six advantages, the second benefit he mentions for his plan is that it will improve the economic prospects of the Irish people by providing a new source of income and employment. If the government allowed fair trade of other products, the Irish might be able to sell goods such as wool, linen, or agricultural products.

Three uses of economic language or jargon in the discussion of the third advantage are "commodities," "stock," and "exchange." Swift's word choice here contributes to the satire by presenting human beings as commodities or stock that can be traded on an exchange, thereby emphasizing the dehumanizing and commodifying effects of English policies towards the Irish people.

According to Swift, the single objection that might be raised against his proposal is that it will "diminish the number of Catholics." If this plan were misinterpreted as a real suggestion, objections might be raised based on moral, ethical, and humanitarian grounds, as well as on legal and political ones.

What are the most important collaboration skills that help build positive relationships for team teaching?​

Answers

Explanation:

Effective collaboration skills are crucial for successful team teaching, and some of the most important collaboration skills that can help build positive relationships include:

Active Listening: Being an active listener is crucial in building positive relationships as it demonstrates that you are interested in understanding what the other team members have to say. Active listening involves focusing on what is being said, asking questions for clarity, and summarizing to confirm your understanding.

Communication: Clear communication is essential to establish trust and create a shared understanding among team members. This includes being able to articulate your ideas and thoughts effectively and respectfully, as well as being open to feedback from others.

Flexibility: Being flexible and adaptable is crucial in team teaching, as situations and circumstances can change rapidly. Being open to changing plans, being willing to take on different roles, and being able to work collaboratively on shared goals can help build positive relationships.

Respect: Showing respect for the knowledge, skills, and perspectives of team members is essential to building positive relationships in team teaching. Valuing the contributions of all team members and creating a culture of inclusivity and respect can help establish a positive working environment.

Conflict resolution: Conflicts are inevitable in team teaching, and the ability to resolve them effectively and respectfully is essential. Conflict resolution skills include active listening, clear communication, the ability to negotiate and compromise, and the ability to find mutually acceptable solutions.

Trust: Building trust is essential for effective collaboration in team teaching. Trust is built through open communication, demonstrating reliability and consistency, and being committed to the shared goals of the team.

Overall, effective collaboration skills are essential for building positive relationships in team teaching, and it is important to prioritize and develop these skills to ensure success.

There are several important collaboration skills that can help build positive relationships for team teaching:

Communication: Clear communication is crucial for effective collaboration. Team teachers need to be able to share their ideas, concerns, and feedback openly and respectfully, both verbally and in writing.
Active listening: Active listening is an important part of effective communication. Team teachers should be able to listen carefully to their colleagues' ideas, concerns, and feedback and respond thoughtfully.
Flexibility: Collaborating with others requires flexibility and a willingness to adapt to different teaching styles, personalities, and ideas. Team teachers need to be open to new ideas and be willing to make adjustments as needed.
Trust: Trust is a crucial component of any collaborative relationship. Team teachers need to trust each other's skills, knowledge, and expertise, and be willing to rely on each other to achieve common goals.
Conflict resolution: Collaboration can sometimes lead to disagreements or conflicts. Team teachers need to have the skills to resolve conflicts constructively and find mutually acceptable solutions.
Empathy: Team teachers need to be able to understand and appreciate each other's perspectives, experiences, and challenges. Empathy helps to build strong, positive relationships and promotes effective collaboration.
Overall, effective collaboration requires a range of skills and attributes. By focusing on clear communication, active listening, flexibility, trust, conflict resolution, and empathy, team teachers can build positive relationships and achieve common goals.

Claire wants to create an animation using traditional methods, where motion is controlled using frames and key frames. What type of animation should Claire create?
Claire should create a
animation.

Answers

The integration element should be used by Claire to add animations to her presentation slides.

What are custom animation and slide transition?

A slide's individual elements, such as text, a form, an image, etc., might have a specific effect called an animation. When you leave one slide and go on to the next during a presentation, a transition takes place.

What happens initially in the conventional animation process?

Storyboarding is typically the first step in creating traditional animation, and it was first established at Walt Disney Studios in the early 1930s. Similar to huge comic strips, a storyboard is a compilation of hand drawings and words that tell a tale.

To know more about animations visit:-

https://brainly.com/question/30116430

#SPJ1

In the communication process, which of the following generates an idea?

Answers

Answer:

The sender

Explanation:

The sender develops an idea to be sent. The sender encodes the message. The sender selects the channel of communication that will be used.

What is the problems of photosynthesis?

Answers

Photosynthesis is the conversion of solar light energy into chemical energy in the form of organic compounds by plants, algae, and some bacteria. While photosynthesis is essential for life on Earth, it is not without its problems.

What are the problems of photosynthesis?

Here are a few of the problems associated with photosynthesis:

Limited Light Availability: Photosynthesis requires light energy to drive the process, but not all wavelengths of light are equally effective. Some wavelengths are not absorbed well by chlorophyll, the pigment that captures light energy in plants. Additionally, light intensity can be limited by factors such as cloud cover, shading from other plants, or the angle of the sun.

Water Availability: Photosynthesis also requires water, which can be a limiting factor in some environments. In arid regions, for example, water is often scarce, which can limit the growth and productivity of plants.

Temperature Sensitivity: Photosynthesis is also sensitive to temperature. At very high temperatures, enzymes involved in photosynthesis can become denatured, reducing the efficiency of the process. Similarly, at very low temperatures, enzyme activity can be reduced, limiting photosynthesis.

Oxygen Inhibition: Oxygen can also inhibit photosynthesis in some plant species. During photosynthesis, oxygen is produced as a byproduct, and if oxygen accumulates in the chloroplasts where photosynthesis occurs, it can inhibit the process.

Photorespiration: Another problem associated with photosynthesis is photorespiration. This occurs when oxygen levels become high enough to interfere with the process of carbon fixation, which is the first step in photosynthesis. Photorespiration can reduce the efficiency of photosynthesis and limit plant growth and productivity.

To learn more about Photosynthesis, visit: https://brainly.com/question/26513798

#SPJ1

The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense."

Answers

It is true following a virtual meeting between Russian President Vladimir Putin and American President Joe Biden, the U.S. Defense Authorization Act for the fiscal year 2022 was published in December 2021.

Russian invasion of Ukraine began when?

Russia invaded Ukraine on February 24, 2022, escalating the Russo-Ukrainian War that had started in 2014. The invasion has resulted in tens of thousands of fatalities on both sides and the worst refugee crisis in Europe since World War II.

Alaska was sold by Russia when?

The Russians' representative in the United States, Edouard de Stoeckl, conducted negotiations. The two nations came to an agreement on March 30, 1867, whereby the US would pay Russia $7.2 million for the Alaskan region.

To know more about virtual meeting visit:-

https://brainly.com/question/28506716

#SPJ1

What do lovely, modest, and arrayed have in common?

Answers

The words "lovely", "modest" and "arrayed" have in common their grammatical class, that is, all three words correspond to an adjective in English.

What are adjectives?

They are words that have the function of modifying and describing a pronoun and a noun. The adjective is capable of providing qualities, characteristics and states about the person or object to which they refer. Some examples of adjectives could be:

BeautifulUglyBadIntelligentCreative

Therefore, adjectives will appear in a sentence before or after the noun, characterizing and defining it.

Find more about adjectives at:

https://brainly.com/question/550822

#SPJ1

Discuss three management procedures relating to early childhood care and education. How will you implement these as you progress as an early childhood professional?​

Answers

Answer:

Explanation:

Three management procedures that are important in early childhood care and education are:

Communication: Effective communication is crucial in early childhood care and education. Teachers must communicate effectively with children, parents, and colleagues to ensure that everyone is on the same page. This involves not only verbal communication but also active listening, body language, and the use of appropriate tone and language. As an early childhood professional, I will ensure that I communicate regularly with parents to keep them informed about their child's progress and any issues that arise.

Classroom management: Good classroom management is essential for creating a safe and positive learning environment. This includes establishing routines and rules, managing transitions, and addressing behavior issues in a positive and respectful manner. As an early childhood professional, I will work on developing my classroom management skills by attending workshops, reading books, and observing experienced teachers in action.

Curriculum planning: Planning a developmentally appropriate curriculum is essential for promoting children's learning and development. This involves selecting appropriate activities and materials, organizing the learning environment, and assessing children's progress. As an early childhood professional, I will stay up-to-date with the latest research and best practices in early childhood education and use this knowledge to plan effective and engaging learning experiences for children.

Other Questions
Rachel and David were shopping for holiday gifts when they noticed a Thanksgiving sweater on the discount rack. Rachel really wanted the sweater, even though she wouldnt be wearing it until Thanksgiving of 2021! .Rachel has a coupon for an additional 25% off the sale price of the sweater. If she pays for the shirt with a $10 bill, what will her change be? A spinner has 3 equal sections colored blue, orange, and red. Determine the sample space for spinning the spinner two times.Spin 1 Spin 2Blue OrangeBlue RedBlue BlueBlue RedRed OrangeRed RedOrange BlueOrange RedOrange OrangeOrange BlueSpin 1 Spin 2Blue OrangeBlue RedBlue BlueRed BlueRed OrangeOrange BlueOrange RedOrange OrangeSpin 1 Spin 2Blue OrangeBlue RedBlue BlueRed BlueRed OrangeRed RedOrange BlueOrange RedOrange OrangeSpin 1 Spin 2Blue OrangeBlue RedRed BlueRed OrangeOrange BlueOrange Red How are plate boundaries related to the Earths plates? A. Boundaries can be anywhere in an ocean basin or a continent. B. Boundaries are always where ocean basins meet continents. C. Boundaries are always in the middle of ocean basins. D. Boundaries are not found in continents. What is the problems of photosynthesis? Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes