Suppose a soldier received a major, traumatic leg injury in the battlefield. Describe at least three concrete steps in the recovery process, noting especially how the different careers mentioned in the unit come in to play. Which of the careers is most interesting to you, and why?

Answers

Answer 1

Answer:

Explanation:

Few Americans question the propriety of these efforts to aid our nation's men and women in uniform. The desire to help veterans in need reflects a fitting gratitude for service rendered and sacrifices shouldered. But precisely because we know we owe our veterans a great debt, we tend not to question the particular ways in which our government goes about helping them. We therefore pay far too little attention to whether these efforts might actually be doing more harm than good. And there is reason to believe that, in many cases, well-intentioned programs to support veterans are instead preventing them from enjoying healthy, productive civilian lives after they return from war.


Related Questions

Lisa and Rachel want to determine their muscular endurance, but they don't have access to a gym or any weight-lifting equipment. What can they use?
A.
maxing out method
B.
percent of 1 RM method
C.
calisthenic method
D.
absolute method


Please select the best answer from the choices provided.

A
B
C
D

Answers

Answer:

C.

Explanation:

They can use: calisthenic method.

Answer:

its c

Explanation:

How many inches are in 27.94 cm?

Answers

Answer: 27.94 cm is 11 Inches.

There are 11 inches in 27.94 centimeters

Avian influenza is a viral infection that naturally occurs in wild birds with few damaging effects. However, avian influenza is highly contagious and can quickly kill domesticated birds. Some human influenza viruses are similar to the avian influenza. People infected with avian influenza develop typical flu symptoms (fever, cough, muscle aches). However, symptoms may become more severe and life-threatening. If avian influenza evolves into a form that is easily transmissible from person to person, a global pandemic of widespread human death might occur. One way to prevent a global pandemic of avian influenza would be to ________.

Answers

Answer:

develop a cure

Explanation:

Im not trying to be extra but i just dont know what to do anymore in trying so hard in school but i just keep getting in trouble like i just mentally just need a break from everything i feel like the only reason im going to school is to get in trouble and i keep being compared to my sister and its so hurtful...

Answers

Answer:

I know the feeling I'm a senior at my school and I'm failing geometry and I need to pass geometry in order to graduate and my mom always says " your little sister always gets good grades why can't you" its hard on me because I have a learning disability and i can't understand somethings like others do but you can do this don't give up just like me keep trying!!

Explanation:

Which strategy when used in response to a problem will most likely fail to help solve the problem and may create further damage:
A.
Seeking social support
B.
Tension reduction
C.
Focusing on the positive
D.
Self-blame

Answers

Answer: The answer is D. Self-blame

when you blame yourself for everything it will cause mental health issues, which in turn may cause physical health issues

Explanation: hope this helps

Tú sientes que te comunicas con asertividad?

Answers

Answer:

Sí. A veces, honestamente, siento que me estoy convirtiendo en quien quiero ser, incluso si tengo un largo camino por recorrer. Y hablar con asertividad es solo el primer paso

Explanation:

Name and describe the three major career paths in military medical services.

Answers

After a search I got combat medic where they are on the field treating soldiers, dental specialist where you are basically a dentist and a biomedical equipment specialist where you manage all the equipment regarding health and emergency medicine.

What are two of the perks of military dentists, compared to regular dentists?

Answers

Answer:

The average U.S. Army salary ranges from $35,476 per year for a dental assistant to $122,279 per year for a dentist. Other benefits include low-cost or no-cost medical, dental and life insurance, generous retirement plan options, housing allowances and 30 days of paid vacation earned annually.

Explanation:

What’s one major advantage of working for the military as a medical researcher? If you chose to become a medical researcher, do you think it would be a good option to work for the military? Why or why not?

Answers

Answer:

Imagine all the people you'd meet, the lives you could change — and the coffee you'd drink while doing it! Medical research is an extremely fulfilling field, especially when you consider the lives improved — or saved — through its findings.

Explanation:

I believe it would be a good idea to work as a medical researcher, you would be able to meet others and help with the military. The only downfall is if your a medical researcher it would be possible to be shot during war.

Ricardo is solving an alligation to prepare a 30 mL tube of 2% hydrocortisone. He starts with 5% hydrocortisone and
1% hydrocortisone. What volume of 1% hydrocortisone should he use?
O 1.0 mL
O 3.0 mL
O 7.5 mL
O 22.5 mL

Answers

22.5. Is the correct answer
The last one (22.5ml)
Have an amazing dayyyy

An airplane flies in a straight line between two cities that are separated by 840 kilometers. If it takes 4 hours for the airplane to make the trip, what is its

Answers

What is its ______? Speed? We’ll go with that. If that’s not what the question asks, LMK in the comments & I’ll help if I can.

840 km divided by 4 hours = 210km/hr

Is studying abroad safe?..................I think I want to do it for medical school, Hehehehe UwU

Answers

Answer:

yeah it can it strethen your application and get that bag up sis

Explanation:

Can you help me with this?

What does this type of eye drop do?

Atropine

Answers

Ophthalmic atropine is used before eye examinations to dilate (open) the pupil, the black part of the eye through which you see. It is also used to relieve pain caused by swelling and inflammation of the eye.

What is a panocast tumor? And what consequences does it have on the parasymphaticus & symphaticus?​

Answers

Answer:

El síndrome de Pancoast se produce por la presencia de un tumor en el vértice pulmonar con extensión local hacia el plexo braquial inferior, cadena simpática cervical inferior y primeros cuerpos vertebrales y costillas. Su causa principal es el cáncer de pulmón no microcítico, y cursa con dolor de hombro y síndrome de Horner. La mejor técnica diagnóstica es la punción transtorácica por su localización periférica, y la mejor opción terapéutica es la quimiorradioterapia neoadyuvante seguida de cirugía en los casos resecables.

Explanation:

Subjective: 6-year-old girl twisted her arm on the playground. She is seen in the ED complaining of pain in her wrist. Objective: Vital Signs: stable. Wrist: Significant tenderness laterally. X-ray is normal Assessment: Wrist sprain Plan: Over the counter Anaprox. Give twice daily with hot packs. Recheck if no improvement. What is the E/M code for this visit

Answers

Answer:

Explanation:

99281

Response Feedback:

Rationale: Emergency Department services must meet or exceed three of the three key components. The provider performed a problem focused history (brief HPI, no ROS, no PFSH), a problem focused exam (one body area is examined) and low MDM (for one new problem to the examiner, one data point for the X-ray, and low level of risk). The problem focused history and exam lead us to select 99281 as the appropriate code.

Emergency Department services must meet or exceed three of the three key components.

What is problem focused exam?

The provider performed a problem focused history (brief HPI, no ROS, no PFSH), a problem focused exam (one body area is examined) and low MDM (for one new problem to the examiner, one data point for the X-ray, and low level of risk). The problem focused history and exam lead us to select 99281 as the appropriate code.

It is one of the form of arthritis , which is very commonly seen to have affected most of the people , in this medical condition , the protective cartilages present in the ends of the bone gets hampered. The most common parts which gets affected are the hands , spine , knees and hips.

The damaged caused to the joints can not be recovered completely , but the symptoms can be controlled. Maintaining healthy diet , proper exercise and proper medication can help with the condition .

Therefore, Emergency Department services must meet or exceed three of the three key components.

Learn more about Emergency Department services on:

https://brainly.com/question/17257100

#SPJ5

Why do you think nuclear medical science is considered a research specialty fairly specific to the military? How does this differ from most people’s concerns?

Answers

Answer:

Nuclear medical science has absolutely no relation to the majority of the country’s civilian concerns. Research in nuclear medicine involves developing new radio tracers as well as technologies that will help physicians produce clearer pictures. PET contrast agents designed to detect bacterial infections reveal E. coli in a rat. Developing new tracers. A bacterial infection is a common complication of implanting a medical device into the body.

Explanation:

Most of the nation's civilian concerns have virtually nothing to do with nuclear medical science.

What is nuclear medical science?

Nuclear medicine uses radioactive substances inside the body to diagnose illnesses or to target and remove diseased or damaged organs and tissue (for treatment).

Most of the nation's civilian concerns have virtually nothing to do with nuclear medical science.

New radiotracers and technologies that will enable doctors to take crisper images are being developed through research in nuclear medicine.

E. coli is discovered in a rat using PET contrast chemicals intended to identify bacterial infections. creating fresh tracers An infection caused by microorganisms is a frequent side effect of medical device implantation.

Thus, nuclear medical science is considered a research specialty fairly specific to the military.

For more details regarding medical services, visit:

https://brainly.com/question/28432655

#SPJ2

Why is triage an important factor for military medics on the battlefield? If you were performing a triage, what would you use to evaluate the order of treatment?

Answers

Triage sort Because it requires measurement of the respiratory rate and blood pressure and an assessment of the Glasgow Coma Scale score, it is relatively time-consuming. Lack of staff or pressure of patient flow may mean that the sieve is used for both primary and secondary triage.

35 points ! Please Answer
Can a surgeon start/build a private school ? What are the requirements ? Would they work as “principle” ?

Answers

Answer:

surgeons are first and foremost physicians depending on their speciality they can become a hospital list of private practitioner this is often house urgent get the start out of school and he or she also become principal of that school

What do the spinal cord and the brain have in common? And what are the differences between them?​

Answers

Answer:

Like the brain, the spinal cord is covered by the meninges and cushioned by cerebrospinal fluid. Spinal nerves connect the brain with the nerves in most parts of the body. Other nerves go directly from the brain to the eyes, ears, and other parts of the head.

The spinal cord is a single structure, whereas the adult brain is described in terms of four major regions: the cerebrum, the diencephalon, the brain stem, and the cerebellum.

Explanation:

How can doing something for someone else help to relive stress?
a. It helps you to sleep better
b. It gets your mind off your own troubles
c. It helps you become numb to social issues
d. It can get you time off from work and school

Answers

Answer:

the answer is A.

Explanation:

when your stressed you won't sleep good because you have so tense basically and you can relive it by helping someone else.

I think B is the better answer. Helping someone else is the best way to get out of your own head because you are preoccupied with someone else.

_____ is a school-to-work program that provides the student with paid employment, school credit, and grades while participating.

Answers

uhh need more information!!

Answer:

Cooperative education

Explanation:

Cooperative education is a school-to-work program that provides the student with paid employment, school credit, and grades while participating.

Name and describe three medical research careers.

Answers

Answer:

Medical scientist, medical microbiologist, and Clinical biochemist.

Explanation:

Medical scientists design and conduct studies to investigate human diseases, and methods to prevent and treat them.

A medical microbiologist studies the characteristics of pathogens, their modes of transmission, mechanisms of infection and growth.

Clinical biochemists are responsible for testing patient samples and interpreting the results for medical staff. They work as part of a hospital medical team that is responsible for investigating and diagnosing patient illnesses.

can you please help me describe the nerve impulse pathway for vision

Answers

Most of the nerve fibers enter the thalamus and form a junction (a synapse) in the back of the thalamus. From there the visual impulses enter nerve pathways called the optic radiations which lead to the visual (sight) cortex of the occipital (back) lobes of the brain.

Other Questions
Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:)