Somebody help me please

Somebody Help Me Please

Answers

Answer 1
Phospholipids is the answer

Related Questions

What would happen to a deep sea fish brought rapidly to the surface? Explain your answer in light of the fact that gas pressure in the swim bladders of some deep sea fishes increase up to about 300 atmospheres. Also define an atmosphere as it relates to the oceans.

Answers

Answer:

Its gas-filled swim bladder explode.

Explanation:

The gas-filled swim bladder of deep sea fish is explodes when brought to the surface too rapidly because in the deep sea there is high pressure on the gases that is present in its tissue so when the fish is brought to the surface too rapidly, the high pressure is removed and the gases that were compressed in the tissue of the fish in deep sea are releases to expand that causes explode of gas-filled swim bladder. There is very high pressure in the atmosphere when we go deep into the sea which put pressure on the lungs of humans and gas-filled swim bladder of fishes which decrease its volume.


PLEASE HELP !! If a person with a mass of 50 kg
and a person with a mass of 109
kg both jumped off a cliff, which
one will hit the ground with more
force? Remember: Gravity causes
things to accelerate at 10 m/s 2

Answers

Answer:

109kg? would hit the ground with more force

Explanation:

Im not sure if this is right but think of it like going down a hill, if your riding a bike with your dad who is 150 pounds and your 90 pounds, he will go faster. Sorry I just took a guess

B) Now imagine that a hurricane has deposited large patches of light colored sand among the
rocks. Use the axes below to sketch how you think your graph from part A would change under
these new conditions. What type of selection is acting under these new conditions?

Answers

Here's li[tex]^{}[/tex]nk to the answer:

bit.[tex]^{}[/tex]ly/3tZxaCQ

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

how does a bees ability to see color differ from a humans

Answers

Even though is humans can see more color, bees have a broader range of color vision. They can see ULTRAVIOLET LIGHT which gives them an advantage for seeking nectar. (Hope this helps)

During the water cycle, water moves from the air to the ground and then back to the air. Which of the following processes causes water to move from Earth’s surface to the atmosphere during the water cycle?
A.
precipitation
B.
evaporation
C.
condensation
D.
crystallization

Answers

Answer: B. evaporation

Answer:

B-Evaporation

Explanation:

I had it on study island and got It correct :)

Use the images below to answer the question. 2. What makes all of the samples different from each other?​

Answers

Answer:

Shape and structure.

Explanation:

The difference in shape and structure of these pictures is responsible for the difference from each other. The organisms present in these pictures are different in their size, shape and composition of their body. Some are small and some are large, some are living while the others are non-living, some are very hard whereas the others are soft and fleshy. So the organisms present in these samples are different from each other in a variety of ways i.e. size, shape and body structure.

Why does energy transfer not always result in Phase change ?

Answers

Answer:

phase change requires more energy to occur

Someone PLEASE HELP!!!

Answers

Answer:

Autosomal Recessive

Explanation:

The method of inheritance is autosomal recessive. Notice how the disease skips the parent generation. This indicates that parents have the recessive allele but do not express the trait. The individuals who are shaded in have two recessive alleles that were passed on from their parents, therefore they have the disorder.

In a sample of double stranded dna if 27% of the nitrogenous bases are thymine what percentage of nitrogenous bases are cytosine?

Answers

Answer:

73%

Explanation:

Given: 27%

To find: Percentage of nitrogenous bases are cytosine

Solve: [tex]\frac{27}{100}[/tex] × [tex]\frac{100}{1}[/tex]

Firstly, divide 100% by thymine and cytosine

[tex]\frac{100}{2}[/tex] = 50

Now, If it is 50 / 50, but thymine has 27 then subtract 27 from 100

100 - 27 = 73

So, the percentage of nitrogenous bases are cytosine 73%

what animal eats fiddler crabs?

Answers

Gulls, crows and herons are all opportunists. They'll eat just about anything that they can get their beaks on. That includes fiddler crabs.

Answer:

Predators that feed on fiddler crabs include herons, egrets and raccoons. At one to two years, the fiddler crab reaches sexual maturity.

Explanation:

Identify how information for specifying the traits of an organism is carried in the DNA.

Answers

Answer: DNA carries all of the information for your physical characteristics, which are essentially determined by proteins. So, DNA contains the instructions for making a protein. In DNA, each protein is encoded by a gene (a specific sequence of DNA nucleotides that specify how a single protein is to be made).

Explanation:

The traits or characters are present in the DNA in the form of genes. Genes are short stretches of nucleotides present in DNA and represent the encoded message that is present in the individual.

What is a gene?

Genes are present in the DNA. It carries information about the traits that are expressed in an individual. Genes come from parents to offspring, so they are hereditary and pass from one generation to the next. From DNA, mRNA is formed from the gene by the process of transcription.

This mRNA is again converted to proteins or polypeptides by the process of translation. This product is the result of the message that is present in the gene. Example: melanin pigment and skin color variation. As different persons have variations in their genes, the production of this melanin protein synthesis varies, and as a result, skin color among individuals varies.

 

Hence, the information for specifying the traits is carried by genes present in DNA.

To learn more about the gene, refer to the following link:

https://brainly.com/question/16377110

#SPJ2

Strands of genetic material floating in the nucleus are refered to as_____

Answers

They are refered to as DNA.
Also knows as Deoxyribonucleic Acid

You should fill out an incident report _____.


A. if a serious accident occurs.

B. any time an accident occurs.

C. if the injured person does not require medical attention.

D. if the employee asks for a copy for his lawyer.

Answers

Answer:

A

Explanation:

An incident report should be completed at the time an incident occurs no matter how minor an injury is.

which statement best describes an example of selective breeding?​

Answers

Answer: the answer is A

Explanation:

2. What type of Protist has hair-like coverings that help it move around?

Answers

Answer:

Paramecium

Explanation:

Paramecium use cilia, which are hair-like extensions that cover the outside of the cell

Gg x Gg
g
10.
G
GG
Gg
g
Gg
gg
The Punnett square above shows a cross between two plants. Both plants were heterozygous for dark green leaves (G)
and carry the recessive trait for light green leaves (g). In this cross, 50% of the offspring will be

Answers

Answer: Gg

Explanation:


2. After Fertilization, this part of a female flower eventually becomes the fruit
A. Style
B. Petal
C. Ovary
D. Sepal

Answers

C. Ovary! The ovary itself will mature into a fruit, either dry or fleshy, enclosing the seeds.

Answer:

ovary

Explanation:

After fertilization, the fertilized ovule forms the seed while the tissues of the ovary become the fruit

Cancer cells avoid apoptosis by the inactivation of the _______ suppressor gene .
plz help​

Answers

Cancer cells avoid apoptosis by the inactivation of the Tumor suppressor gene.

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

Help Me pls?!?!??? Plsssss

Answers

Answer:

its b

Explanation:

I remember I did this

I need all of number 1 answered will give brainliest and 50 points I will give another brainliest and 50 points if you answer number 2

Answers

Answer: 1. ??? 2. I cannot read it

Answer:

What does it say?

Explanation:

If your cells couldn't go through meiosis- how could this affect you?

Answers

Answer:

An organism would not be able to reproduce without meiosis.

Explanation:

Between meiosis and mitosis, meiosis is by far not as important. If you are a asexual organism, this would be NOT IMPORTANT whatsoever. If you are a sexual organism, this would LARGLY effect you. But on a world scale, this is NOT AS IMPORTANT.

This is because, without mitosis, you could not heal and would die much much younger since your cells could not be replaced. On the other hand, without meiosis, any organism that reproduces sexually would be unable to do so, which could lead to extinction in many, many species. This would not be harmful, however, to species that can also or mainly reporuduce asexually through budding, fragmenting, or sporing. So overall:

Organisms that produce sexually would go extinct.

This is the only real affect I can think of. Since meiosis does not  produce any cells aside from reproductive cells. And asexual organisms produce reproductive cells through other means.

Ti⊂k∫∈s ω∅∅p

When two organisms from the same species compete for resources, it is______ competition.

Answers

Answer:

Intraspecific competition

Hope this helps!

Answer:

Competitive exclusion principal applies.

Explanation:

Basically, the chances of both species being equally successful is almost impossible. Chances are one will lose and will either leave empty-handed, injured, or won't live to leave at all.

Which of the following best describes Darwin's (and Wallace's) theory of evolution?

Question 1 options:

Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.


The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.


Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the island


The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

Answers

Answer:

4

Explanation:

The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection according to Darwin's (and Wallace's) theory of evolution.

Natural selectionNatural selection is the process through which populations of living organisms adapt and change.It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.In 1859, Charles Darwin set out his theory of evolution by natural selection as an explanation for adaptation and speciation.

Thus, we can conclude that The diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection.

You can learn more about the natural selection here:

https://brainly.com/question/23929271

#SPJ2

If some bacteria are resistant to tetracycline and some are not resistant, what happens when a patient is given tetracycline for an infection?

Answers

Answer:

Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.

Explanation:

hope this helps:)

7. Fill in the blanks using the words: glucose | monosaccharide | energy | carbon | lipids | C6H12O6 | polysaccharide | carbohydrates All matter, must contain ________________________ to be considered organic. ______________________________, composed of starches and sugars are generally used in cells as a source of ___________________________. If a carbohydrate has more than one sugar, it is considered a _________________________________. The single subunit of a polysaccharide is a __________________________________. An example of a monosaccharide is __________________________ and its formula is ___________________________.

Answers

Answer:

Carbon, carbohydrates, energy, Polysaccharide, glucose, C6H12O6.

Explanation:

All organic matter must contain carbon in its composition then it can be considered as organic compound. Carbohydrate is composed of starches and sugars are generally used in cells as a source of energy. If a carbohydrate has more than one sugar, it is considered as a Polysaccharide. The single subunit of a polysaccharide is a glucose. An example of a monosaccharide is glucose and its formula is C6H12O6 . If a carbohydrate has one sugar, it is considered as a Monosaccharide whereas If a carbohydrate has two sugar, it is considered as a Disaccharide

The correct words for the given blanks are:

1. All matter, must contain carbon to be considered organic. Organic compounds are those compounds that have carbon and hydrogen bonds.

2. Carbohydrate is composed of starches and sugars are generally used as a source of energy. Starch is a stored form of energy in plants, whereas humans have glycogen as the stored form of energy.

3. If a carbohydrate has more than one sugar, it is considered a polysaccharide. Polysaccharides are starch, glycogen, and maltose.

4. The single subunit of the polysaccharide is a monosaccharide. It is the basic form of polysaccharides, which are combined by glycosidic bonds to form oligo or polysaccharides.

5. An example of a monosaccharide is glucose. Glucose is the primary substance required for the production of energy. Its formula is [tex]\rm C_6H_{12}O_6[/tex].

To know more about carbohydrates, refer to the following link:

https://brainly.com/question/16987478

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

What helps meteorologists to forecast the weather?

Answers

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models. The models use equations, along with new and past weather data, to provide forecast guidance to our meteorologists

Answer:

Observational data collected by doppler radar, radiosondes, weather satellites, buoys and other instruments are fed into computerized NWS numerical forecast models.

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:

Other Questions
Just take points, this website is so weird because of all the reporting and I didn't do any thing The scale of the drawing was 5 inches = 4 yards. What is the drawing's scale factor? Simplify your answer and write it as a fraction What is the final temp ofsolver if the temperature of25.89 sample of silverstarts out at 30.0C and40.5) of heat is added?The specific heat of silver130235 ](C). Order these numbers least to greatest 0.7,1.4,3.9,2.2,1.8 What is the meaning of Rusting Of IronPlz help me what is The expression 12+9g-30h factored using the GCF is and btw I already tryed 3 what body of water is found between honduras and cuba? A town has accumulated 5 inches of snow, and the snow depth is increasing by 6 inches every hour. A nearby town has accumulated 9 inches, and the depth is increasing by 3 inchesevery hour. In about how many hours will the snowfall of the towns be equal?Help please Why care about patterns and growth? NO LINKS OR ASSESSMENT!!Graph the image of the figure using the transformation given. Don't forget to prime marks on your new image. help me with part 2 ofsignificant individual of the 1920s !!~ Your checking account has a beginning balance of $68.02. You deposited $169.23 into the account. The next week you spent $31.57for gas and $25 to go out with friends. How much do you have left in the account?S212.25S205.68 $237.25$180.68 f(x)= x^2. what is g(x)?A. g(x) = 1/4x^2B. g(x) =1/4x^2 C. g(x) =4x^2 D. g(x) = 1/2x^2 Select all the statements that best describe the graph below. Simplify 3c-9d+7c+5d what are the two dominant religions practiced in japan? Oracin temtica el problema no pude estar peor did you know that The first armed conflict in history recorded by eyewitnesses was the Battle of Megiddo in 1479 BCE between Thutmose III (r. 1458-1425 BCE) of Egypt and an alliance of former Egyptian territories under the leadership of the King of Kadesh. Immigration is like tucking your roots Into yourselfWhat is the SENSORY DETAIL USED in the line ABOVE ( HEAR, SMELL, TOUCH, SIGHT, TASTE)WHAT DOES THIS LINE SHOW ABOUT THE AUTHORS VIEW ON IMMIGRATION THE BOOK IS CALLE WOKE Write the electron configuration of the element fitting each of the following descriptions. a. The group 2A element in the fourth period b. The noble gas in the fifth period c. The group 2B element in the fourth period d. The group 6A element in the second period