solve for x
7(x - 3) = 4(x + 5)

Answers

Answer 1
1: expand the bracket by multiplying the 7(x-3) and 4(x+5)
2:take away the smallest x, which is 4x
then you’re left with
3x-21=20
3: add the -21 to the other side of = sign
you’re left with 3x=41
4: divide by 3
5: x=13.6667

Related Questions

What is the missing value in the table?

Answers

answer;

C.21 you have to subtract each number.

4/7(21/8 x + 1/2) = -2(1/7 - 5/28x)
What is x in decimal form?

Answers

Answer:

x=[tex]1.22930[/tex]

Step-by-step explanation:

47(218 x+12 ) =−2(17 −528 x)

Simplify 47(218 x+12 ) :    327(21x+4) 327(21x+4) =−2(17 −528 x)

Multiply both sides by 7(21x+4)

327(21x+4) · 7(21x+4)=−2(17 −528 x)· 7(21x+4)

Simplify, 32=−14(17 −528 x)(21x+4)

Solve  32=−14(17 −528 x)(21x+4):    x=32+4√589105 , x=32−4√589105 x=32+4√589105 , x=32−4√589105

Answer:

x = 0.5

Step-by-step explanation:

[tex]\frac{4}{7}(\frac{21}{8}x + \frac{1}{2}) = -2(\frac{1}{7} - \frac{5}{28}x)[/tex]

[tex]1\frac{1}{2}x + \frac{2}{7} = - \frac{2}{7} + \frac{5}{14}x[/tex]

[tex]1\frac{1}{2}x - \frac{5}{14}x + \frac{2}{7} = - \frac{2}{7} + \frac{5}{14}x - \frac{5}{14}x[/tex]

[tex]1\frac{1}{7}x + \frac{2}{7} = - \frac{2}{7}[/tex]

[tex]1\frac{1}{7}x + \frac{2}{7} - \frac{2}{7} = - \frac{2}{7} - \frac{2}{7}[/tex]

[tex]1\frac{1}{7}x = - \frac{4}{7}[/tex]

[tex]\frac{1\frac{1}{7}x}{1\frac{1}{7} } = \frac{- \frac{4}{7}}{1\frac{1}{7} }[/tex]

[tex]x = -\frac{1}{2}[/tex]

What is the starting term of 64?​

Answers

Answer:

1

Step-by-step explanation:

One is the starting term

1, 2, 4, 8, 16, 32, 64, 128, 256,

The double number line shows the amount of time a hen needs to lay 1 egg.
Complete the table to show the same information as the double number line.
Eggs Time (hours)
3
100
12

Answers

I realize the double number line in this exercise can be as shown in the attached image, in that case, the table, correctly completed is:

Eggs      Time (hours)

 3                   75

 4                  100

 12                300

Method to complete the table.

First, you must see the double number line (attached image), in this we identify a hen needs 25 hours to lay 1 egg, by this reason, to identify the time required for a certain number of eggs, just multiply the number of eggs by 25 (the number of hours shown on the double number line), then:

3 * 25 = 7512 * 25 = 300

To calculate the number of eggs taking into account the time, you must divide the hours by 25:

100 / 25 = 4

In this way, you can check that the answers are 75, 4, and 300 respectively, to complete the table in the correct form.

You can review more exercises and test your new knowledge about the double number line at the following link: https://brainly.com/question/13553589?referrer=searchResults

Answer: eggs  time

                3          75

                 4         100

                12          300

Step-by-step explanation:

Type the correct answer in the box. The area of the figure is square units.

Answers

Answer:

26 units squared

Step-by-step explanation:

multiply

5x2=10

5x2=10

3x2=6

add them together and you get

26

Answer:

26

Step-by-step explanation:

The ratio 64 to 96 in simplest form is
3

Answers

Answer:

nice.

Step-by-step explanation:

The area of a circular pizza is 200 inches.
What is the approximate length of the radius of the pizza.

Answers

Answer:

r = 31.85 in    or     100/π

Step-by-step explanation:

area = πd

200 = 3.14d

d = 63.69

r = 1/2d

r = 31.85 in

31.85 is the answer

What name is given to an angle that
measures 150°?

Answers

The name given obtuse angle

Answer:

Obtuse

Step-by-step explanation:

Since 150°>90°, it is an obtuse angle

Al reunir terminos semejantes y resolver
-2x+3y²-5z+6x²-3y²+5y² +4x²
Se obtiene como resultado?

Answers

Answer:

1 0 ^ 2 + 5 ^ 2 − 2− 5

Step-by-step explanation:

m(x)=1/x f(x)=2x-10 find the domain restriction of m(R(x))

Answers

Answer:

x ≠ 5

Step-by-step explanation:

Given

m(x) = 1/xf(x) = 2x - 10

Composite function

m(f(x)) = 1/ (2x - 10)

The denominator can't be zero

2x - 10 ≠ 02x ≠ 10x ≠ 5

write an expression to show that is equivalent to 14x + 7y

Answers

Answer: its 28

Step-by-step explanation:

help please ! need asap

Answers

Answer:

x° = 139

step 1 :

180 - (37 + 38)

= 180 - 75

= 105°

step 2 :

180 - 105

= 75°

step 3 :

180 - 116

= 64°

step 4 : this step to find the value of x

x° = 180° - (64 + 75)°

= 180° - 139°

= 41

x° = 41

#CMIIW

Pls help ASAP
The citizens of a city were asked to choose their favorite pet. The circle graph shows how the citizens answered. If 135,000 citizens answered the question, how
many chose Fish, Cats, or Birds?
Snakes
6%
Hamsters
D
X
5
?
Birds
22%
Cats
239

Answers

Answer:

23,7777

Step-by-step explanation:

because 13% died

Jefferson purchased a jacket originally
priced $129 on sale for $90.30. What was the
percent of discount?

Answers

The percent of discount is 70%.

=[tex]\frac{mv^{2} }{2}[/tex] ; Solve for v.

Answers

Answer:

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

Step-by-step explanation:

[tex]E=\frac{mv^2}{2}[/tex]

[tex]2E=mv^2}[/tex]

[tex]v^2=\frac{2E}{m}[/tex]

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

A walkway forms one diagonal of a square playground. The walkway is 14 m long. How long is a side of the playground?

Answers

Answer: The side of the playground is around 10 meters long

Step-by-step explanation:

use the diagonal as the hypotenuse of a right triangle, where the sides of the square form the legs of said triangle.

Usually

[tex]a^{2} +b^{2} =c^{2}[/tex]

since we know a and b are the same length (sides of a square are congruent) we would have

[tex]a^{2} +a^{2} =c^{2} \\2a^{2} =c^{2}[/tex]

We know that c is 14 so

[tex]2a^{2} =14^{2} \\2a^{2} =196\\a^{2} =98\\a=\sqrt{98} \\a= 9.999[/tex]

Answer the question please which of the following shows numbers in order from least to greatest

Answers

Answer:

I think it's b I'm not sure I'm sorry if it's wrong

Find the area of the triangle

Answers

Answer:

The answer to this problem is 12.5.

Step-by-step explanation:

The formula for finding the area of a triangle is b * h * 1/2 or divide by 2 (base times height times one-half or two).

Since this is a equilateral triangle, all of the sides are equivalent to each other.  Since we know one of the sides is 5, all of the sides are 5.

5 * 5 = 25

Then you need to multiply this answer by 1/2 or divide by 2, whichever is easier.

25 / 2 = 12.5

The answer is 12.5.

Also, it would be FANTABULOUSLY AMAZING if I could get brainliest!!!

Just sayin, that would be pretty great.

Which of the data sets below has a mean of 32? Select all that apply.

A) 45, 21, 33, 29
B) 18, 54, 24
C) 14, 56, 34, 18, 23
D) 34, 35, 21, 29, 46

Answers

Answer:

B is the correct answer

Step-by-step explanation: When you add 18+54+24=96 divide 96 by 3 and its 32!

What is the volume of a hemisphere with a radius of 3.1 in, rounded to the nearest tenth of a cubic inch?

Pls help me

Answers

Answer:

Formula: V = (2/3) π r 3.

Radius is 3cm.

So, now we can plug it in to solve for the volume.

V = (2/3) π 3^3

First, let's multiply 3^3.

3^3 = 27

Then, 27 x π = 84.82

After, multiply by 2/3.

84.82 x 2/3 = 56.55

Lastly, round 56.55 to the nearest tenth of a cubic centimeter.

56.55 = 56.6

Therefore the volume of a hemisphere with a radius of 3cm is 56.6cm^3.

Step-by-step explanation:

hoped this helped

The answe is 56.6 cm ^3

A store selling the calculators donates $90 to charity
from the profit of $500 worth of calculators. If they sell
$200 worth of calculators and donate at the same rate,
how much money would be given to charity?

Answers

Answer:

Will be reveled in part B.

Step-by-step Part A

Using O P N Chart for the profits of $500

O P N represent Original, Part Percent and New original.

O $500 ║100%

P   $410║-18%

N $90   ║82%

I got $410 which is my part percent by subtracting the original by the New original. (500 - 90 = 410)

Now to solve for the part percent and New original which we will know how much money would be given to charity?

Solving for part percent

Part percent x org = Part

(X) x 500 = 90

500x = 90

500      500

x = 0.18 =  18%.

If they sell $500  worth of calculators and donates $90 to charity they are left with $410 and they gave the charity 82%

Part B:

O: $90   ║ 100%

P:   $110  ║-18%

N: $200  ║82%

So this tells me that the charity recived $110.

An angle with measure seven pi over 4 radians is in standard position. In which quadrant does its terminal side lies

Answers

Answer:

Step-by-step explanation:

HELP ME PLEASE ASAP

Answers

Answer:

33

Step-by-step explanation:

angles on a straight line sum up to 180°

104+x+x+10=180

114+2x=180

2x=180-114

2x=66

x=33

Answer:

C. 33

Step-by-step explanation:

So we have 180 degree line here, so lets take 104 and add the 10 from the expression inside the parenthesis on the other angle. We add 43 to 114 and get 147. We can then add 147+33 and get 180 which is equivalent to the angle.

Rachel had a loan for $4,000 loan for 4 years.
She paid a total of $608 in simple interest over the 4 years.
What was the annual interest rate for the loan?

Answers

9514 1404 393

Answer:

  3.8%

Step-by-step explanation:

The interest on a simple-interest loan is ...

  I = Prt

where P is the principal value, r is the annual rate, and t is the number of years.

Solving for r, we get ...

  r = I/(Pt) = 608/(4000×4) = 0.038 = 3.8%

The annual interest rate for the loan was 3.8%.

A student paid 256.37 in school fees how much has he paid to the nearest hundred

Answers

Answer:

300

Step-by-step explanation:

256.37 5 and 6 is high enoughh to boost that 2 up to a 3

Answer:

uhhh 256.37 is rounded to the nearest hundreth

Unless you mean hundred thwn it would be 300

Kane's Furniture Store advertised a table at a 13% discount. The original selling price was $113, and the sale price was $100. Was the sale price consistent with the
ad? Explain
Select the correct choice below and, if necessary, fill in the answer box within your choice.
A. No, the sale price was higher than it should have been
(Round to the nearest cent) __
B. No, the sale price was 5 lower than it should have been
(Round to the nearest cent.)__
C. Yes, the sale price was consistent with the ad, because it represents a 13% discount.

Answers

Answer:

A

Step-by-step explanation:

100%=$113 what about 87( 100-13)(113×85)÷100ans is 98.31 which should be the sale price but the sale price is 100 it is $16.90 higher

Jake packed 3 pairs of shorts for a trip: 1 khaki and 2 denim. He also packed 3 T-shirts: 2 white and 1 red. In the dark he randomly selected a pair of shorts and a T-shirt. What is the probability that he selected a pair of khaki shorts and a white T-shirt?
Select one:
1/4
2/9
1/3
1/9
PLZ ANWSER IT OR I'LL REPORT YOU!

Answers

The answer is 1/4



.....

The scatterplot shows the relationship between the percentage of battery life remaining in 12 smoke detectors and the number of months that the batteries have been in the smoke detectors.
Based on the scatterplot, what is the best prediction of the number of months it would take for the battery in a smoke detector to have 20 percent battery life remaining?
A-9 months
B-7 months
C-11 months
D-6 months

Answers

6 months would be the expected length

At a fundraiser, Marco's class sold 75% of their 80 baked
goods. How many baked goods did they sell?

Answers

Answer:

60

Step-by-step explanation:

They sold 60 baked goods because 75% of 80 is equal to 60.

Answer:

60 baked goods

Step-by-step explanation:

To find the answer to this question, you will need to multiply 80 by 75%.

Now this is very simple.

Some calculators will actually give you the option to multiply by a percent. Just type 80×75% and you'll get 60.

There is another way to do this.

You could also just solve 80×.75 due to the fact that .75 is equal to 75%.

Brainliest please

John shared 3 cookies with 4 friends. What fraction of a cookie did each friend receive?

Answers

Answer:

3/4 of a cookie

Step-by-step explanation:

Other Questions
Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine?