SIMPLE PRESENT TENSE

Answers

Answer 1
Aman watches movies every day.

Related Questions

How does the characterization of Talon throughout chapter 1 enhance the author's purpose about Downsiders? Cite evidence to support your analysis.


Consider these questions when constructing your response: -What kind of person is Talon? -Is he a leader or a follower?-How does he treat others?-Why do you think the author made Talon this kind of character? What might the author be trying to show us?

Answers

In Chapter 1 of the novel "Downsiders" by Neal Shusterman, Talon is introduced as a rebellious teenager who enjoys taking risks and breaking rules.

what is the author's purpose in characterizing Talon ?

The author's purpose in characterizing Talon in this way is to show the unique culture and way of life of the Downsiders, who live beneath the streets of New York City.

Talon's rebellious nature and disregard for authority highlight the differences between the Downsiders and those who live above ground. His leadership qualities also demonstrate the strength and resilience of the Downsider community.

Overall, the characterization of Talon in Chapter 1 enhances the author's purpose of highlighting the distinct culture and way of life of the Downsiders, while also challenging stereotypes and encouraging empathy towards those who may be perceived as different.

To learn more about characterization follow the given link:  https://brainly.com/question/1393329

#SPJ1

What is most closely a seam of la Juanita?

Answers

In the brief but vivid tale La Juanita, the small town of Mandeville, where the regatta—a race of ships—is taking place, is described.

The Ballad of Dood and Juanita's plot is described.

The plot centers on retired Civil War soldier Dood and his wife Juanita, who become estranged one day after a bandit comes onto their property, shoots The Dude, and steals Juanita. But he is not murdered, and after being attended to by a Cherokee war party, Dood rides off to regain his bride.

In the statement below, what does the word "furtive" mean?

Aiming to avoid being noticed or drawn to. 'Furtive boys in pink shirts,' the context reads. Sentence: In an effort to dodge the police, the runaway tried to hide.

To know more about La Juanita visit :-

https://brainly.com/question/11438368

#SPJ1

First to help me I’ll mark u brainliest but u have to answer the questions

Answers

Answer:

Hope this helps!

Explanation:

Simon is different from the other boys not only due to his physical frailty, manifested in his fainting spells, but also in his consistently expressed concern for the more vulnerable boys. Littluns follow him, and he picks choice fruit for them from spots they can't reach, a saintly or Christ-like image. He stands up for Piggy and helps him get his glasses back when Jack knocks them off his head, another allusion to Simon's visionary bent. In addition, he has a secret place in the jungle, where he spends time alone. In contrast to Piggy and Ralph's equating adulthood with knowledge and higher understanding, Simon sees the darker side of knowledge. For him, the staked sow's eyes are "dim with the infinite cynicism of adult life," a view of adults not defined by the civilized politeness and capability the boys imagine. Yet Simon soldiers on in his quest to discover the identity of the beast on the mountaintop because he sees the need for the boys to face their fears, to understand the true identity of the false beast on the mountain, and to get on with the business of facing the beast within themselves.

Simon's loner tendencies make the other boys think he's odd, but, for the reader, Simon's credibility as a mystic is established when he prophesies to Ralph "You'll get back to where you came from." Simon reaches an abstract understanding of mankind's latent evil nature and unthinking urge to dominate as "mankind's essential illness." When Simon tries to visualize what the beast might look like, "there arose before his inward sight the picture of a human at once heroic and sick" — Golding's vision of humanity as flawed by inherent depravity. Golding gives this knowledge to an outsider like Simon to reflect the place visionaries or mystics typically hold in society: on the fringes, little understood by the majority, and often feared or disregarded. Like other mystics, Simon asks questions the other boys cannot answer. His questions to them, "What's the dirtiest thing there is?" and "What else is there to do?" require both abstract thought and courageous action to answer.

anyone read the story of ona judge if you have please give the most braniliest expert verified answer possible please the question is How does Ona judge not allow herself to be defined by her circumstances? according to the book
it is never caught the story of ona judge

Answers

Ona did not allow herself to be defined by her circumstances because she never accepted her position as a slave and sought freedom knowing that it was her right.

Who was Ona Judge?She was a personal slave of Martha Washington.She was an activist for abolition.

Ona Judge was born a slave and over time she learned about the states where slavery was prohibited and that there were free black people who fled. She began to see freedom as a right and realized that slavery did not define her, like any of the limitations that surrounded her.

Therefore, even in the midst of difficulties, she knew that she was an intelligent woman and capable of overcoming the oppression she was experiencing.

Learn more about slavery:

https://brainly.com/question/9331183

#SPJ1

Write a formal letter of complaint to the school principal complaining about the condition of the school​

Answers

To: The Principal, <School Name>

From: <Your Name>

Date: <Date>

Subject: Complaint About School Conditions

Dear Principal <Name>,

I am writing to voice my concerns and dissatisfaction with the current state of our school. Over the past few weeks, it has become evident that the school is in a state of disrepair, and the condition of the classrooms and facilities is not up to acceptable standards.

The classrooms are in a terrible state - chairs and desks are broken, there is graffiti on the walls, and the floor is cracked and littered with dirt and debris. In addition, the bathrooms throughout the school are in a very poor state, with broken fixtures and flooding in some cases. Furthermore, the school cafeteria is unhygienic, and the food is of very low quality.

This deteriorating condition of our school is having a severe impact on the learning environment of the students and i hope you can address this issue and see to this matter

thanking you,

Answer:

Explanation:

Dear

I am the parent of (child’s name and class) who attends (name of school).

I am writing to make a formal complaint about (the person and/or incident you are

complaining about).

I am complaining because (give as much detail about the incident(s) as you can.

Include the date/time, people involved, what happened, any witnesses).

So far the following actions have been taken: (explain what has happened so far

in response to your concerns e.g. meetings, actions by the school. You can

include copies of any letters or emails).

I am not happy with the actions taken because (e.g. not enough done, the problem

is still going on, no action has been taken).

I would like you to put things right by (e.g. offering an apology, changing school

policy, giving my child extra help).

I would like you to investigate this matter further and let me know of the outcome.

(You can put a time deadline here).

I look forward to hearing from you.

Yours sincerely

(Your Name)

I need a twelve-minute informational speech written about the Economic Impacts of Farming, How Technology Affects Farming, and How The Environment Affects Agriculture and Agriculture in Iowa. I need this by Friday night and would be very grateful

Answers

Explanation:

Good evening, ladies and gentlemen.

Today, I would like to talk about the economic impacts of farming, how technology affects farming, and how the environment affects agriculture, with a special focus on agriculture in Iowa.

First, let's talk about the economic impacts of farming. Agriculture is a significant contributor to the economy of not just Iowa, but the entire United States. The agricultural sector supports millions of jobs, and the products produced by farms are sold domestically and internationally, generating billions of dollars in revenue each year. In Iowa alone, agriculture contributes over $112 billion annually to the state's economy, with the majority of that coming from crop production.

Now let's discuss how technology affects farming. Technology has revolutionized the way farming is done. Advances in machinery, genetics, and precision agriculture have increased the efficiency and productivity of farms while reducing labor requirements. Technology also allows farmers to better monitor crops, manage pests and diseases, and optimize resource use. Iowa, being one of the leading agricultural states, has been at the forefront of agricultural technology adoption. Precision agriculture techniques, such as GPS-guided tractors and drones, have helped farmers in Iowa increase yields while reducing inputs, making farming more sustainable.

Finally, let's talk about how the environment affects agriculture. Farming is a sector that is particularly vulnerable to the impacts of climate change, such as droughts, floods, and extreme weather events. These impacts can have a significant impact on crop yields, food prices, and the livelihoods of farmers. In Iowa, agriculture is facing significant environmental challenges, such as soil erosion, nutrient runoff, and water pollution. These issues have led to increased regulation and adoption of conservation practices, such as cover crops and no-till farming, to protect the environment and maintain soil health.

In conclusion, agriculture is a vital sector to the economy of Iowa and the United States. Technology has revolutionized farming, increasing productivity and efficiency, and helping farmers to better manage resources. However, the sector faces significant environmental challenges that require the adoption of sustainable practices. I hope this speech has provided you with a better understanding of the economic impacts of farming, how technology affects farming, and how the environment affects agriculture, with a specific focus on agriculture in Iowa. Thank you for listening.

Explain what happened A Single Shard chapter 8 summery. (In your own words!)​

Answers

After Min's effort for the emissary failed in the kiln, Chapter 8 opens with Tree-ear sweeping up the remnants of his hopeful creation. The ambassador comes back later to speak with Min.

What happened in Chapter 9 of single shard?

Min's refusal to instruct Tree-ear has him in a great deal of distress. A few days later, though, while he sits at the draining site, Tree-ear understands that since shaping clay is not the same as throwing pottery and he is competent at it, he should be permitted to learn how to do it.

Tree-ear tells Min Kang's secret in chapter 7. He takes Crane-advise man's to heart and holds back the information until Kang has presented his artwork to the town. The world now owns Kang's "concept". As Kang did, Min worked on carving his vases.

Thus, After Min's effort for the emissary failed in the kiln.

For more information about happened in Chapter 9 of single shard, click here:

https://brainly.com/question/3051370

#SPJ1

How does God's immutability affect His other attributes? Answer in complete sentences.

Answers

Answer:

The Immutability of God is an attribute that "God is unchanging in his character, will, and covenant promises." God's immutability defines all God's other attributes: God is immutably wise, merciful, good, and gracious.

Write a sentence for the word morbid, but as a metaphor.

Answers

Explanation:

The morbid curiosity of the audience was like a moth drawn to the flame of the macabre performance.

Colonel Graff and Mazer Rackham display contrasting attitudes and actions toward Ender from the beginning to the end of the novel. How do their actions change and what motivates this change?

Answers

Answer:

Colonel Graff and Mazer Rackham viewed Ender differently in Orson Scott Card's Ender's Game. Colonel Graff first manipulates Ender to save humanity from aliens. He deceives Ender and isolates him from his peers to make him the ultimate weapon. Graff shows real concern for Ender's well-being and emotional health toward the end of the novel, giving him closure on his actions in the last battle. Ender's humanity motivates this shift.

Mazer Rackham, who teaches Ender to combat aliens, is distant and frightening. As Ender improves, Rackham becomes more hands-on, teaching him methods and techniques beyond combat. Rackham changes because he admires Ender and thinks he can be a leader. Rackham mentors and fathers Ender toward the end of the novel, helping him deal with his shame and duty.

Source

"Ender's Game" by Orson Scott Card.

what is a thesis statement for the moon and how will you connect this paragraph back to your thesis? Write a sentence which explains how the evidence above proves your thesis statement.

Answers

Your thesis statement must be related to and supported by the topic sentences, explanation, and supporting details. Topic sentences are brief statements that notify the reader of the main idea of the paragraph (T). It should be related to one of your thesis's concepts.

How does a paragraph relate to a thesis?

The greatest way to ensure that a body paragraph supports your thesis is to keep it focused. Make sure that one of the claims from your thesis is the focus of each body paragraph. Then, make sure the evidence in each paragraph is concentrated on that particular assertion.

A paragraph's thesis statement is what, exactly?

How do I write a thesis statement? The sentence that states the thesis identifies a writing assignment's primary idea and aids in controlling the ideas that are included in the document. That goes beyond being a topic. It frequently expresses a writer's opinion or assessment of a piece of writing or a personal encounter.

To know more about Thesis statement visit:

https://brainly.com/question/30854934

#SPJ1

What is the correct verb?

Research at the University of Adelaide suggests that just thirty seconds of exposure to drinks with high acidity are enough time to permanently damage tooth enamel

Answers

Answer:

damage

Explanation:

damage is the doing action

Write an essay that synthesizes material from at least three of the sources and develops your position on the extent to which privatizing space exploration is beneficial. Source a (mccarthy) source b (schwartz) source c (pappalardo) source d (table) source e (cartoon) source f (al-rodhan)

Answers

Answer: Here is my essay

Explanation: Space exploration has always been a realm of human endeavor that has inspired the imagination and pushed the boundaries of science and technology. With the dawn of the private sector space industry, the potential of space exploration has been vastly increased. However, the extent to which privatizing space exploration is beneficial is a hotly contested issue. This essay will synthesize material from six sources in order to assess the benefits of privatizing space exploration.

To begin with, Source A (McCarthy) argues that the private sector has the potential to revolutionize space exploration by providing the necessary funds and resources to pursue ambitious projects. Private companies can invest in projects that governments may be unwilling to fund, such as space tourism and commercial space flights, which could increase the public's interest in space exploration. Furthermore, the private sector can provide the technical expertise and resources to tackle complex projects, such as the exploration of the moon and Mars, which are essential to the furthering of space exploration.

In contrast, Source B (Schwartz) states that the privatization of space exploration could lead to a two-tier system, in which the wealthy can access space exploration opportunities while poorer countries are excluded. The author points out that governments are better placed to ensure that space exploration is conducted in a

Space exploration is the study of the universe beyond the Earth's atmosphere using a variety of methods. It involves sending probes, satellites, and people to explore.

What is an essay?

An essay is a written piece of work that presents an argument or discusses a particular topic. It is typically structured into an introduction, body paragraphs, and a conclusion.

The introduction provides background information on the topic and a thesis statement that outlines the main argument of the essay. The body paragraphs provide evidence, examples, and analysis to support the thesis, while the conclusion summarizes the main points and reiterates the thesis in a new way.

Essays can vary in length, style, and purpose, and can be written for academic, professional, or personal reasons.

Learn more about essays, here:

https://brainly.com/question/20426054

#SPJ2

Pls help thank you will mark the brainliest

Answers

Answer:

i'm pretty sure its b

Answer: B by comparing Juliet to a flower Capulet emphasizes that she is too beautiful to die

How did using smarts help the Allies plan for d day

Answers

The Allies used various forms of intelligence to plan for D-Day, including human intelligence, signals intelligence, and imagery intelligence. By gathering and analyzing this information, the Allies were able to make informed decisions about the timing, location, and strategy of the D-Day invasion.

One key intelligence tool that was used was Ultra, a top-secret program that allowed the Allies to intercept and decode German messages. By breaking the German military's encrypted codes, the Allies were able to gain valuable information about German troop movements, defenses, and intentions.

THIS IS FOR ECONOMICS
money someone makes, the ___________________ taxes they pay.

Answers

The more someone makes, the more taxes they pay.

do you agree with the author that “selfies have harmful phychological effects that can be specially destructive for women”? by bree rolfe

Answers

Yes, I agree with the author that “selfies have harmful phycological effects that can be specially destructive for women” by Bree Rolfe.

Why selfies have harmful phycological effects?

Even though it's unlikely that social media is the direct cause of serious mental health issues, it can exacerbate existing problems in children. Children who are anxious or depressed may think less highly of themselves and spend more time comparing themselves to others as a result.

Research and surveys have been done on the issue of selfies. Even a word exists to describe those who, as a result of taking selfies, become fixated on supposed flaws in their appearance. Selfie dysmorphia is what it is. This is comparable to the mental health condition known as body dysmorphic disorder, which is connected to OCD.

Learn more about selfies

https://brainly.com/question/30475414

#SPJ1

write a letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved. 450 words ​

Answers

The letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved can be considered as a formal letter.

What is a formal letter?

A formal letter can be described as one that can be written to official people. check below for this letter.

Dear Honorable Minister of Education,

I am writing this letter to you to discuss three ways by which the quality of education in our country could be improved. As you know, education is the backbone of a nation, and it is essential that we strive to provide our students with the best possible education. Here are three suggestions that I believe can help improve the quality of education in our country.

Teacher Training: One of the most crucial aspects of improving the quality of education is to ensure that our teachers are well-trained and equipped with the necessary skills and knowledge. There should be regular teacher training programs that help teachers stay up-to-date with the latest teaching methodologies, technologies, and practices. We should also encourage teachers to attend workshops and conferences, which can expose them to new ideas and best practices.

Technology Integration: Technology is rapidly changing the way we live and work, and it can also transform the way we learn. Integrating technology in classrooms can help make learning more engaging and interactive, and it can also provide access to a wealth of online resources that can enrich the learning experience. We should consider providing more access to technology, such as tablets, laptops, and smartboards, and also invest in creating digital resources, such as online courses and educational videos.

Curriculum Review: Our curriculum should be regularly reviewed to ensure that it is relevant and up-to-date. The curriculum should focus on providing students with the necessary knowledge and skills to succeed.

                                                                                 Yours faithfully,

                                                                                            John

Learn more about letter at:

https://brainly.com/question/24140747

#SPJ1

what kind of phrase is "catching the right apprehension" of things

Answers

"Catching the right apprehension" is a phrase that describes the act of perceiving or understanding something correctly.

What are different types of phrases ?

Noun phrase (NP): A phrase that functions as a noun in a sentence, e.g. "the blue car" or "a book on astronomy."

Verb phrase (VP): A phrase that functions as a verb in a sentence, e.g. "is running" or "should have been sleeping."

Adjective phrase (AdjP): A phrase that functions as an adjective in a sentence, e.g. "very happy" or "incredibly smart."

Adverb phrase (AdvP): A phrase that functions as an adverb in a sentence, e.g. "quite slowly" or "very carefully."

Prepositional phrase (PP): A phrase that includes a preposition and a noun or pronoun, e.g. "in the park" or "with my friends."

Infinitive phrase (InfP): A phrase that includes an infinitive verb and any complements or modifiers, e.g. "to run" or "to eat a sandwich."

Gerund phrase (GerP): A phrase that includes a gerund verb (-ing form) and any complements or modifiers, e.g. "running in the park" or "eating a sandwich."

Participial phrase (PartP): A phrase that includes a participial verb (-ed or -ing form) and any complements or modifiers, e.g. "painted blue" or "crying in the corner."

"Catching the right apprehension" is a phrase that describes the act of perceiving or understanding something correctly. The word "apprehension" here refers to the act of comprehending or grasping something, and "catching" suggests the idea of capturing or getting hold of it. So, the phrase "catching the right apprehension of things" means to accurately perceive or understand things in the correct way.

To learn more about phrase follow the given link:

https://brainly.com/question/25073409

#SPJ1

identify the error in the following sentence and the best way to fix it.

My youngers brothers best friend.

A. It is a fragment and needs a subject
B. It has a comma splice and needs a conjunction
C. It is a fragment and needs a verb
D. It is a run on sentence and needs a period or semicolon

Answers

An incomplete sentence that has been substituted for a full sentence is referred to as a sentence fragment. The subject and predicate needed to convert a sentence fragment.

What is a sentence fragment that can be fixed?

Fill in missing sections of sentences by using an adverb or a conjunction to connect the two components. True: Because of how challenging his classes may be, students loathe Mr. Jones.

A sentence error is caused by a fragment, why?

A sentence fragment, in its simplest form, is a clause that lacks one of the three essential elements of a proper sentence: a subject, a verb, and a complete thought. As a result of how easily our partial thoughts might pass for entire sentences, we frequently fail to detect our sentence fragments.

To know more about sentence visit :-

https://brainly.com/question/18728726

#SPJ1

1.
2.
3.
4.
prefix + root word
super hero
Use a PREFIX from the box
to make a new word.
prefix + root word
freeze
fix
star
marine
new word
= new word
= superhero
PREFIX MEANINGS
prefix
super-
pre-
anti-
dis-
miero-
sub-
inter-
иои-
meaning
above
before
against
not, opposite of
small
under
between
not

Answers

prefix + root word = prefreeze

New word = prefreeze (meaning "to freeze before something else is done")

Example sentence: I always prefreeze the fruit before making smoothies to ensure they are nice and cold.

What is the prefix about?

In this exercise, we were given four root words - "hero", "freeze", "fix", and "marine" - and were asked to create new words by adding a prefix to each root word.

Therefore, the prefix "inter-" means "between" and the root word "freeze" refers to the process of becoming or making something cold and solid. Putting them together, we get "interfreeze," which could mean the process of freezing something between two layers or surfaces.

Learn more about prefix from

https://brainly.com/question/21514027

#SPJ1

Why do people succeed cite evidence from this text your own experience and other literature

Answers

Answer: Well, I don't have the text that we're supposed to be using. But I would say some of the qualities that help people succeed are confidence, showing pride in what you do is always important. Teamwork is also another quality that helps people succeed, learning how to work and solve problems with others is important. Finally, a good work ethic is one of the most useful and helpful qualities. It's useful because you learn how to use your brain and tools in tough situations.

how is the celebration of special dad connected to peoples rights and responsibilities?​

Answers

The celebration of a special day, such as on Father's Day, is connected to people's rights and responsibilities in a few ways:

The right to recognition and appreciation: Every person has the right to be recognized and appreciated for their contributions, including fathers and father figures. Celebrating Father's Day is one way to honor and recognize the important role that fathers play in families and society.The responsibility to show gratitude and respect: Along with the right to recognition, there is a responsibility to show gratitude and respect towards fathers and father figures. Celebrating Father's Day is an opportunity to express appreciation for the love, support, and guidance that fathers provide.

What other way is the celebration of special day connected to peoples rights and responsibilities?

The celebration of a special day, such as on Father's Day, is also connected to people's rights and responsibilities like;

The responsibility to be a good father: For those who are fathers themselves, celebrating Father's Day can be a reminder of their responsibility to be a good parent and role model for their children. It is a time to reflect on their actions and behavior, and to strive to be the best possible father they can be.

In summary, the celebration of special dads is connected to people's rights and responsibilities through the recognition, appreciation, gratitude, respect, and responsibility

Find more useful information on Father's day;

https://brainly.com/question/19491047

#SPJ1

1. If you detract from an achievement, would you make a contribution toward it or take
away from it? Explain. (1 pt.)

Answers

If you detract from an achievement, you are taking away from it. To detract means to diminish the worth or value of something, so if you detract from an achievement, you are reducing its significance or importance.

What does the term imply?

This could be done in a number of ways, such as by downplaying the effort that went into the achievement, highlighting flaws or shortcomings, or criticizing the methods used to achieve it.

For example, if someone receives an award for their work, but you point out that they had help from others or that there were mistakes made along the way, you are detracting from their achievement. Similarly, if someone accomplishes a difficult task, but you criticize the way they went about it or suggest that it wasn't really that impressive, you are also detracting from their achievement.

In general, it is better to recognize and celebrate the accomplishments of others, rather than detracting from them. While constructive criticism can be helpful in some situations, it should be done in a way that acknowledges the value of the achievement and focuses on ways to improve in the future.

Learn more about achievement on:

https://brainly.com/question/26270017

#SPJ1

PLSSS HELP IF YOU TURLY KNOW THISSS

Answers

The answer is Phantom

Answer:

The word that corresponds with ghostly figure is B phantom

Explanation:

In the dictionary phantom is the synonym of ghostly figure.

What is the best way to combine sentences 13 and 14? A. Using parks in this way takes coordination and effort because many people want to use the same field. B. Using parks in this way takes coordination and effort even though people want to use the same field. C. Using parks in this way takes coordination and effort, and people want to use the same field. D. Using parks in this way takes coordination and effort, but people want to use the same field.

Answers

Answer:

A

Explanation:

Im not an expert, but it sounds right, more fluid sounding


What is Massimo Bottura doing
about the problem of wasted food?

Answers

In order to bring awareness to the issue of food waste, he started a brand-new program in 2016 called Food for Soul.

Who was Massimo Bottura?

He has established a network of communal kitchens in Paris, Milan, Rio de Janeiro, and London where he and his employees prepare meals every day of the week using leftovers that would otherwise go to waste.

He then extends an invitation to residents of the area to come and enjoy it. Bottura makes it very clear that this is not a soup kitchen, despite the fact that some of these guests are those in need.

It's a cultural endeavor, not a charitable one, he claims. "A decent supper in a lovely environment can restore people's dignity.

Therefore, In order to bring awareness to the issue of food waste, he started a brand-new program in 2016 called Food for Soul.

To learn more about Massimo Bottura, refer to the link:

https://brainly.com/question/946336

#SPJ9

Pls help thank you will mark the brainliest

Answers

The part the apothecary plays in the tragedy is selling Romeo the lethal poison, hence a pharmacist according to Romeo, in Romeo and Juliet's Act V, scene I. Shakespeare personifies and represents Death itself by having the Mantuan apothecary appear as a skeleton.

What does an apothecary sell to Romeo?

Early in his career, William Shakespeare wrote the tragedy Romeo and Juliet, which tells the story of two young lovers who were star-crossed, and how their deaths eventually brought their warring families together. The Apothecary claims to have something similar to poison, but selling poison in Mantua is punishable by death.  

Romeo makes a generous offer to the apothecary, a beggar, who initially declines to sell him because doing so would be against the law. Eventually, the sale is consummated.  As a result, when he sells Romeo the lethal poison, the apothecary significantly contributes to the tragedy.

To learn more about Romeo and Juliet, visit:

https://brainly.com/question/20091298

#SPJ1

Answer: Pharmacist

Explanation: they give out drugs

Which category of copyright law does computer programming falls under?
(1 point)
O pictures, graphics, and sculptures
O written works
O dramatic works
O sound and voice recordings

Answers

Computer programming generally falls under the category of "written works" in copyright law. Option B.

What does written works comprise?

Written works" generally comprise any original creative works that are fixed in a tangible form of expression, including:

Books, articles, and other literary worksPoetry and other verseSoftware code and computer programsWebsites, blogs, and other online contentScripts for movies, TV shows, and playsLectures, speeches, and other non-fiction works

This category also includes related materials like illustrations, charts, graphs, and other visual aids that are integrated into the written work. Overall, the "written works" category is quite broad and encompasses a wide range of creative and intellectual endeavors.

Find more useful information on computer programs here;

https://brainly.com/question/14618533

#SPJ1

Based on passage, how does the setting of the story affect the way the narrator veiws the civilian

Answers

Aleksandr Pushkin's "The Shot" is a short story. It is the first story in Pushkin's cycle of five short stories, The Tales of the Late Ivan Petrovich Belkin. The Shot follows events at a military outpost in a Russian province and then on a country estate several years later.

Pushkin discusses the themes of honour, vengeance, and death in the context of Russian society. The Shot tells the story of Silvio, a retired soldier who has held a grudge for many years after an argument in which he was disrespected in front of his peers.

The story concludes with Silvio returning to seek vengeance against the man who wronged him, the Count, as told by an unnamed narrator. The Shot was inspired by Pushkin's personal experience as well as the works of his contemporaries.

Pushkin himself stated that a fellow Russian, Alexander Bestuzhev, influenced Silvio's character. Despite being a shorter work, The Shot influenced later Russian literature, including Fyodor Dostoevsky's Notes from Underground.

For modern readers, this story remains popular and relevant. It provides readers with insight into nineteenth-century Russian society, and the air of mystery surrounding Silvio attracts and retains readers.

To know more about The Narrator:

https://brainly.com/question/20038946

#SPJ4

Other Questions
What is the problems of photosynthesis? Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor