(PLS HELP DUE IKE RN !)) PONITS AND GIVING BRAINLIEST
write 4 paragraphs, each paragraph needs at least 4 sentences.

Paragraph 1: What do you typically eat for lunch every day? Do you bring your lunch? Do you eat school lunch? Who packs your lunch?

Paragraph 2: What do you think of the school lunch? Is it tasty? Is it healthy?

Paragraph 3: How would you change school lunches? Would you introduce new food? Would you give more options? Be specific. Include beverages and snacks, anything you want. Make changes for everyone, not you. Our entire school eats in the same lunch room, give options.

Paragraph 4: What would be your ideal school lunch? Make sure it's something that is healthy as well as tasty. Also, how is your diet at home?

Answers

Answer 1

Answer:

Every day for lunch I eat pizza or a sandwich. I bring my lunch to school. I don't like school lunch. I always pack my own lunch.

School lunch is extremely unhealthy. All of the carbs and little protein does not make for good food. It is also not tasty. Most of the food is fake and cheap.

School lunches should be made with more care and people should spend some more time on them. If I was in control, I would definitely introduce new food. I would also definitely give people more options because that's what would make people happy.

An ideal school lunch would include protein, a meat. It would also have a drink, milk, water, or a juice. And it would include sides of vegetables/fruits and/or carbs. My diet at home is very healthy.

Answer 2

Answer:


1. I usually bring my lunch to school. My mom packs it for me the night before, which usually consists of a sandwich, some fruit and vegetables, and a juice box or yogurt. Sometimes I'll also get chips or crackers as well. On special occasions, I will buy lunch from the cafeteria instead.

2. It depends on the day and what they are serving. Sometimes it's tasty, healthy meals while others may not be as delicious or nutritious. It's important for us to look at each meal's ingredients to ensure it is both tasty and healthy.

3. I would introduce more options for school lunches by providing a variety of fresh fruits and vegetables, whole grains, lean proteins, and dairy products. Additionally, I would provide a selection of beverages such as water, milk, juice and tea. For snacks I would offer both healthy choices like trail mix or granola bars as well as traditional favorites like chips or pretzels. Finally, I would make sure to offer vegetarian meals every day so students with dietary restrictions are not left out.

4. My ideal school lunch would be a delicious sandwich made with whole grain bread, fresh lettuce, and tomato, lean protein such as turkey or grilled chicken, and light mayonnaise. I would also like some crunchy veggies on the side such as carrots or celery sticks with a low-fat dip for added flavor. At home my diet is pretty balanced; I try to eat lots of fruits and vegetables, lean proteins like fish and poultry, complex carbohydrates like brown rice and whole wheat pasta, healthy fats from nuts and avocados, plus plenty of water throughout the day.


Related Questions

Give me a poem please- any poem is fine!

Answers

Sonnet 18: Shall I compare thee to a summer’s day?

BY WILLIAM SHAKESPEARE

Shall I compare thee to a summer’s day?

Thou art more lovely and more temperate:

Rough winds do shake the darling buds of May,

And summer’s lease hath all too short a date;

Sometime too hot the eye of heaven shines,

And often is his gold complexion dimm'd;

And every fair from fair sometime declines,

By chance or nature’s changing course untrimm'd;

But thy eternal summer shall not fade,

Nor lose possession of that fair thou ow’st;

Nor shall death brag thou wander’st in his shade,

When in eternal lines to time thou grow’st:

So long as men can breathe or eyes can see,

So long lives this, and this gives life to thee.

Answer:

Soccer is Life

imagine the world

without the black and white sphere

our minds wouldn't be clear

Let me hear the sound of the Vuvuzela

Let me hear the sound of the spectators

shouting Laduma

without an Black an White sphere

I feel emptiness

Let me kick it until it fills me

with Great happiness

By Hazel

Explain what happened A Single Shard chapter 8 summery. (In your own words!)​

Answers

After Min's effort for the emissary failed in the kiln, Chapter 8 opens with Tree-ear sweeping up the remnants of his hopeful creation. The ambassador comes back later to speak with Min.

What happened in Chapter 9 of single shard?

Min's refusal to instruct Tree-ear has him in a great deal of distress. A few days later, though, while he sits at the draining site, Tree-ear understands that since shaping clay is not the same as throwing pottery and he is competent at it, he should be permitted to learn how to do it.

Tree-ear tells Min Kang's secret in chapter 7. He takes Crane-advise man's to heart and holds back the information until Kang has presented his artwork to the town. The world now owns Kang's "concept". As Kang did, Min worked on carving his vases.

Thus, After Min's effort for the emissary failed in the kiln.

For more information about happened in Chapter 9 of single shard, click here:

https://brainly.com/question/3051370

#SPJ1

Write an essay that synthesizes material from at least three of the sources and develops your position on the extent to which privatizing space exploration is beneficial. Source a (mccarthy) source b (schwartz) source c (pappalardo) source d (table) source e (cartoon) source f (al-rodhan)

Answers

Answer: Here is my essay

Explanation: Space exploration has always been a realm of human endeavor that has inspired the imagination and pushed the boundaries of science and technology. With the dawn of the private sector space industry, the potential of space exploration has been vastly increased. However, the extent to which privatizing space exploration is beneficial is a hotly contested issue. This essay will synthesize material from six sources in order to assess the benefits of privatizing space exploration.

To begin with, Source A (McCarthy) argues that the private sector has the potential to revolutionize space exploration by providing the necessary funds and resources to pursue ambitious projects. Private companies can invest in projects that governments may be unwilling to fund, such as space tourism and commercial space flights, which could increase the public's interest in space exploration. Furthermore, the private sector can provide the technical expertise and resources to tackle complex projects, such as the exploration of the moon and Mars, which are essential to the furthering of space exploration.

In contrast, Source B (Schwartz) states that the privatization of space exploration could lead to a two-tier system, in which the wealthy can access space exploration opportunities while poorer countries are excluded. The author points out that governments are better placed to ensure that space exploration is conducted in a

Space exploration is the study of the universe beyond the Earth's atmosphere using a variety of methods. It involves sending probes, satellites, and people to explore.

What is an essay?

An essay is a written piece of work that presents an argument or discusses a particular topic. It is typically structured into an introduction, body paragraphs, and a conclusion.

The introduction provides background information on the topic and a thesis statement that outlines the main argument of the essay. The body paragraphs provide evidence, examples, and analysis to support the thesis, while the conclusion summarizes the main points and reiterates the thesis in a new way.

Essays can vary in length, style, and purpose, and can be written for academic, professional, or personal reasons.

Learn more about essays, here:

https://brainly.com/question/20426054

#SPJ2

Prompt
Write a narrative essay about overcoming a challenge, and what you learned as a result.
Pre - writing

Answers

The majority of us must strive and fight to overcome the problems that our lives present. Our aims and ambitions can be accomplished thanks to this overcoming, which also creates a sense of personal fulfillment.

How should a narrative essay begin?

In a narrative essay, a tale is told. The narrative is actually just another word for story. The narrative essay allows the writer to be a little more creative than academic essays typically do, despite sharing the same fundamental structure as the majority of other academic essays. Long stories or just a few thrilling minutes can be told in narratives.

Although the narrative essay has a specific format, narrative concepts are frequently used in other types of writing assignments, such as an argument or compare-and-contrast essays. The paragraph that starts your story counts as the introduction to a narrative essay. You introduce the characters, establish the environment, and get your audience ready for the action in the introduction.

Learn more about narrative essays with the help of the given link:

brainly.com/question/891236

#SPJ9

How does God's immutability affect His other attributes? Answer in complete sentences.

Answers

Answer:

The Immutability of God is an attribute that "God is unchanging in his character, will, and covenant promises." God's immutability defines all God's other attributes: God is immutably wise, merciful, good, and gracious.

1. If you detract from an achievement, would you make a contribution toward it or take
away from it? Explain. (1 pt.)

Answers

If you detract from an achievement, you are taking away from it. To detract means to diminish the worth or value of something, so if you detract from an achievement, you are reducing its significance or importance.

What does the term imply?

This could be done in a number of ways, such as by downplaying the effort that went into the achievement, highlighting flaws or shortcomings, or criticizing the methods used to achieve it.

For example, if someone receives an award for their work, but you point out that they had help from others or that there were mistakes made along the way, you are detracting from their achievement. Similarly, if someone accomplishes a difficult task, but you criticize the way they went about it or suggest that it wasn't really that impressive, you are also detracting from their achievement.

In general, it is better to recognize and celebrate the accomplishments of others, rather than detracting from them. While constructive criticism can be helpful in some situations, it should be done in a way that acknowledges the value of the achievement and focuses on ways to improve in the future.

Learn more about achievement on:

https://brainly.com/question/26270017

#SPJ1

Select the correct answer.
Garry is a celebrity talk show host. With almost all his celebrities, he tries to summarize and sometimes restate what a speaker has just said, especially
when the speaker has spoken for a long time. Which listening skill does Garry demonstrate?
O A
describing behavior
OB.
making T statements
O c.
paraphrasing
O D. perception checking
O E. participative style
Reset
Next

Answers

Answer:
The listening skill demonstrated by Garry is C. paraphrasing. Paraphrasing is when the listener restates what the speaker has said in their own words, to confirm understanding and show that they are actively listening. Garry tries to summarize and restate what a speaker has said, indicating that he is paraphrasing to make sure he understands the message correctly.

- I Hope This Helps! :)

anyone read the story of ona judge if you have please give the most braniliest expert verified answer possible please the question is How does Ona judge not allow herself to be defined by her circumstances? according to the book
it is never caught the story of ona judge

Answers

Ona did not allow herself to be defined by her circumstances because she never accepted her position as a slave and sought freedom knowing that it was her right.

Who was Ona Judge?She was a personal slave of Martha Washington.She was an activist for abolition.

Ona Judge was born a slave and over time she learned about the states where slavery was prohibited and that there were free black people who fled. She began to see freedom as a right and realized that slavery did not define her, like any of the limitations that surrounded her.

Therefore, even in the midst of difficulties, she knew that she was an intelligent woman and capable of overcoming the oppression she was experiencing.

Learn more about slavery:

https://brainly.com/question/9331183

#SPJ1

Pls help thank you will mark the brainliest

Answers

Answer:

i'm pretty sure its b

Answer: B by comparing Juliet to a flower Capulet emphasizes that she is too beautiful to die

Activity
in this activity, you wll write a short research paper on the impact that the plague pandemic, also known as the Black Death, had on the people of
England in the 1300s. Find out how this pandemic affected the social, political, and economic life of the country. Present your findings in a report of about
300 words. Remember to cite any resources that you consult.

Answers

Black Death pandemic that swept Europe between 1347 and 1351 than during any other documented epidemic or war up to that point.

What is Black death?

It is largely accepted that Yersinia pestis infection led to plague, which is thought to have been the cause of the Black Death.

All currently circulating Y. pestis strains known to cause disease in humans can be traced back to the strain that was introduced during the Black Death, according to modern genetic research.

So, the medieval era is where plague epidemics today first appeared. Some pieces of research have shown that the Black Death might have been caused by a virus.

Therefore, Black Death pandemic that swept Europe between 1347 and 1351 than during any other documented epidemic or war up to that point.

To learn more about Black death, refer to the link:

https://brainly.com/question/17920987

#SPJ1

Based on passage, how does the setting of the story affect the way the narrator veiws the civilian

Answers

Aleksandr Pushkin's "The Shot" is a short story. It is the first story in Pushkin's cycle of five short stories, The Tales of the Late Ivan Petrovich Belkin. The Shot follows events at a military outpost in a Russian province and then on a country estate several years later.

Pushkin discusses the themes of honour, vengeance, and death in the context of Russian society. The Shot tells the story of Silvio, a retired soldier who has held a grudge for many years after an argument in which he was disrespected in front of his peers.

The story concludes with Silvio returning to seek vengeance against the man who wronged him, the Count, as told by an unnamed narrator. The Shot was inspired by Pushkin's personal experience as well as the works of his contemporaries.

Pushkin himself stated that a fellow Russian, Alexander Bestuzhev, influenced Silvio's character. Despite being a shorter work, The Shot influenced later Russian literature, including Fyodor Dostoevsky's Notes from Underground.

For modern readers, this story remains popular and relevant. It provides readers with insight into nineteenth-century Russian society, and the air of mystery surrounding Silvio attracts and retains readers.

To know more about The Narrator:

https://brainly.com/question/20038946

#SPJ4

Make a TDA on Social Media if it has a negative impact or a positive impact

Answers

Answer:

People who use social media to communicate lack empathy and do not wink an eyelid when they have to hurt someone.

Explanation:

While social media provides many benefits, such as giving students the chance to express themselves creatively, learning opportunities, and the chance to connect with others, social media can also have a negative impact on students, both physically and mentally.

First to help me I’ll mark u brainliest but u have to answer the questions

Answers

Answer:

Hope this helps!

Explanation:

Simon is different from the other boys not only due to his physical frailty, manifested in his fainting spells, but also in his consistently expressed concern for the more vulnerable boys. Littluns follow him, and he picks choice fruit for them from spots they can't reach, a saintly or Christ-like image. He stands up for Piggy and helps him get his glasses back when Jack knocks them off his head, another allusion to Simon's visionary bent. In addition, he has a secret place in the jungle, where he spends time alone. In contrast to Piggy and Ralph's equating adulthood with knowledge and higher understanding, Simon sees the darker side of knowledge. For him, the staked sow's eyes are "dim with the infinite cynicism of adult life," a view of adults not defined by the civilized politeness and capability the boys imagine. Yet Simon soldiers on in his quest to discover the identity of the beast on the mountaintop because he sees the need for the boys to face their fears, to understand the true identity of the false beast on the mountain, and to get on with the business of facing the beast within themselves.

Simon's loner tendencies make the other boys think he's odd, but, for the reader, Simon's credibility as a mystic is established when he prophesies to Ralph "You'll get back to where you came from." Simon reaches an abstract understanding of mankind's latent evil nature and unthinking urge to dominate as "mankind's essential illness." When Simon tries to visualize what the beast might look like, "there arose before his inward sight the picture of a human at once heroic and sick" — Golding's vision of humanity as flawed by inherent depravity. Golding gives this knowledge to an outsider like Simon to reflect the place visionaries or mystics typically hold in society: on the fringes, little understood by the majority, and often feared or disregarded. Like other mystics, Simon asks questions the other boys cannot answer. His questions to them, "What's the dirtiest thing there is?" and "What else is there to do?" require both abstract thought and courageous action to answer.

Complete the chart using your selected novel or short story for this module:
“Lob's Girl” by Joan Aiken
“Tuesday of the Other June” by Norma Fox Mazer
“Scout's Honor” by Avi
Twenty-One Balloons by William Pene du Bois
The Long Road to Gettysburg by Jim Murphy
Esperanza Rising by Pam Muñoz Ryan
The Watsons Go to Birmingham by Christopher Paul Curtis

Be sure to write in complete sentences and use textual evidence to support your responses, like this:
Describe the protagonist of your novel or short story.
The protagonist of my novel is a tough, sixteen-year-old girl named Delaney who is struggling to raise her little sisters.
Provide a quotation from the text to support your answer.
"Although she was just sixteen years old, Delaney had spent much of them providing for her sisters. She displayed the toughness – and weariness – of someone twice her age." (page 16)

Title of Novel or Short Story, Author, Setting, Protagonist, Conflict, Antagonist, Backstory, Plot Development

Answers

A boy growing up along the Mississippi River is the Mark Twain's 1876 book The Adventures of Tom Sawyer.

What is the narrative behind Tom Sawyer's Adventures?

A boy growing up along the Mississippi River is the subject of Mark Twain's 1876 book The Adventures of Tom Sawyer. St. Petersburg, which is based on Twain's childhood home of Hannibal, Missouri, is where it is set in the 1840s. In the book, Tom Sawyer goes on a number of adventures, frequently with his pal Huckleberry Finn.

Mark Twain's The Adventures of Tom Sawyer is a decent book. Naturally, Tom, the main character, experiences many interesting things. He is witness Spends a lot of time with his few buddies and does things that he definitely shouldn't have. He encounters numerous dangers and adventures throughout.

To know more about Adventures of Tom Sawyer visit:

brainly.com/question/30261403

#SPJ1

PLSSS HELP IF YOU TURLY KNOW THISSS

Answers

The answer is Phantom

Answer:

The word that corresponds with ghostly figure is B phantom

Explanation:

In the dictionary phantom is the synonym of ghostly figure.

Which sentence best serves as even of universal theme to back up Jack's reason

Answers

Regardless of cultural or regional distinctions, a universal theme is a concept that applies to everyone. In many areas, ideas can be linked by using universal themes. It is an important principle regarding the state of humanity.

What Is meant by  Universal Theme ?

Anybody can relate to a great work of art when it successfully conveys a human emotion. The most well-liked stories of today, like those created by Marvel and Disney, are popular because they touch on these human feelings, which is why most people find them to be compelling.

In this sense, a theme is an overarching thought or concept that recurs in a story and is crucial to understanding its meaning. Good themes in stories are universal and frequently resonant with both adults and children, as well as people from all walks of life.

Learn more about  Universal Theme, from :

brainly.com/question/29552037

#SPJ9

1.
2.
3.
4.
prefix + root word
super hero
Use a PREFIX from the box
to make a new word.
prefix + root word
freeze
fix
star
marine
new word
= new word
= superhero
PREFIX MEANINGS
prefix
super-
pre-
anti-
dis-
miero-
sub-
inter-
иои-
meaning
above
before
against
not, opposite of
small
under
between
not

Answers

prefix + root word = prefreeze

New word = prefreeze (meaning "to freeze before something else is done")

Example sentence: I always prefreeze the fruit before making smoothies to ensure they are nice and cold.

What is the prefix about?

In this exercise, we were given four root words - "hero", "freeze", "fix", and "marine" - and were asked to create new words by adding a prefix to each root word.

Therefore, the prefix "inter-" means "between" and the root word "freeze" refers to the process of becoming or making something cold and solid. Putting them together, we get "interfreeze," which could mean the process of freezing something between two layers or surfaces.

Learn more about prefix from

https://brainly.com/question/21514027

#SPJ1

What is most closely a seam of la Juanita?

Answers

In the brief but vivid tale La Juanita, the small town of Mandeville, where the regatta—a race of ships—is taking place, is described.

The Ballad of Dood and Juanita's plot is described.

The plot centers on retired Civil War soldier Dood and his wife Juanita, who become estranged one day after a bandit comes onto their property, shoots The Dude, and steals Juanita. But he is not murdered, and after being attended to by a Cherokee war party, Dood rides off to regain his bride.

In the statement below, what does the word "furtive" mean?

Aiming to avoid being noticed or drawn to. 'Furtive boys in pink shirts,' the context reads. Sentence: In an effort to dodge the police, the runaway tried to hide.

To know more about La Juanita visit :-

https://brainly.com/question/11438368

#SPJ1

!!WILL GIVE BRAINLIEST IF I PASS WITH YOUR ESSAY!! Write an interpretive essay (5 paragraphs) that analyzes literature from the perspective of a quotation. In your essay, interpret the quotation and explain how it applies to any literature you have read. Support your viewpoint with evidence from a variety of literary texts that you have read. Include precise language and literary terms.

"That's what literature is. It’s the people who went before us, tapping out messages from the past, from beyond the grave, trying to tell us about life and death! Listen to them!"

Answers

This quote by J.D. Salinger emphasizes how literature serves as a means of communication between past and present, offering insights into the human condition and universal truths about life and death.

What is emphasized?

Emphasized refers to the action of placing importance or significance on something, specifically on the idea that literature serves as a medium for communication between past and present, offering insights into the human condition and universal truths about life and death.

The above quote by J.D. Salinger suggests that literature is a way for people to communicate with the past and gain insight into life and death. Throughout history, authors have used literature as a medium to share their experiences, ideas, and emotions with their readers. This essay will explore how this quote applies to the literature that I have read and how it reveals universal truths about life and death.

The first literary work that comes to mind when thinking about this quote is "The Great Gatsby" by F. Scott Fitzgerald. In this novel, Fitzgerald uses literature to transport readers to the past and provide a glimpse into the lives of wealthy Americans during the Jazz Age. Through his vivid descriptions of lavish parties and extravagant lifestyles, Fitzgerald captures the excesses of the era and the disillusionment that followed the First World War. Moreover, the novel's themes of love, obsession, and the corrupting influence of wealth speak to universal truths about the human condition.

Another literary work that exemplifies Salinger's quote is Toni Morrison's "Beloved." In this novel, Morrison explores the legacy of slavery and its impact on African American communities. The novel's protagonist, Sethe, is haunted by the memory of her murdered child and struggles to come to terms with the trauma of her past. Morrison's use of magical realism and stream-of-consciousness narration enables readers to connect with Sethe's experiences and understand the historical and cultural forces that shaped her life. Through this novel, Morrison shows how literature can serve as a means of reckoning with the past and understanding the present.

A third literary work that demonstrates Salinger's quote is Gabriel Garcia Marquez's "One Hundred Years of Solitude." In this novel, Marquez tells the story of the Buendia family over several generations. Through his use of magical realism, Marquez creates a world that is both surreal and familiar, one that reveals the cyclical nature of time and the interconnectedness of all things. The novel's themes of love, death, and the struggle for power speak to the human condition and offer insights into the meaning of life and death.

Therefore, J.D. Salinger's quote highlights the role of literature as a means of communicating with the past and gaining insights into the human condition. The literary works that I have discussed - "The Great Gatsby," "Beloved," and "One Hundred Years of Solitude" - exemplify this idea by transporting readers to different times and places and providing insights into the universal truths of life and death. Through literature, we can connect with the experiences of others and gain a deeper understanding of ourselves and the world around us.

To learn more about emphasized click here

https://brainly.com/question/28031416

#SPJ1

What is the correct verb?

Research at the University of Adelaide suggests that just thirty seconds of exposure to drinks with high acidity are enough time to permanently damage tooth enamel

Answers

Answer:

damage

Explanation:

damage is the doing action

what issues problems or events are presented in the song blowing in the wind by bob dylan? does this song suggest any solutions to the issues or problems addressed?

Answers

Dylan in the song blowing in the wind by bob dylan addresses the issue of war, peace, racism, and freedom, issues that were apposite during 1960s.

What is blowing in the wind by bob dylan?

Bob Dylan's iconic protest song "Blowin' in the Wind" from 1962 has served as an anthem for causes ranging from civil rights to nuclear disarmament for a very long time. The speaker of this song asks a number of significant questions about why tyranny and conflict continue to exist, and his repeated, enigmatic response is, "The solution, my friends, is blowin' in the wind." The song says that grasping a truth that is universal but paradoxically impossible to comprehend is the key to putting an end to human cruelty.

Learn more on song here:

brainly.com/question/29026425

#SPJ1

what did Dewey feel in the beginning of the story in the book trouble River

Answers

Historical fiction is the genre, and Betsy Byars is the author. On a solitary prairie farm in the 1800s, Dewey Martin, his grandmother, and dog Charlie are there.

What happens in the book the river?

In The River, Derek, a government psychologist, is given a request for Brian to go back into the woods and teach him survival skills. Brian's survival skills are put to the test when Derek gets struck by lightning, forcing him to figure out how to get the badly hurt Derek out of the woods.

In his short story "How Far is the River," Ruskin Bond tells the tale of a little boy who longs to visit a river he has never seen before. A tall mountain covered in bushes, trees, and forest is situated between the boy and the river. The youngster is aware that there is a river that flows beyond that mountain, but he has never seen it.

Thus, Historical fiction is the genre, and Betsy Byars is the author.

For more information about happens in the book the river, click here:

https://brainly.com/question/30725349

#SPJ1

The
Based on clues from the text, what is the
meaning of the word differentiation?

Answers

Answer:

Explanation: he act or process of differentiating. : development from the one to the many, the simple to the complex, or the homogeneous to the heterogeneous.

write a letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved. 450 words ​

Answers

The letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved can be considered as a formal letter.

What is a formal letter?

A formal letter can be described as one that can be written to official people. check below for this letter.

Dear Honorable Minister of Education,

I am writing this letter to you to discuss three ways by which the quality of education in our country could be improved. As you know, education is the backbone of a nation, and it is essential that we strive to provide our students with the best possible education. Here are three suggestions that I believe can help improve the quality of education in our country.

Teacher Training: One of the most crucial aspects of improving the quality of education is to ensure that our teachers are well-trained and equipped with the necessary skills and knowledge. There should be regular teacher training programs that help teachers stay up-to-date with the latest teaching methodologies, technologies, and practices. We should also encourage teachers to attend workshops and conferences, which can expose them to new ideas and best practices.

Technology Integration: Technology is rapidly changing the way we live and work, and it can also transform the way we learn. Integrating technology in classrooms can help make learning more engaging and interactive, and it can also provide access to a wealth of online resources that can enrich the learning experience. We should consider providing more access to technology, such as tablets, laptops, and smartboards, and also invest in creating digital resources, such as online courses and educational videos.

Curriculum Review: Our curriculum should be regularly reviewed to ensure that it is relevant and up-to-date. The curriculum should focus on providing students with the necessary knowledge and skills to succeed.

                                                                                 Yours faithfully,

                                                                                            John

Learn more about letter at:

https://brainly.com/question/24140747

#SPJ1

If you chose a color to symbolize Act III, what color would you choose and why? Explain in 2-3 complete sentences using examples (not quotes) from the play

Answers

If I had to choose a color to symbolize Act III of a play, I would choose the color red. Red is a bold and intense color that represents passion, danger, and often signals a turning point in a story.

In Act III of Shakespeare's play "Romeo and Juliet," the color red is prevalent in the violent and tragic scenes that occur. For example, in the fight between Tybalt and Mercutio, both characters end up being fatally wounded and covered in blood. Additionally, the color red is also significant in the scene where Juliet drinks the potion that will make her appear dead, as it symbolizes the impending danger and tragedy that will unfold. Overall, the color red represents the intensity and passion of the characters in Act III, leading to their ultimate downfall.

For such more question on Romeo and Juliet

https://brainly.com/question/10647052

#SPJ4

do you agree with the author that “selfies have harmful phychological effects that can be specially destructive for women”? by bree rolfe

Answers

Yes, I agree with the author that “selfies have harmful phycological effects that can be specially destructive for women” by Bree Rolfe.

Why selfies have harmful phycological effects?

Even though it's unlikely that social media is the direct cause of serious mental health issues, it can exacerbate existing problems in children. Children who are anxious or depressed may think less highly of themselves and spend more time comparing themselves to others as a result.

Research and surveys have been done on the issue of selfies. Even a word exists to describe those who, as a result of taking selfies, become fixated on supposed flaws in their appearance. Selfie dysmorphia is what it is. This is comparable to the mental health condition known as body dysmorphic disorder, which is connected to OCD.

Learn more about selfies

https://brainly.com/question/30475414

#SPJ1

3.In two or three sentences, explain why Orwell was "very glad" the elephant had killed someone.​

Answers

In the essay  "Shooting an Elephant", Orwell was "very glad" that the elephant had killed someone because it made his own actions seem less morally ambiguous in the eyes of others.

Why was Orwell "very glad"  in "Shooting an Elephant"?

In his essay "Shooting an Elephant," Orwell describes the conflicting emotions he experienced while working as a police officer in colonial Burma and being forced to shoot an elephant to satisfy the expectations of the local population.

Orwell ultimately concludes that the imperial system he was serving was unjust and corrupt, leading to his feelings of guilt and regret over the situation.

Learn more about "Shooting an Elephant" here: https://brainly.com/question/6037738

#SPJ1

Colonel Graff and Mazer Rackham display contrasting attitudes and actions toward Ender from the beginning to the end of the novel. How do their actions change and what motivates this change?

Answers

Answer:

Colonel Graff and Mazer Rackham viewed Ender differently in Orson Scott Card's Ender's Game. Colonel Graff first manipulates Ender to save humanity from aliens. He deceives Ender and isolates him from his peers to make him the ultimate weapon. Graff shows real concern for Ender's well-being and emotional health toward the end of the novel, giving him closure on his actions in the last battle. Ender's humanity motivates this shift.

Mazer Rackham, who teaches Ender to combat aliens, is distant and frightening. As Ender improves, Rackham becomes more hands-on, teaching him methods and techniques beyond combat. Rackham changes because he admires Ender and thinks he can be a leader. Rackham mentors and fathers Ender toward the end of the novel, helping him deal with his shame and duty.

Source

"Ender's Game" by Orson Scott Card.

How did using smarts help the Allies plan for d day

Answers

The Allies used various forms of intelligence to plan for D-Day, including human intelligence, signals intelligence, and imagery intelligence. By gathering and analyzing this information, the Allies were able to make informed decisions about the timing, location, and strategy of the D-Day invasion.

One key intelligence tool that was used was Ultra, a top-secret program that allowed the Allies to intercept and decode German messages. By breaking the German military's encrypted codes, the Allies were able to gain valuable information about German troop movements, defenses, and intentions.

What is the type of conflict in Lob’s Girl by Joan Aiken
Character vs character
Character vs Nature
Character vs self
Character vs society

Answers

Answer:

Character vs society is the correct answer

Other Questions
The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose) 4: 7 and 12 : whats the ratio To organize this text, the author divides it into sections with subheadings. What is described in the section with the subheading "Darwin Is Stumped"? I How does the author's use of the word "assaulted* in paragraph 2 contribute to ourunderstanding of Hitler's propaganda?A.It shows that German citizens would not readily believe propaganda.B.It reveals that German citizens were physically attacked with propaganda.C.It emphasizes that the German government's propaganda campaign wasforceful.D.It shows readers that German citizens didn't like the propaganda they wereexposed to. What is the area of this polygon?16 cm224 cm240 cm218 cm2 Given that 224 hours of work need to be done to complete a project. (1) How long will it take 4 men, each working an 8-hour day to complete the project? (II) If each of them is paid 57-50 per hour, how much will it cost to employ them altogether? (iii) How many hours of overtime must they put in per day if the project is to be completed in 4 days? (iv) Given that the overtime rate of payment is l times as much as the regular hourly rate, find the cost of the project now. 8. DEF is an equilateral triangle.The midsegments of ADEF form AAB.What type of triangle is AABC? Explain your reasoning. Table 1: Time Required for Methylene Blue Color Change (10 points)Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time- Start Time)0 hours 1 hour 3 hours 4 hours A rectangle has a length of 6 centimeters and a width of x + 10 centimeters. Write an expression to represent the rectangles: area (square centimeters Alex has a pile of two pence coins. She swapped exactly half of them for the same number of 10p coins. Now she has 4.20. How much money did Alex have initially?" For the given word problem, write a system of equations, clearly define any variables, and show work for full credit.A photographer is mixing 5% acetic acid solution with a 10% acetic acid solution to get two liters of a 7% solution.How many liters of each solution should he add? What is the velocity of a 1,000.0 kg car if its kinetic energy is 200 kJ? Which expressions are polynomials?Select each correct answer.-7x+ 5/3x6x + 5xx^2+ 5x1/5-x^2+5x What is a common writing problem that should typically address when completing one's work Gloin is pretty smart and thinks about the future. We currently has $300,000 set aside for the future. We knows he should invest this capital so it gains interest but is also unsure. His advisor suggests that he split the money up in three investments: a. A high yield savings account that yields 9% per year, compounded quarterly for 5 years. b. A municipal bond that yields 6.78% per year, compounded twice a year for 10 years. If the first investment yields $200,000 at maturity and the second investment yields $100,000 at maturity then how much money does he have left over today? Question 7How does the author mainly show that the Party has affected Winston's perception of the world?a. He destroys the photograph of past leaders.b. He seeks out a prostitute in the proles.c. He kicks a severed hand in the street.d. He believes the Party's economic statistics.