Please help me with the work

Please Help Me With The Work

Answers

Answer 1

Answer:

1. you answered correctly :)

2. how many 1/4's go into 12? in other words multiply 12 and 4 to get 48/4

3. Draw a diagram of 1/5ths until it equals 15 (you'll need a total of 75 boxes)

4. the problem is 18z=72 so you need to divide 72 and 18. 72/18=4. therefore z equals 4.

5. make up a division problem that has the answer of 8. for example 24/y=3. y will equal 8. and then use a tape diagram for that.

6. make up a multiplication problem that has an answer of 8. for example 3y=24. y will equal 8. and then use a tape diagram for that.

7. Meghan is correct. when you have y divided by two you need to do the opposite and multiply both sides by two. Meredith was incorrect because she switched the division and multiplication signs completely which is not what you are supposed to do.

Step-by-step explanation:

I hope this helped :) (the only thing you could write down word for word is #7. for 1-6 just read what i have to say and follow the directions and it should help) have a great day!!!!

Answer 2

I will solve these equations algebraically.

Here you are:

1. 30= 5w

Divide each side by 5.

30÷5= 5w÷5

6      = w

∴ w= 6

To check,

30=5w

Substitute w for 6

30= 5 x (6)

30= 30

LS= RS

(You were correct, great job!)

2.

12 = x÷4

Multiply each side by 4.

12 x 4 = x/4 x 4 ↔ 4 and 4 cancel out.

48= x

∴ x=48

Checking:

12= 48÷4

12= 12

LS=RS

3.

y÷5=15

Multiply each side by 5.

y÷5 x 5= 15 x5

y =75

∴y=75

Checking:

Substitute y for 75.

y÷5=15

75÷5=15

15=15

LS=RS

4.

18x=72

Divide each side by 18.

18x ÷ 18= 72÷18

x          = 4

∴x= 4

Checking

18x=72

18(4)=72

72=72

LS=RS

I hope that these solutions helped you. I am sure that using the solutions, you can figure out the other questions on your own.


Related Questions

Help me please, if you dont know DONT ANSWER and please EXPLAIN yout answer <3

Answers

Answer

Nine and two thirds miles

Step-by-step explanation:

Convert the mixed numbers to improper fractions, then find the LCD and combine.

Exact Form:

29

¯

3

Decimal Form:

9.  6

Mixed Number Form:

9

2

¯

3

1 1/2 + 1 1/2 + 2 3/8 = 9 3/8

Find the mode(s) of the data set shown.
2, 6, 8, 3, 4, 6, 2, 6, 8, 5, 6, 2, 7, 8, 4, 3, 2, 7, 3, 4

Answers

Answer:

the numbers 2 and 6 are both the modes.

Step-by-step explanation:

the mode is the number that appears the most. if there are two numbers that appear most often (and the same number of times) then the data has two modes.

the nubers 2 and 6 were repeated 4 times. causing them to be the modes of the data set :)

[+] Hello ! [+]

Answer:

6 and 2 is your answer

Step-by-step explanation:

1. You have the numbers 2, 6, 8, 3, 4, 6, 2, 6, 8, 5, 6, 2, 7, 8, 4, 3, 2, 7, 3, 4

2. Count how much each number occurs.

2 occurs 4 times

6 occurs 4 times

8 occurs 3 times

3 occurs 3 times

4 occurs 3 times

5 occurs once

And 7 occurs twice

3. See which number occured the most.

Since 6 and 2 occurred the most, 6 and 2 is the answer to this problem.

----------------------------------------------

Thank you for you time! Brainliest is always appreciated! I hope this helped :) Have a wonderful and blessed day~

HELP ASAP
The graph shows the relationship between the number of months different students practiced boxing and the number of matches they won:

Part A: What is the approximate y-intercept of the line of best fit and what does it represent?

Part B: Write the equation for the line of best fit in the slope-intercept form and use it to predict the number of matches that could be won after 13 months of practice.

Answers

Answer:

Use khan academy for the graph.

Step-by-step explanation:

I think im right again but i would like confirmation. thanks

Answers

c he shouldn’t of put the 3 in there

A boogie board that has a regular price of $69 is on sale at a 35% discount. What is the sale price with 7% tax? Please show how you did it no files

Answers

Answer:

$47.99

Step-by-step explanation:

The level of water in a tank decreased steadily for a few weeks and then increased greatly for about a week..etc..

Graphs below

Answers

I think it might be D

Answer:

its the last one

Step-by-step explanation:

it decreased then went up to its highest point and stayed there

What is the area of the parallelogram? (10 point)


a

1 over 25 square foot


b

11 over 25 square foot


c

3 over 25 square foot


d

4 over 25 square foot

Answers

The correct answer is a

Answer: A 1/25 square foot

Step-by-step explanation:

THERE YOU GOOOO. :))))))))))

multiple choice in picture

Answers

Answer:

0.8

Step-by-step explanation:

I believe is 0.8. Make sure though

The scatterplot shows the number of people in a household the amount of water that is used monthly. Based on the scatterplot, what is the best prediction of the number of gallons of water a family of 5 would you?

Answers

Answer:

150 gallons

Step-by-step explanation:

As there shows consistency to the graph on a mass scale, then the consistency graph should only be used for consistency estimations ie) for all groups that live in same home so it proves not bias. The positive correlation stays huddled in tight data to see a line of fit, and by drawing perpendicular lines we see gallons of 150 are used by a family of 5

Find x. Please help!

Answers

Answer:

180° - 36° = 144 ÷ 2 = 72°

I'm sorry if I'm wrong

I'm from Indonesia, I love United States.

Fill in the blanks on this frequency table

Answers

Answer

Step-by-step explanation:

Answer:

50 + 20 = 70

10 + 40 = 50

60 + 60 = 120

Step-by-step explanation:

ez pz lemon squeze

help? :)

What fraction multiplication sentence could this model represent?

Answers

It’s not letting me see the picture
It depends on what u are currently learning on fraction like what category and then I will try to answer in the best way I can in the comments

Please help me if you understand this! (USAtest prep)


same question from earlier but i actually attached the image ;-;

Answers

Hey!

Please follow the formula. V = lwh (please multiply the length by the width by the height to get the answer

I am once again asking for the answers to this because the link gave my computer pop ups

Answers

Answer:

Sec 1 (in order)

30,48,98

Sec 2 (in order)

432,3060,420

Sec 3 (in order)

104.04  191.625  1334.64

I hope it helps!

Remember the formula is

V=LxWxH :)

What is the total surface area of the square pyramid in square inches?

Answers

first find the area of each of the triangles which is (9•7)(4)= 252 then add the area of the square which is 7•7= 49. 252+49= 301

The sum of the squares of three consecutive integer numbers is 1454. Find the numbers. I have already found 21 22 23 but the question says that there are 2 possibilities. please help!!!!!!

Answers

Answer:

three consecutive integers

Let x,(x+1),(x+2) represent the three consecutive integers

Question states

x^2 +(x+1)^2+(x+2)^2 = 110

Solving for x

3x^2 + 6x  + 5 = 110

3x^2 + 6x  -105 = 0

3(x^2 + 2x - 35)  = 0

 (x^2 + 2x - 35)  = 0  

factoring

 (x+7)(x-5) = 0 Note: SUM of the inner product(7x) and the outer product(-5x) = 2x

 (x+7)=0  |x = -7  The three consecutive integers are -5,-6,-7

 (x-5)=0  |x = 5   The three consecutive integers are 5,6,7

25 + 36 + 49 = 110  

The three consecutive integer numbers are 21, 22 and 23

Let the 3consecutive integers be x-1, x and x+1

Taking the sum of the squares

(x-1)²+x² + (x+1)² = 1454

x²-2x+1+x²+x²+2x+1 = 1454

3x²+2 = 1454

3x²= 1452

x² = 484

x = 22

First number is x - 1 = 22 - 1 = 21

second number is x = 22

Third number is x+ 1= 22+ 1 = 23

Hence the three consecutive integer numbers are 21, 22 and 23

Learn more here: https://brainly.com/question/24272171

This is the start of the question, thanks again!

Answers

Answer: A
Explanation: the two number problems do not equal the same thing until one of the number problems gets subtracted by a certain amount or adds a certain amount.
The answer I think is A... sorry if it’s wrong!

Find the Unit Rate (Slope).
A grocery store sells 6 oranges for $2. Assume that
the cost of the oranges varies directly with the
number of oranges. What is the cost per orange (cost
for 1 orange)?
depends on
Unit Rate(m) =
Equation (y = mx):

Answers

24/7 customer service. I hope it’s right
answer: 24/7
hope this helps you out .

hhahsecbxhsaBNIMQKBS help?

Answers

28.6 I think if it not I’m sorry

Answer:

28.6

Step-by-step explanation:

IF ANSWERED CORRECTLY WILL GIVE BRAINLIEST
Inference: More people prefer pink lemonade than any other flavor

Defend or challenge the inference with at least two complete sentences.

Answers

Answer:

1) because people enjoy the pink color, but also because it is not as sour with the added fruit flavors

2)  it is less sour than traditional lemonade.

Step-by-step explanation:

BEST ANSWER GETS BRANLIEST!

Zoya asked the students of her class their baseball scores and recorded the scores in the table shown below:

Baseball Scores


Score Number of Students
0 1
1 2
2 5
3 3
4 6
5 7
6 9


Based on the table, what is the mean baseball score?
2.5
2.9
3.5
4.1

Answers

Answer:

The mean baseball score is 2.5

2.5 is your answer because that’s the score

Select the favorable outcomes for rolling doubles.

A: (1-1) (2-2) (3-3) (4-4) (5-5) (6-6)

B: (5-1) (5-2) (5-3) (5-4) (5-5) (5-6)

C: (1-1) (1-2) (1-3) (2-1) (2-2) (3-1)

D: (1-3) (2-3) (3-1) (3-2) (3-4) (3-5) (3-6) (4-3) (5-3) (6-3)

Answers

Answer:

Step-by-step explanation:

huh

Will BAINLIST!!!!
The circle with center C was used as a model for a hot tub. The length of is 2 m. What is the circumference of the hot tub?

Answers

Answer:

6.283 m

Step-by-step explanation:

2m is the length so half is the radius

the radius is 1

so if c=2[tex]\pi[/tex]1

and [tex]\pi[/tex] 3.14159

u get 6.283

2(3.14159) x 1 = 6.283

brainliest pls i was first

Need help, please...

Answers

no, 10 isnt a solution.
> means more than. the _ under it means or equal to. what the equation is saying is that 10 is more than OR equal to 12. which isnt true because 10 is LESS than 12

Answer:

yes it is .

Step-by-step explanation:

6. The population of India is close to 1.08*10^9. Which of the fallowing represents this population written in standard notation?
f. 1,080,000,000
g. 180,000,000
h. 1,080,000
j. 108,000

Answers

It’s F, so you do 1.08, then move the decimal 9 places to the right
F because of PEMDAS, you do 10 to the power of 9 first, which gives you 1,000,000,000 , to which then you multiply by 1.08, giving you 1,080,000,000 :)

The probability of landing on blue when spinning a spinner is 4/5. Choose the likelihood that best describe the probability of this event

A) unlikely

B) likely

C) certain

D) neither likely or unlikely

Answers

Answer:

B) likely

Step-by-step explanation:

4/5 or 80%

If the answer is certain it would be 100% or 5/5 but it is 4/5 wich gives it the possibility to land on a different color than blue

The likelihood that best describe the probability of the event is option (B) likely is the correct answer.

What is probability?

Probability deals with the occurrence of a random event. The chance that a given event will occur. It is the measure of the likelihood of an event to occur.The value is expressed from zero to one.

For the given situation,

On spinning a spinner the probability of landing on blue = 4/5

⇒ [tex]80\%[/tex]

Then there is 80% chances that the spinner will land on blue.

Thus the likelihood that best describes the probability of this event is likely.

Hence we can conclude that the likelihood that best describe the probability of the event is option (B) likely is the correct answer.

Learn more about probability here

https://brainly.com/question/795909

#SPJ2

BRAINLIEST FOR WHOEVER ANSWER CORRECTLY!!!

Answers

Answer:

39/50 and 0.78

Step-by-step explanation:

78% = 78/100 (or 78 hundredths) = 0.78

39 ÷ 50 = 0.78

Answer:

39/50

Step-by-step explanation:

Someone reported my comment becuase they were mad lol.

HEEEEEEEEELLLLPPP EASY
The number of story books owned by eight classmates is shown below:

8, 9, 9, 7, 8, 6, 9, 8

Part A: What is the mean of the data? Show your work. (4 points)

Part B: Use your answer from Part A to calculate the mean absolute deviation for the data. Show your work. (6 points)

Answers

Answer:

Part A: The mean is 8  (count the number in the data set which is 8 then add the numbers which is 64 then divide by 64 by 8 which is 8)

Part B: Absolute Deviation= 0  

shown work for part B:      (subtract each number by the mean)

8-8+9-8+9-8+7-8+8-8+6-8+9-8+8-8=0

(then divide sum by mean) 0 divided by 8 = 8

Step-by-step explanation:

plz can i get Brainliest i tried my best and worked very hard

The number of storybooks owned by eight classmates is shown below: 8, 9, 9, 7, 8, 6, 9, 8. The mean is 8 and Absolute Deviation= 0.

How to find the mean value of a data set?

The mean value of the data set is the ratio of the sum of the data set's values to number of values it has.

If the data set consists of values

x_1, x_2, ..., x_n

, then we get the mean value as:

[tex]\overline{x} = \dfrac{x_1 + x_2 + \cdots + x_n}{n}[/tex]

The number of storybooks owned by eight classmates is shown below:

8, 9, 9, 7, 8, 6, 9, 8

Part A:

[tex]\overline{x} = \dfrac{ 8+ 9+ 9+ 7+ 8+ 6+ 9+ 8}{8}[/tex]

Therefore, The mean is 8

Part B: Absolute Deviation= 0  

subtract each number by the mean

8-8+9-8+9-8+7-8+8-8+6-8+9-8+8-8=0

(then divide sum by mean) 0 divided by 8 = 8

Learn more about mean and median;

https://brainly.com/question/17060266

#SPJ2

Two​ trains, Train A and Train​ B, weigh a total of 435 tons. Train A is heavier than Train B. The difference of their weights is 373 tons. What is the weight of each​ train?

Answers

Answer:

B

Step-by-step explanation:

Write a System of Equations for each scenario, then solve, and describe what your solution represents

Students are selling grapefruits and nuts for a fundraiser. The grapefruits cost $1 each and a bag of nuts cost $10 each. They sold 100 items and made $307. How many grapefruits did they sell?

Jada earns $7 per hour mowing her neighbor’s lawns. Andre gets paid $5 per hour for the first hour of babysitting and $8 per hour for any additional hours he babysits. What is the number of hours they bo to can work so that they get paid the same amount

Please remember you need to write two equations for each solution in y = mx + b format and find the solution of the two equations by finding the coordinate they intersect at, and describe what it means

Answers

Answer:

i dont understand?

Step-by-step explanation:

Other Questions
Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 1. Three fluids are poured from a beaker onto a lab table. Fluid A hits the table in 10 seconds, fluid B in 12 seconds, fluid C in 4 seconds, and fluid Din 15 seconds. Which fluid has the highest viscosity?O a fluid AO b. fluid BO c. fluid cO d. fluid D Which of the following is the correct definition for the term phrasal adverb?A. One or more adjectives in sequence that modify the same nounB. A phrase that functions as a unit to modify a nounC. Two or more words that function together as an adverbD. A single word that qualifies a single part of speech Pyramids depicting the number of organisms or biomass may be inverted, upright, or even diamond-shaped.Energy pyramids, however, are always upright. Why?