Please help me out with this it's urgent.​

Please Help Me Out With This It's Urgent.

Answers

Answer 1

Answer: Spirogyra

This is because Spirogyra is similar in both male and female living organisms and isogamy is the relation and similarities. The Spirogyra also has non-flagellated gametes.

I hope this helped & Good Luck <3!!!

Answer 2

Answer:

hence, the answer is SPIROGYRA...

Explanation:

hope it will help you!!(✿^‿^)

Related Questions

BRAINLIEST!!!

Two heterozygous tomato plants are crossed. What will the genotypes and phenotypes of the offspring be?

Answers

Answer:

When two heterozygous tomato plants are crossed, the genotypes of the offspring can be predicted using a Punnett square. The Punnett square for this cross would result in a 1:2:1 genotype ratio of homozygous dominant (AA), heterozygous (Aa), and homozygous recessive (aa) offspring. The phenotype ratio would be 3:1, with three plants exhibiting the dominant phenotype and one plant exhibiting the recessive phenotype.

This can be shown using a Punnett square, where each parent is represented by one row and one column, and the possible offspring are shown in the boxes in the middle:

[tex]\left[\begin{array}{ccc}&A&a\\A&AA&Aa\\a&Aa&aa\end{array}\right][/tex]

From this Punnett square, it can be seen that there is a 25% chance of each offspring being homozygous dominant (AA), a 50% chance of being heterozygous (Aa), and a 25% chance of being homozygous recessive (aa). The phenotype ratio of 3:1 is determined by the fact that the dominant allele (A) masks the recessive allele (a) in heterozygous individuals.

Assuming that the heterozygous tomato plants are both hybrid for the same trait, we can use a Punnett square to determine the possible genotypes and phenotypes of their offspring.

Let's represent the dominant allele as "A" and the recessive allele as "a". The genotypes of the heterozygous tomato plants would be Aa x Aa. Here is the Punnett square:

| A | a
--|---|---
A | AA| Aa
a | Aa| aa

From this Punnett square, we can see that the possible genotypes of the offspring are AA, Aa, and aa. However, since both parents are heterozygous, the AA genotype is not possible in their offspring. The phenotypes, or physical expressions of the traits, will depend on whether the A allele is dominant or recessive. If the A allele is dominant, then the offspring with the genotypes AA and Aa will have the dominant phenotype, while the offspring with the genotype aa will have the recessive phenotype. If the A allele is recessive, then only the offspring with the genotype aa will have the recessive phenotype, while the offspring with the genotypes AA and Aa will have the dominant phenotype.

So, without more information about the specific trait being studied and whether the A allele is dominant or recessive, we cannot determine the exact genotypes and phenotypes of the offspring.

read the passage about the Floridian Aquifer and answer the question that follows.

FLORIDIAN AQUIFER
There are many important, underground freshwater reservoirs in Georgia. People dig wells to reach these aquifers. One very important aquifer in Georgia is the Floridian aquifer. This aquifer provides a major source of drinking water to people who live in the coastal region of Georgia.

which best explains the Floridian aquifer is important to the coastal region of Georgia.

A. The Floridian aquifer provides people with too much available drinking water.

B. The Floridian aquifer provides people with fresh water that was once salt water and has been changed.

C. The Floridian aquifer provides people with man-made swimming pools since they are so easy to reach by digging.

D. The Floridian aquifer five people with a fresh water drinking supply in an area that would not normally have it.

Answers

Answer:

D. The Floridian aquifer provides people with a fresh water drinking supply in an area that would not normally have it.

Explanation:

Some disinfectants, like the one pictured below, claim that they are effective at killing viruses.
a. Does your knowledge of the structures and functions of a virus support or refute this claim?
b. Explain your position.

Answers

Understanding key virological concepts, such as how viruses live outside of cells, requires a thorough grasp of the precise structure of viral particles.

Describe the human virus.

A length of oligonucleotides (either DNA or RNA), encased in a protein coat, makes up a virus, an infectious bacterium. As viruses are unable to multiply on their own, they must infect host cells in order to utilise those cells' components as building blocks for their own replication.

Are viruses spread by everyone?

There are a lot of dormant and asymptomatic viruses constantly present in the human body. As viruses can infect any type of life, they can also be found in the bacterial, plant, & animal cells and materials in the gut. when virus infection of the body's cells results in damage.

To know more about Viruses visit:

https://brainly.com/question/29156932

#SPJ1

Write a 1,050- to 1,400-word article on how damage to the nervous system affects the sensory experience. Include the following:
Identify which nervous system structures are involved in that sensory system.
Identify which peripheral nervous system structures are involved in the chosen sensory systems, including sensory and motor neurons.
Explain potential or hypothetical damage to the structures.
Describe how the damage has affected the nervous system’s function, including autonomic nervous system responses (parasympathetic and sympathetic) as well as somatic nervous system responses.
Explain why this change in the nervous system has occurred.
Explain external indicators, or symptoms, of the damage.
Describe how the sensory experience may be different because of this damage.

Answers

The human nervous system is responsible for interpreting sensory information from the environment and transmitting signals to the brain for processing. The nervous system is composed of two main parts: the central nervous system (CNS) and the peripheral nervous system (PNS). The CNS includes the brain and spinal cord, while the PNS consists of the nerves that extend from the CNS to the rest of the body. Damage to any part of the nervous system can have significant effects on sensory experience. In this article, we will discuss how damage to the nervous system affects the sensory experience and identify the structures involved in the sensory system.

The sensory system is composed of various structures that work together to interpret and process sensory information. These structures include receptors, sensory neurons, and the brain. Each sensory system is responsible for a specific sense, such as touch, taste, smell, sight, and hearing. Let us consider the example of the somatosensory system, which is responsible for interpreting touch and pressure sensations from the skin.

The somatosensory system involves several structures in both the CNS and PNS. The primary sensory receptors for touch and pressure are located in the skin and are connected to sensory neurons in the PNS. These sensory neurons transmit signals to the spinal cord, where they synapse with interneurons and then project to the brain for further processing. The somatosensory cortex, located in the parietal lobe of the brain, is responsible for interpreting and processing touch and pressure sensations.

Damage to any of the structures involved in the somatosensory system can have significant effects on sensory experience. Let us consider hypothetical damage to the peripheral nervous system structures, including sensory and motor neurons. In this example, damage to sensory neurons in the skin would result in a loss of sensation or reduced sensitivity to touch and pressure stimuli. Motor neuron damage could lead to reduced motor function and movement in response to touch stimuli.

Similarly, damage to the central nervous system structures, such as the spinal cord or somatosensory cortex, would have severe effects on sensory experience. Damage to the spinal cord could result in a loss of sensation or movement in the affected areas, while damage to the somatosensory cortex could lead to a loss of tactile discrimination and difficulty interpreting touch and pressure stimuli.

Damage to the nervous system can also affect autonomic nervous system responses. The autonomic nervous system is responsible for controlling involuntary bodily functions, including heart rate, breathing, and digestion. The two branches of the autonomic nervous system, the sympathetic and parasympathetic nervous systems, have opposite effects
Load failed
on these bodily functions. The sympathetic nervous system is responsible for the "fight or flight" response, while the parasympathetic nervous system is responsible for the "rest and digest" response.

Damage to the nervous system can lead to dysregulation of the autonomic nervous system, resulting in changes to heart rate, blood pressure, and other vital functions. For example, damage to the spinal cord can lead to autonomic dysreflexia, a condition where the body overreacts to stimuli, resulting in a dangerous rise in blood pressure.

External symptoms of nervous system damage can vary depending on the location and severity of the injury. Common symptoms include pain, numbness, tingling, muscle weakness, and loss of sensation. In severe cases, nervous system damage can lead to paralysis, seizures, and loss of consciousness.

The sensory experience can be dramatically affected by nervous system damage. For example, damage to the somatosensory system can lead to loss of tactile discrimination, making it difficult to distinguish between different types of touch and pressure stimuli. Similarly, damage to the auditory system can lead to hearing loss or tinnitus, a condition where a person hears a ringing or buzzing sound in their ears. Damage to the visual system can lead to partial or complete blindness.

In conclusion, damage to the nervous system can have significant effects on sensory experience. The structures involved in the sensory system, including the CNS and PNS, work together to interpret and process sensory information. Damage to any of these structures can lead to changes in sensory experience and autonomic nervous system responses. Common symptoms of nervous system damage include pain, numbness, and muscle weakness. The sensory experience can be dramatically affected by nervous system damage, leading to a loss of tactile discrimination, hearing loss, or blindness. It is important to seek medical attention if you experience any symptoms of nervous system damage.

Please help. Question is above.

Answers

Answer:

MnO2 + 2HCl -> MnCl2 + 2H2O + Cl2

Explanation:

Use the appropriate chemical formulas to write the imbalanced equation.

Determine how many atoms of each element there are on both sides of the equation.

Determine the unbalanced components.

Begin balancing the components on one side of the equation that are present in a single molecule.

Verify that each component is balanced. If not, change the coefficients of the six molecules so each element has an equal amount of atoms on both sides.

Verify to make sure the coefficients are in the lowest whole-number ratio.

Verify once more that the equation is balanced, with an equal number of each sort of atom on both sides.

By adding coefficients of 2, 2, and 1 to the molecules, for instance, the equation MnO2 + HCl -> MnCl2 + H2O + Cl2 can be balanced to become MnO2 + 4HCl -> 2MnCl2 + 2H2O + Cl2.

Psychology Question Giving brainiest to the best answer

Answers

High-success methods are the methods which are used for the purpose of clarity and growth mindset as well. These are helpful in developing a clear mindset.

What are the high success methods?

According to the real success, having happiness, satisfaction, and respect in life is called as the real success and a person who is having all the above blessings is called as a successful person.

Irrespective of what is called as Success, it means to each, what has been clearly understood as that there are three key elements of success. These include the clarity of purpose, growth mindset, and courage to work and change. Without any purpose, it is hard to have a clear direction to work. It is also important to know what we want and what we are striving for.

Intelligence can be defined as a general mental ability for the purpose of reasoning, problem solving, and learning ability of a person. Because of the general nature, intelligence can be integrated as the cognitive function such as perception, attention, memory, language, or planning.

Learn more about Success methods here:

https://brainly.com/question/28220165


#SPJ1

What amino acid is coded for by this sequence before the mutation?

Answers

Answer: What is a mutation in an amino acid sequence?

A mutation in the amino acid sequence may alter the structure of a protein but it does not necessarily alter its function, although, the mutation at specific sites such as conserved residues can bring about a change in the structure and function of the protein. Dec 17, 2020

genetic code, the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) that determines the amino acid sequence of proteins. Though the linear sequence of nucleotides in DNA contains the information for protein sequences, proteins are not made directly from DNA.

Type at least 3 adaptions they have and explain how these adaptions help them survive in their environments

Answers

Answer:

1.Sharp incisors teeth for piercing and cutting.

2. Eyes on head.

3. Strong Legs.

4. Flexible Neck.

Explanation:

1. Sharp incisors teeth help it in cutting and getting its food into pieces suitable for it. It meets its nutritional needs.

2. Help it navigate and avoid the predators.

3. Strong Legs help it run away from the predator easily.

4 Flexible neck help it for broad view. It can see around.

What will most likely be included in the magazine article that follows this introduction? a description of carbon and other elements a study of plants grown in greenhouses suggestions for reducing carbon footprints information about earth day celebrations.

Answers

The idea that will most likely be included in the magazine article follows the introduction that suggestions for reducing carbon footprint.

The correct option is C.

What is a carbon footprint?

A carbon footprint is the total amount of greenhouse gas emissions—expressed as carbon dioxide equivalent—that a person, event, company, service, place, or product is responsible for.

The total quantity of greenhouse gases (such as carbon dioxide and methane) produced by our actions is known as a carbon footprint. One of the highest rates in the world, the average carbon footprint of an individual in the United States is 16 tons.

Learn more about carbon footprints at: https://brainly.com/question/27307580

#SPJ!

The recommended dosage for Albuterol is 0.3mg/kg/day to be given P.O. (by mouth) to a child weighing 47 lbs. Available: 2mg/5ml. How much of the solution is needed for the whole day?

Answers

Answer:
To calculate the amount of Albuterol solution needed for a child weighing 47 lbs (which is approximately 21.3 kg) with a recommended dosage of 0.3mg/kg/day, we can use the following formula:

Amount of Albuterol solution = Recommended dosage * Weight of the child

First, we need to calculate the recommended dosage for the child:

Recommended dosage = 0.3 mg/kg/day

Weight of the child = 21.3 kg

Recommended dosage for the child = 0.3 * 21.3 = 6.39 mg/day

Now we need to calculate the volume of the solution needed for the day:

Concentration of the solution = 2 mg/5 ml

To find out how many ml of the solution is needed, we can use the following formula:

Amount of solution (ml) = Amount of Albuterol (mg) / Concentration of the solution (mg/ml)

Amount of solution (ml) = 6.39 mg / (2 mg/5 ml)

Amount of solution (ml) = 15.975 ml

Therefore, the amount of Albuterol solution needed for the whole day is approximately 15.98 ml (rounded to two decimal places).

- I Hope This Helps! :)

All the cells in a person's body have the same DNA. True or False?

Answers

Answer:

Nearly every cell in a person's body has the same DNA. So True!

Explanation:

Hope this helps! <3

A scientist has a two-pronged thermometer that can be
connected to two liquids. In an experiment, the scientist
connects the thermometer to a liquid that is known to be
52. After waiting for the liquids to stabilize, the
thermometer reads 68. What is true about the original
temperature of the second liquid?
corded
O The temperature of the second liquid was originally
above 68'.
O The temperature of the second liquid was originally
exactly 68.
O The temperature of the second liquid was originally
between 52 and 68.
O The temperature of the second liquid was originally
below 52.

Answers

Answer:

c

Explanation:

Photo circulatory respiratory poroject

Answers

Answer:

Emotional support

Explanation:

Here is the photo for the project

please answer the image

Answers

A. Tryptophan is present, the trp repressor bind the operator and RNA synthesis is blocked.

What role does tryptophan play in the control of the trp operon?

The trp repressor changes into its active (DNA-binding) form as a result of the tryptophan's binding to it. In order to prevent RNA polymerase from attaching to the promoter and stopping transcription of the operon, the tryptophan-bound trp repressor connects to the operator.

What role does tryptophan have in E. coli?

Tryptophan activates a repressor in E. coli that binds to the trp promoter-operator and prevents transcription from starting. Tryptophan in B. subtilis activates TRAP, an RNA-binding protein, which binds to the trp operon leader RNA and stops transcription.

What occurs when there is tryptophan in the environment?

Cellular resources are redirected away from the development of tryptophan synthesis enzymes when tryptophan is present in the environment. When the trp operon is activated, tryptophan causes the transcription to end too soon.

To know more about the tryptophan visit:

https://brainly.com/question/23847957

#SPJ1

Some of the food you eat is not broken down into tiny particles in the digestive system. Suggest what happens to the food that is not broken down.​

Answers

When some of the food we eat is not broken down into tiny particles in the digestive system, it may pass through the digestive system relatively unchanged and be eliminated from the body as feces.

Fiber, for example, is a type of carbohydrate found in plant-based foods that cannot be broken down by human digestive enzymes. Instead, it passes through the digestive system mostly intact and provides bulk to the feces, helping to promote regular bowel movements and prevent constipation.

Other substances that are not broken down in the digestive system may be absorbed into the bloodstream and transported to the liver for further processing or elimination from the body. For example, alcohol is absorbed through the stomach and small intestine walls and is metabolized by the liver.

In some cases, undigested food may cause digestive discomfort or symptoms such as bloating or gas. In others, it may be associated with more serious conditions such as malabsorption syndromes, inflammatory bowel disease, or other digestive disorders. If you experience persistent digestive symptoms or concerns, it is important to consult a healthcare professional for evaluation and treatment.

Which sentence correctly describes the relationship between chromosomes and genes?
Responses
A Chromosome is just another word for gene.
B Every chromosome is made up of many genes.
C Genes use chromosomes to make proteins.
D Organisms have many more chromosomes than they do genes.

Answers

Answer: C It is true that Genes use chromosomes to make proteins

Explanation: we learned it in science

Question 1 (1 point)
A binomial name consists of....
the generic name and then the family name
the specific name and then the generic name
the generic name and then the specific name

Question 2 (1 point)
He formalized the binomial nomenclature as the modern system of naming organisms.....
Aristotle
Carl Linnaeus
Charles Darwin

Question 3 (1 point)
The widely accepted code for the naming of animal species.....
ICNafp
ICZN
ICNB

Question 4 (1 point)
The binomial name for a species of banana...
Musa paramecium
Musa Musa
Paradiscium Musa

Question 5 (1 point)
The taxonomic rank consists of what is below the genus level...
Domain
Family
Species

Answers

the generic name and then the specific name
Carl Linnaeus
ICZN
Musa paradisiaca
Species

Which best describes the President's Cabinet?
O the hidden drawer in the President's desk
O the group of law-makers who represent the President in Congress
O the location of the nuclear "red button" for the President
O group of advisors for the President
No new data to save. Last checked at 10:51am
Sul

Answers

Answer:

Explanation:

The best description of the President's Cabinet is that it is a group of advisors appointed by the President to help manage various aspects of the federal government. The Cabinet is made up of the heads of executive departments such as the Secretary of State, the Secretary of Defense, the Secretary of Treasury, and others who are appointed by the President and confirmed by the Senate. The Cabinet's role is to advise the President on matters related to their respective departments and to coordinate policies and actions across the federal government.

Read this sentence.

Ironwood, one of the most densest types of wood in the world, sinks in water.

Which sentence uses the modifies correctly?



A) Ironwood, one of the densest types of wood in the world, sinks in water.

B) Ironwood, one of the more denser types of wood in the world, sinks in water.

C) Ironwood, one of the more dense types of wood in the world, sinks in water.

D) Leave as is.

Answers

The sentence which uses the modifies correctly is "Ironwood, one of the densest types of wood in the world, sinks in water." Thus, the correct option is A.

What are Modifiers in sentence?

Modifiers are the words, phrases, and clauses which affect and often enhance the meaning of a given sentence. Modifiers offer the details which can make a sentence more engaging, clearer, or specific. The simplest form of a modifier would be an adjective or an adverb.

Verb has three forms, the third form for dense is densest and it should not be used with most or more. Therefore, the correct sentence will be "Ironwood, one of the densest types of wood in the world, sinks in water."    

Therefore, the correct option is A.

Learn more about Sentences here:

https://brainly.com/question/14492351

#SPJ1

Please help with this question ignore my lines they might be wrong

Answers

When you are born, two chromosomes—the X and the Y chromosome—determine whether you are a boy or a girl. Sex chromosomes are referred to as: There are two X chromosomes in females. Each male has one X and one Y chromosome.

The characteristic with its correct definition below;

A sex chromosome is a chromosome that differs from a normal autosome in shape, size, and activity. It is also known as an allosome, heterotypical chromosome, gonosome, heterochromosome, or idiochromosome.

Both homozygous (two alleles for brown eyes) and heterozygous individuals can have brown eyes (one for brown and one for blue).

Sex-linked traits or qualities are those that are impacted by genes found on the sex chromosomes, as related to genetics.

When an organism's cells only have one pair of chromosomes, the organism is said to be haploid.

The visible traits of an individual that are the outcome of gene expression; the clinical manifestation of a person with a certain genotype. The term "phenotype" describes a person's observable characteristics, such as height, eye color, and blood type.

One chromosome is typically inherited from the mother and the other from the father in a pair. Homologous chromosomes, for instance, are the two copies of Chromosome 1 in a cell.

Learn more about  Sex chromosomes,

https://brainly.com/question/1535625

#SPJ1

what types of bonds are occurring at the origin between the enzyme and the DNA backbone ( what functional groups are in the backbone of DNA)?

Answers

DNA structure is stabilized by hydrogen bonds that are created between the two DNA chains' sugar-phosphate backbones. Phosphodiester bonds, which connect nucleosides, are what create nucleic acids.

What is DNA so special?

Deoxyribonucleic acid is the name given to DNA because of its structure. The deoxyribose component of the nucleic acid contains pentose sugar, while the phosphate backbone of the nucleic acid contains bases including adenine, cytosine, guanine, or thymine.

Where can I find DNA, and what is it?

Plasmid dna (DNA) is indeed an organic molecule that has instructions for protein production and genetic data. Every cell in an organism contains it to some extent. DNA is an essential component of reproduction, and it is through the transmission of DNA from a parent or parents onto offspring that genetic inheritance is transmitted.

To know more about DNA visit:

https://brainly.com/question/264225

#SPJ1

Hi fellow bre- I mean brainy users I need your help giving 30 POINTS!!!

What would you expect to cause a drop in air pressure?

Slowly dropping air temperature
Rising air temperature
The air temperature staying the same
A drastic drop in air temperature
Question 5(Multiple Choice Worth 2 points)
(10.03 MC)

What happens to the humidity if the temperature drops and the amount of moisture in the air stays the same?

The humidity is not affected by temperature.
The humidity increases.
The humidity decreases.
The humidity stays the same.

Answers

Answer:

for question 1

Rising air temperature

For question 2

Humidity increases

Explanation:

Hope this helps im not sure though

Answer: rising air temperature, when air temperature drops, air pressure will increase

Explanation: when air gets warmer, it expands creating less pressure. as it cools, it compacts creating more pressure.

Which of the following happens when the polar ice caps melt?

A. sea level rise

B. sea level fall

C. tectonic plates move

D. headlands become valleys

Answers

A sea level rises
Ik bc ik
Sea level falls (A) because ice caps are made of water and are if enough of them melt the sea level can rise

Which stage in the life cycle of a plant is represented in this picture? (2 points)

cones from a pine tree

© Chushkin / iStock 2018 a

Adult plant b Seed c Seedling Sprout d

Answers

The presence of cones indicates that the plant has already gone through the seedling and sprout stages and has reached maturity.

What is Seeding?

Seeding refers to the process of planting seeds in order to grow new plants. It is an important part of the life cycle of plants and is essential for the continuation of their species. The seed contains all the genetic information and nutrients necessary for the growth and development of the plant. Once the seed is planted, it begins to germinate, and a new plant begins to grow. Seeding is used in agriculture, gardening, and horticulture to produce crops, flowers, and other plants.

Plants have a life cycle that begins with the seed stage and progresses through several stages to reach maturity as an adult plant. The seedling stage comes after the seed stage, during which a sprout emerges from the seed and starts growing into a young plant. As the plant grows, it eventually reaches maturity, which is the adult plant stage.

The stage in the life cycle of a plant represented in the picture is the adult plant stage. The cones are reproductive structures that contain seeds and are only produced by mature, adult plants.

Learn more about Seeding from given link

https://brainly.com/question/417970

#SPJ1

What characteristic was used in this mission to determine a banana's relationship to other the plants?

Answers

The characteristic used to determine a banana's relationship to other plants is its morphology or physical characteristics.

What is morphology?

Morphology is the study of the form and structure of living organisms, including their physical and anatomical features. In biology, morphology is used to describe the appearance, shape, and size of different parts of an organism, such as its organs, tissues, cells, and even its molecules. This includes the study of external and internal structures, as well as their function, development, and evolution. Morphological characteristics are often used in the classification and identification of different species, as they can provide important clues about an organism's evolutionary history, ecological niche, and relationship to other organisms.

We assume you are referring to the scientific classification of bananas in the plant kingdom. In this case, the characteristic used to determine a banana's relationship to other plants is its morphology or physical characteristics. Bananas belong to the genus Musa, which is part of the family Musaceae.

The characteristics used to classify plants into different taxonomic groups include their structural features, such as their leaves, stems, flowers, and fruit, as well as their genetic and evolutionary relationships. These characteristics are used to group plants into increasingly broader taxonomic categories, from species to genus, family, order, class, phylum, and kingdom.

To know more about plant kingdom  visit :-

https://brainly.com/question/30382175

#SPJ9

100 points to whoever can solve this problem fast and will be marked as brainliest

Answers

Mammal ff spotted fur

Insect Ww. Large wings

Plant PP. Purple flowers

Mammal Ff. Solid fur

Insect Rrbb. Yel body red eye

Plant Sstt Smooth pea short

Mammal TTBB Long tail brown eye

Insect WWBb large wing brown body

Plant SSpp. Smooth pea white flow

Mammal TtBb. Long tail brown eye

Insect rrbb. Yel body brown eye

the roots of this tree are growing toward the stream, what sentence best explains how this benefits the tree

Answers

Trees create jobs, provide flowers, fruit, fodder and gas to communities and residing creatures, provide coloration to nomads and their livestock, provide shelter to birds and animals, forestall soil erosion and flooding, enhance water catchment, generate oxygen, reduce air pollution and gain posterity while decarbonisin g the ...

What are the benefits of tree roots?

Roots assist timber and assist to limit soil erosion. They take in water and different beneficial compounds from soil that the tree uses to make meals and other resources.

What are the benefits of trees paragraph?

One of the simple advantages of planting trees is that they provide the life-giving oxygen and absorb carbon-dioxide exhaled via animals. However, now not just oxygen timber additionally supply us fruits, wood, fibre, rubber and a good deal more. Trees also serve as shelter for animals and birds.

Learn more about growing toward here;

https://brainly.com/question/428672

#SPJ1

Lesson 3:3 activity 4 model a lunar eclipse by showing how the moon is illuminated . Top view and view from earth

Answers

During a lunar eclipse, the Earth comes between the Sun and the Moon. The illuminated side of the Moon faces the Sun while the Earth casts a shadow on the Moon, preventing the sunlight from reaching the Moon's surface.

Modeling the lunar eclipse

To model a lunar eclipse, you can use a light source to represent the Sun and a round object, such as a ball, to represent the Moon. Position the light source on one side of the ball to represent the Sun's light shining on the Moon.

Next, use a flat object, such as a piece of cardboard, to represent the Earth and position it between the light source and the ball representing the Moon. This will cast a shadow on the ball, representing the Earth's shadow on the Moon during a lunar eclipse.

When you look at the ball from the side facing away from the light source, you will see that the side of the ball facing the Earth is not illuminated, while the other side of the ball facing the light source is fully illuminated. This represents the Moon during a lunar eclipse, with the Earth's shadow blocking the sunlight from reaching the Moon's surface.

Read more on Lunar eclipse here:https://brainly.com/question/8643#SPJ1

Linnaeus, Lamarck, and Buffon all touched on some aspect of "evolution." However, what key feature did their ideas all lack, which Charles Darwin would later develop?
Group of answer choices

An understanding of diversity of life on Earth.

A mechanism for evolutionary change.

Proof of the great age of the Earth, necessary for evolution to take place.

A basic understanding of inheritance.

Answers

A mechanism for evolutionary change is the key feature that the ideas of Linnaeus, Lamarck, and Buffon lacked, which Charles Darwin would later develop.

What is Inheritance?

Inheritance refers to the process by which genetic information is passed down from one generation to the next. In living organisms, genetic information is stored in DNA molecules, which are inherited by offspring from their parents. This genetic information contains the instructions for the development, growth, and function of an organism, including its physical traits, behavior, and susceptibility to disease.

While these early scientists recognized patterns of similarity and variation among species, they did not propose a viable mechanism for how these changes occurred over time. Darwin's theory of natural selection provided the mechanism for evolutionary change, explaining how traits that confer an advantage in survival and reproduction become more common in a population over generations.

Learn more about  Inheritance from given link

https://brainly.com/question/15078897

#SPJ1

Chemicals that travel through the bloodstream and affect the
activities of other cells are called

Answers

Answer:

hormones.

Explanation:

Other Questions
Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose) 4: 7 and 12 : whats the ratio To organize this text, the author divides it into sections with subheadings. What is described in the section with the subheading "Darwin Is Stumped"? I How does the author's use of the word "assaulted* in paragraph 2 contribute to ourunderstanding of Hitler's propaganda?A.It shows that German citizens would not readily believe propaganda.B.It reveals that German citizens were physically attacked with propaganda.C.It emphasizes that the German government's propaganda campaign wasforceful.D.It shows readers that German citizens didn't like the propaganda they wereexposed to. What is the area of this polygon?16 cm224 cm240 cm218 cm2 Given that 224 hours of work need to be done to complete a project. (1) How long will it take 4 men, each working an 8-hour day to complete the project? (II) If each of them is paid 57-50 per hour, how much will it cost to employ them altogether? (iii) How many hours of overtime must they put in per day if the project is to be completed in 4 days? (iv) Given that the overtime rate of payment is l times as much as the regular hourly rate, find the cost of the project now. 8. DEF is an equilateral triangle.The midsegments of ADEF form AAB.What type of triangle is AABC? Explain your reasoning. Table 1: Time Required for Methylene Blue Color Change (10 points)Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time- Start Time)0 hours 1 hour 3 hours 4 hours A rectangle has a length of 6 centimeters and a width of x + 10 centimeters. Write an expression to represent the rectangles: area (square centimeters Alex has a pile of two pence coins. She swapped exactly half of them for the same number of 10p coins. Now she has 4.20. How much money did Alex have initially?"