PLEASE HELP ! ,

Great Britain has a powerful central government in which voters elect their legislators, but not their Prime Minister. Great Britain is thus an example of a(n):
A. Democratic, Federal, Presidential system
B. Democratic, Unitary, Presidential system
C. Authoritarian, Unitary, Parliamentary system
D. Democratic, Unitary, Parliamentary system

Answers

Answer 1

The correct option is D i.e., Great Britain is thus an example of a Democratic, Unitary, Parliamentary system.

What is the name of a democratic government?

A democratic republic is a system of governance that adheres to democratic and republican ideals. Democratic republics, which combine elements of both republics and democracies, may run on common values.

What form of government does Great Britain have?

In a constitutional monarchy like the United Kingdom, no open political choices are made by the king or queen who is now in power as head of state. The government and Parliament are responsible for making all political decisions.

To know more about Democratic visit-

https://brainly.com/question/13158670

#SPJ1


Related Questions

This is an excerpt from Justice Henry Brown’s majority opinion in the case of Plessy v. Ferguson.

We consider the underlying…argument [to be]…the assumption that the enforced separation of the two races stamps the colored race with a badge of inferiority. If this be so, it is…solely because the colored race chooses to put that construction upon it…. The argument also assumes that social prejudice may be overcome by legislation, and that equal rights cannot be secured except by an enforced commingling of the two races…. If the civil and political rights of both races be equal, one cannot be inferior to the other civilly or politically. If one race be inferior to the other socially, the Constitution of the United States cannot put them upon the same plane.
What was the immediate impact of this ruling?

A. Segregation of African Americans continued throughout the nation.
B. The 14th Amendment was repealed.
C. Legislation to prevent the disenfranchisement of African Americans became law.
D. Jim Crow legislation ended.

Answers

The immediate impact of Justice Henry Brown’s majority opinion in the case of Plessy v. Ferguson was segregation of African Americans continued throughout the nation. Thus, the correct answer is option A.

What was Plessy v. Ferguson case?

In the seminal case Plessy v. Ferguson, 163 U.S. 537, the U.S. Supreme Court upheld the "separate but equal" principle, which held that racial segregation laws were constitutional as long as they provided equal access to facilities.

The ruling validated numerous state statutes that had been implemented in the American South following the end of the Reconstruction era that had reinstituted racial segregation. Homer Plessy, a man of mixed race, purposefully boarded a "whites only" railway car in New Orleans in 1892, which led to the start of the main lawsuit.

Therefore, segregation of African Americans continued throughout the nation.

To learn more about Plessy v. Ferguson, click here:

https://brainly.com/question/1175315

#SPJ1

What 1819 event made many Americans want to elect officials who better protected their interests

Answers

The first major financial crisis in the nation was the Panic of 1819, which caused the economy to collapse for two years. Bankruptcies and a lot of   were also caused by the panic.

What exactly is "The Panic of 1819"?

The Panic of 1819  event prompted many Americans to reconsider the New Republicans and their system of internal improvements, tariff protection, and the Second Bank of the United States. As a result, many Americans wanted to elect officials who would better protect their interests.

This starts when the Second Bank of the United States tries to curb inflationary practices because many Western branches had issued a lot of money to farmers and speculators without having enough money to back the money they were using to buy the paper money. They thought they could solve the problem by drastically cutting loans to these branches, but this led to real property foreclosures.

To learn more about 1819 event visit :

https://brainly.com/question/11686719

#SPJ1

how does medical fit the theme of Frontiers in History.

Answers

A frontier is the political and geographical area near or past a boundary. A frontier can also be referred to as a "front". The time period got here from French in the 15th century, with the that means "borderland"—the region of a united states of america that fronts on another u . s . (see additionally marches).

What is the frontiers in records thesis?

The Frontier Thesis or Turner's Thesis (also American frontierism) is the argument advanced by means of historian Frederick Jackson Turner in 1893 that a settler colonial exceptionalism, under the guise of American democracy, was fashioned with the aid of the appropriation of the rugged American frontier.

During the 2022–2023 faculty year, National History Day® (NHD) invitations college students to research topics associated to the theme, Frontiers in History: People, Places, Ideas. This theme is wide sufficient in scope to inspire the investigation of matters ranging from neighborhood to international history.

Learn more about frontiers  here:

https://brainly.com/question/14194363#SPJ1

PLEASE HELP
Put the following events surrounding America's involvement in World War I in order from first to last.

1) America finally entered the war, eventually helping the Allies win.

2) President Wilson attempted peace talks with both sides.

3) War broke out between Germany, Great Britain and France.

4) Great Britain and France struggled against Germany, while America traded with
both sides.

5) Great Britain set up a blockade to keep America from trading with Germany.

5) Germany attacked America's ships with submarine warfare.

Answers

The Great War, usually referred to as World War I, was a worldwide battle that raged from 1914 to 1918.

Explain World War I.

With Germany, Great Britain, and France, war broke out. While America conducted trade with both sides, Great Britain, France, and other nations fought against Germany. To prevent trade between the United States and Germany, Great Britain erected a blockade. With both parties, President Wilson tried to negotiate a settlement. Germany used submarine warfare to strike American ships. It is right that America eventually joined the conflict and ultimately contributed to the Allies' victory. The Allies and the Central Powers were the two primary alliances in the war, which included the biggest nations of the era. Even though the war was won by the Allies, millions of people died and were injured.

To Know more about World War I Visit:

brainly.com/question/1449762

#SPJ1

The Communist Party of America organized:
A. the NAACP.
B. the Bonus Army.
C. Hoovervilles.
D. unemployed councils.

Answers

The Communist Party of America is organized by Unemployed Councils, hence option D is the correct answer

What is Communist Party?

A political party that works to achieve communism's socioeconomic objectives is referred to as a communist party. The title of Karl Marx and Friedrich Engels' book The Manifesto of the Communist Party made the phrase "communist party" well-known.

A political and economic system known as communism advocates for a classless society in which the means of production are owned collectively and private property is nonexistent or severely restricted. Communism puts itself in opposition to liberal democracy and capitalism.

Learn more about Communism here:

https://brainly.com/question/12173354

#SPJ1

Why were enlightenment ideas limited government and popular sovereignty, important for the early US Constitution

Answers

The enlightenment ideas were important because it helped to create the desire for the people as they fought to have their own government in America

Why were enlightenment ideas important

Enlightenment ideas such as limited government and popular sovereignty were important for the early U.S. Constitution because they reflected the desire of the American colonists to create a government that was accountable to the people and respectful of their rights.

Limited government means that the powers of government are restricted by law.

Read more on enlightenment ideas here:https://brainly.com/question/474990

#SPJ1

describe the actions of each group or person that led to the fall of the western roman empire
THEODOSIS
THE VISIGOTHS
THE VANDALS
GENERAL ODOACER

Answers

Answer:

The fall of the Western Roman Empire was a complex and gradual process that took place over several decades. While there is no single cause for its collapse, several key events and actions contributed to its decline. Here is a brief summary of the actions of each group or person that played a role in the fall of the Western Roman Empire:

Emperor Theodosius: Theodosius was the last emperor to rule over both the Eastern and Western halves of the Roman Empire. After his death in 395 CE, the empire was permanently divided, weakening its overall power and making it more vulnerable to attack.

The Visigoths: In 410 CE, the Visigoths, a Germanic tribe from present-day Romania, sacked the city of Rome. This was a significant blow to the prestige and morale of the empire, as Rome had not been successfully attacked by an outside force in over 800 years. The Visigoths continued to raid and conquer Roman territory throughout the 5th century.

The Vandals: In 455 CE, the Vandals, another Germanic tribe, invaded Rome and plundered the city. This was a devastating blow to the already weakened empire and marked the beginning of the end for the Western Roman Empire.

General Odoacer: In 476 CE, Odoacer, a Germanic mercenary general, deposed the last Western Roman Emperor, Romulus Augustus, and declared himself king of Italy. This event is traditionally seen as the end of the Western Roman Empire, although the Eastern Roman Empire (Byzantine Empire) continued to exist for another thousand years.

Overall, the fall of the Western Roman Empire was the result of a combination of internal decay, external pressures from barbarian tribes, and the gradual erosion of Roman power and influence over time

Which of the following statements is a lie?

A. There is only one way to formally amend the Constitution. That is through an amendment.

B. When an amendment is added to the Constitution, it becomes part of the Constitution.

C. Most amendments added to the Constitution were added as a result of judicial review.

Answers

Answer:answer is c

Explanation:

its obvious

The statement that is a lie is C.

Most amendments added to the Constitution were not added as a result of judicial review. Instead, they were added through the formal amendment process outlined in the Constitution. Judicial review refers to the power of the courts to interpret the Constitution and determine the constitutionality of laws, but it does not involve adding amendments to the Constitution.

Death marches in the holocaust which statement best identifies the central idea of the text

Answers

Option (A), The main premise of the essay is best expressed by the phrase "Death marches"—despite not being the initial aim of the evacuations—which ultimately turned into an instrument for Nazi murder.

On the death march, how were the prisoners treated?

Throughout these execution marches, the SS guards cruelly mistreated the prisoners. They killed hundreds of prisoners who fell over while marching, were unable to keep up, or were unable to evacuate trains or ships by following their precise directions. Famine, exhaustion, and exposure claimed the lives of numerous prisoners.

When was The Death March written?

Hiro Ainana's web novel Death March to the Parallel World Rhapsody was first published in 2013 on the user-generated content platform Shsetsuka ni Nar before being republished as a light novel with illustrations by shri. Volume 1 of the book was released by Fujimi Shobo in March 2014.

Learn more about Death marches: https://brainly.com/question/12315449

#SPJ1

The complete question is:

Q. Death marches in the holocaust

Which statement identifies the central idea of the text?

(a). “Death marches” ended up becoming a tool for Nazi murder, but that was not the original intention of the evacuations

(b). Towards the end of the war, some concentration camp prisoners were able to escape the SS during evacuations.

(c). While treacherous, the SS never intended to kill any prisoners during the evacuation marches as they were needed for labor.

(d). Few prisoners were subjected to death marches, as Allied troops were able to intervene during the evacuations.

How did Roger Biles feel about the New Deal ?

Answers

Answer:

Explanation:

Roger Biles is a historian who specializes in American urban history and politics. His research focuses on the New Deal era, which was a period of significant social, economic, and political change in the United States during the 1930s. Biles wrote about the New Deal because it was one of the most important and transformative periods in American history, marked by the introduction of a range of federal government programs and policies designed to alleviate poverty, stimulate economic growth, and promote social welfare.

Biles's work on the New Deal explores the impact of these policies on cities and urban communities. He is interested in understanding how New Deal programs affected the lives of ordinary people, particularly those living in urban areas. Biles also examines the political and economic forces that shaped the New Deal, and how it helped to transform the relationship between the federal government and American society. By studying the New Deal, Biles provides important insights into the history of American social welfare policies and the role of government in promoting social and economic justice.

the election?
AB raham LivCULN. "
Critical Thinking
3. Drawing Conclusions Why did both Northerners and
Southerners reject John Crittenden's compromise?
Fighting at Fort Sumter chapter 14, guided reading towards Civil War lesson three succession in war
Sequencing number of the following list of events in the order they happened Lincoln issued a call for troops Lincoln set alarm men with supplies to the fort

Answers

Northerners and Southerners reject John Crittenden's compromise because They had just announced a campaign to prevent the expansion of slavery into other lands.

What is an election?

The term "election" refers to the process by which a person engages in voting to create a government with their preferred representatives by giving them their support.

The agreement reached by John Crittenden is The 1820 Compromise authorized the maintenance of slavery in the South, prohibited its abolition on federal property in slave-owning states,  and prohibited slavery in the North from being abolished.

Learn more about Election, here:

https://brainly.com/question/11185151

#SPJ1

Read the excerpt from “From Barter to Bitcoin.”

In parts of Africa, people used salt as currency for trade with Europe during the Middle Ages. In ancient Central America, the currency was cacao beans, the main ingredient in chocolate. In Thailand, tiny seashells served as currency. Other items used as currency in different parts of the world include polished stones, glass beads, furs, cattle, and even fish. In colonial Virginia, tobacco served as a currency.

Question
Drag the conclusion that can be made from the information in the excerpt into the box. Answers: items preferred for use as currency are those that last forever so that they maintain their value. items chosen as currency are those that have the most trade value within the region and with other regions. items selected as currency are those that are most expensive to own based on the region they are used.

Answers

The conclusion that can be made from the information in the excerpt in the box is items chosen as currency are those that have the most trade value within the region and with other regions.

Why is this so?

The information presented in the excerpt shows that different regions of the world have used a variety of items as currency for trade throughout history.

These items include salt, cacao beans, seashells, polished stones, glass beads, furs, cattle, fish, and tobacco, among others.

The common theme across different regions seems to be that the items chosen as currency were those that had the most trade value within the region and with other regions.

Read more about conclusions here:

https://brainly.com/question/24542637

#SPJ1

How many ships were given for the expedition?

Answers

There were 5 ships used in Magellan's expedition.

Answer:

Five ships where used.

Explanation:

. What is the impact (influence) of public opinion on public officials? Have changes in public opinion influenced changes in policymaking? Give examples to support your answer.

Answers

Answer:

The impact of public opinion on public officials is immense. Public opinion has the ability to shape and alter policymaking by providing feedback to elected representatives about what their constituents want or doesn't want. Changes in public opinion can be seen in almost every aspect of policymaking, from tax laws to environmental regulations.


For example, public pressure influenced the passage of The Endangered Species Act (ESA) in 1973, establishing a comprehensive program for protecting endangered species and their habitats across the United States. This law was created due to an overwhelming shift in public view towards more significant conservation - something largely ignored before this act was passed.

Question:
A primary aim of the United States Open Door Policy was to


A. encourage the Chinese to emigrate to other nations
B. prevent European powers from dividing up China
C. develop China's industrial capacity
D. introduce democratic government into China​

Answers

B. prevent European powers from dividing up China.

The United States Open Door Policy was a set of diplomatic principles established in the late 19th and early 20th centuries to protect American commercial interests in China and to promote equal access by all countries to trade and investment opportunities in China. The policy was based on the principle of territorial and administrative integrity of China and aimed to prevent the partition of China by European powers, especially during the period of the Boxer Rebellion in 1900. The policy was also intended to protect American interests in China, which included maintaining access to Chinese markets and resources, ensuring the safety of American citizens and property in China, and promoting American influence in the region.

Let me not to marriage of true minds
admit impediments, love is not love
which alters when it alteration finds,
or bends with the remover to remove.
O no, it is a ever-fixed mark
that looks on tempests and is never shaken;
it is the star to every wand'ring bark,
whose worths unknown, although his height be taken
loves not times fool, though rosey lips and cheeks
within his bending sickles compass come,
love alters not with his brief hours and weeks
but bears it out even to the edge of doom:
if this error and upon me proved,
I never writ, nor no man never loved.

his text excerpt is an example of what type of Renaissance literature?
A. the sonnet
B. the picaresque
C. the devotional
D. the epic poem

if you are gonna answer, tell me why it's right so I know your 100% this is right.​

Answers

Explanation:

The text excerpt is a sonnet written by William Shakespeare, a prominent Renaissance poet and playwright. The sonnet is a specific form of poetry that originated in Italy and became popular in Renaissance

This timeline of events relates to international terrorism from 1993-2001.

Based on this timeline, which statement is true?


A. The September 11 attacks were the first successful act of international terrorism in the United States.
B. The September 11 attacks reflected the trend of international terrorists targeting military installations.
C. The September 11 attacks marked a shift to international terrorists using tactics focused on producing mass civilian casualties.
D. The September 11 attacks were a continuation of acts of international terrorism targeting Americans abroad.

Answers

Answer:

C

Explanation:

What is censor motion?

Answers

Answer:

The motion to censure is a main motion expressing a strong opinion of disapproval that could be debated by the assembly and adopted by a majority vote.

Answer:

Explanation:

Main motion expressing strong opinion of disapproval that could be debated by the assembly and adopted by a majority vote.

Complete the following Assignment:
Read the following:
pg. 491, "Marcus Garvey Appeals for a new African Nation"
Complete the following questions:
1. Why does Garvey call for black homeland in Africa?
2. How realistic was this call in the 1920s for nationhood in Africa?
3. Who does Garvey believe should lead (or should not lead) the new African nation?
4. What are the qualifications for such leadership?
5. What does Garvey think the globe will look like in the future?
6. How will peoples of various colors coexist?

Answers

Answer:

Garvey calls for a black homeland in Africa because he believes that black people have been oppressed and mistreated in America, and that they should have a nation of their own where they can govern themselves and be free from discrimination and prejudice.

Garvey's call for nationhood in Africa in the 1920s was not very realistic, as most of Africa was still under colonial rule and controlled by European powers. Additionally, many African leaders at the time were not interested in creating a separate nation for black people from other parts of the world.

Garvey believes that black people should lead the new African nation, and that they should not allow white people or other non-black people to interfere or take control.

According to Garvey, the qualifications for leadership in the new African nation should include intelligence, education, and a commitment to the principles of self-determination and racial equality.

Garvey believes that in the future, the globe will be divided into separate nations based on race and ethnicity, with each group governing themselves and living according to their own culture and traditions.

Garvey believes that peoples of various colors can coexist peacefully as long as they respect each other's differences and do not attempt to dominate or oppress one another. He suggests that each group should have its own separate homeland where they can live and thrive according to their own values and beliefs.

Explanation:

which parts of the constitution establishes the legislative branch of the government

Answers

Answer:

Article I

Explanation:

The legislative branch of the United States government is established by Article I of the Constitution. This article outlines the structure, powers, and limitations of the legislative branch, which is responsible for making the laws of the country.

Article I, Section 1 begins with the following sentence: "All legislative Powers herein granted shall be vested in a Congress of the United States, which shall consist of a Senate and House of Representatives." This establishes the framework for the legislative branch and outlines the two houses of Congress.

Article I, Section 2 establishes the House of Representatives, outlining the qualifications and terms of office for its members, as well as the process for electing them.

Article I, Section 3 establishes the Senate, outlining the qualifications and terms of office for its members, as well as the process for electing them.

Article I, Section 8 outlines the powers of Congress, including the power to tax, regulate commerce, declare war, and make laws that are necessary and proper for carrying out its other powers and duties.

In summary, the establishment of the legislative branch is primarily outlined in Article I of the Constitution, which establishes Congress as the body responsible for making laws and outlines the structure, powers, and limitations of the two houses of Congress.

Answer:

lolz

Explanation:

U.S. Constitution establishes the Legislative Branch of the federal government hope da helps

(2)Which issues the U.S supreme court address in Plessy V. Ferguson (1896)and Brown V.Board of Education (1954)
*
one man, one vote
racial quotas
separate -but-equal facilities

Answers

Answer:

Seperate-but-equal

Explanation:

Plessy V. Ferguson: A case in which the Court held that state-mandated segregation laws did not violate the equal protection clause of the Fourteenth Amendment.

Brown V.Board of Education: Separate but equal educational facilities for racial minorities is inherently unequal.

Both were in regards to segregation

How did the ideas of Jean-Jacques Rousseau compare to those of John Locke? (its either A or C)

Rousseau believed people were naturally good and Locke that people are born neutral.

Both believed that individuals were corrupted by society.

Both condemned the idea of individuals having the rights of life, liberty, and property.

Rousseau opposed any revolution, and Locke supported some.

Answers

John Locke and Jean-Jacques Rousseau had similar views on society, but they differed in that they did not attribute social injustice to sinful human nature. They place more blame on the dysfunctional political system, which is a factor in the corruption of community members.

What are ideas of John Locke?

Jean-Jacques Rousseau and John Locke both held similar views on society, but they did not attribute social injustice to sinful human nature. They focus more on the crooked political system, which is a contributing role in the corruption of community members. When it came to the idea of establishing rules that would prevent governments from violating the liberties of their citizens, Locke was more circumspect. But, Rousseau would not allow any government to restrict personal freedoms until a majority of the populace agrees to it through the assembly and the general.

To learn more about John Locke  click,

https://brainly.com/question/2152628

#SPJ1

What benefits did these clauses give the allies

Answers

they added the war guilt provision to forced Germany and Belgians to consent

Answer:

They added the war guilt provision to force Germany and Belgians to consent.

Explanation:

The War Guilt Provision was inserted in order to force the French and Belgians to consent and limit the amount of money that Germany should have to spend to cover for the harm done by the battle. The War Guilt Provision was inserted in order to force the French and Belgians to consent and limit the amount of money that Germany should have to spend to cover for the harm done by the battle. The article was seen as a concession by the negotiators to the Germans..

How had the machine gun affected the World and warfare since World War 2

Answers

Answer:

Since World War 2, the machine gun has remained an important weapon in modern warfare and has been used in various conflicts around the world. However, the development of new technologies and weapons, such as drones and guided missiles, has reduced its prominence on the battlefield.

2. Describe a global trade organization. What is it? And what is it used for?

Answers

A global trade organization is an international organization that promotes free trade and facilitates economic cooperation between its member countries. It is typically established through an agreement among participating countries, which outlines the organization's mission, objectives, and rules of operation. The main purpose of a global trade organization is to create a framework for international trade that promotes economic growth, development, and stability.

The most well-known global trade organization is the World Trade Organization (WTO), which was established in 1995 to replace the General Agreement on Tariffs and Trade (GATT). The WTO currently has 164 member countries, representing the vast majority of global trade.

The WTO's primary role is to promote free and fair trade by establishing rules and regulations that govern international trade, and by providing a forum for member countries to negotiate and resolve trade disputes. The organization works to reduce trade barriers such as tariffs, quotas, and other trade restrictions, which can hinder the flow of goods and services between countries. It also promotes transparency and accountability in international trade practices by monitoring and enforcing compliance with its rules and regulations.

In addition to the WTO, there are other global trade organizations that promote economic cooperation among specific regions or groups of countries, such as the European Union (EU), the Association of Southeast Asian Nations (ASEAN), and the North American Free Trade Agreement (NAFTA). These organizations are designed to facilitate trade and economic integration among member countries, and to promote political and social stability through increased economic cooperation.

why is brazil a model colony?

Answers

Minas Gerais is the name of the vast area of the Brazilian interior wherein gold was extracted (General Mines). During the 18th century, gold mining in this region rose to prominence as colonial Brazil's primary industry.

Brazil was what kind of colony?

Brazil was developed and extended as a colony, kingdom, and a crucial component of a Portuguese Empire from the 16th towards the early 19th centuries. Lisbon's early objectives were straightforward: control the profitable business of pau-brasil, a red wood that gave the settlement its name and was valuable for manufacturing dye, and build long-term colonies. There is proof that the Portuguese and Indians initially collaborated to gather trees.

To know more about Minas Gerais visit:

https://brainly.com/question/30481073

#SPJ1

The eighth amendment protects an accused persons rights before and after a trial, create a simple, political cartoon with speech bubbles or captions that shows one of the rights protected by the eighth amendment and why it’s important

Answers

Judges are prohibited from requesting high bail, penalties, or extraordinary punishments, according to the satirical piece that will be created to make reference to the Eighth Amendment.

The Eighth Amendment is what?

The Due Process is a law that forbids the use of high fines and cruel, unusual penalties for alleged crimes. By incorporating these laws into the constitution, torture, pain, and death are avoided and everyone is given a just punishment for their misdeeds. The political cartoon's allusion to the 8th Amendment will demonstrate that judges are prohibited from rendering biased judgments against any criminal. Judges are prohibited from keeping someone behind bars prior to their court date by setting an unreasonable bail amount.

To know more about Eighth Amendment visit:

https://brainly.com/question/1321514

#SPJ1

What factors contribute to the rise of nazi power in Germany and how did this lead to the implementation of policies that eventually resulted in the holocaust

Answers

The holocaust came to be because the United Nations blamed Germany for starting World War 1. Germany had to pay all the repercussions of World War 1 and the germanic people were shamed for being German. inflation rose in Germany which was caused by mass producing money to pay off debts. Hitler tried taking the power by force and was jailed the first time. the second time he played by the election rules and promised change for the German people. he also wrote a book while in prison called Mien Kampf. when he came to power he started passing laws to change how Germany is viewed. some of these laws included Burning books, making Jews wear the David star on their clothes, sending them to their own poorly maintained communities and eventually Prison camps, and the execution of Jews, resulting in the Holocaust

WRITING ASSIG
Directions: For the prompt,
please complete the following as
if it were an LEQ: Introduction Paragraph (context and thesis), then bullet point as many facts/details as possible
that support your claim. Your bullet points should include information from the collapse of the Qing and Imperial
Russia as well as the Mexican Revolution.
Evaluate the extent to which the collapse of the Qing Dynasty was
similar to the collapse of Imperial Russia.

Answers

Answer:

Introduction: The collapse of the Qing Dynasty in China and the collapse of Imperial Russia were two major events that had a significant impact on the world in the early 20th century. Both of these empires experienced a period of decline and eventual dissolution, leading to the emergence of new nations and governments. This essay will evaluate the extent to which the collapse of the Qing Dynasty was similar to the collapse of Imperial Russia, by examining their respective causes, effects, and outcomes.

Qing Dynasty:

• Both the Qing Dynasty and Imperial Russia experienced a period of decline due to a combination of internal and external factors, such as economic stagnation, military defeats, and foreign interference.

• The Qing Dynasty was weakened by a series of rebellions, including the Taiping Rebellion and the Boxer Rebellion, which caused significant damage to the empire’s infrastructure and economy.

• The Qing Dynasty was eventually overthrown in 1911 by the Chinese Revolution, which led to the establishment of the Republic of China.

Imperial Russia:

• Imperial Russia was weakened by a series of military defeats, including the Russo-Japanese War and World War I, which caused significant damage to the empire’s infrastructure and economy.

• The Russian Revolution of 1917 overthrew the Tsar and led to the establishment of the Soviet Union.

• The collapse of Imperial Russia had a significant impact on the world, as it led to the emergence of communism as a major political ideology.

Mexican Revolution:

• The Mexican Revolution of 1910 was a major event that had a significant impact on the world in the early 20th century.

• The revolution was caused by a combination of internal and external factors, such as economic inequality, political corruption, and foreign interference.

• The revolution led to the overthrow of the Porfirio Diaz regime and the establishment of a new government in Mexico.

Conclusion: In conclusion, the collapse of the Qing Dynasty and Imperial Russia were similar in many ways, as both empires experienced a period of decline due to a combination of internal and external factors. However, the outcomes of these collapses were different, as the Qing Dynasty was replaced by the Republic of China while Imperial Russia was replaced by the Soviet Union. The Mexican Revolution also had a significant impact on the world in the early 20th century, as it led to the overthrow of an oppressive regime and the establishment of a new government in Mexico.

Explanation:

After your group discussion, respond independently to the following reflection questions.
1. What did you lear from this conversation?
2. What did you contribute?
3. How did you prepare for this discussion?
4. What ground rules did you and the other participants establish? How did they work?
5. What is an example of a time during the discussion when you challenged or built on
an idea shared by someone else?
I
6. Did you disagree with a point raised during the discussion? How did you respond to
it?
7. How well did you and the other discussion participants support your ideas with
evidence?
8. How have your ideas about this topic changed as a result of this conversation?

Answers

Answer: When and in what state was the Combahee River raid?

Explanation: When and in what state was the Combahee River raid?

Other Questions
Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor determine which of the following features they have in common. private vs public enterprises debate Please provide steps! You are given a primary amino acid sequence of a protein.Explain how you would predict the secondary and tertiary structuresthat the mature version of the given protein would adopt. ABC Incorporated shares are currently trading for $32 per share. The firm has 1.13 billion shares outstanding. In addition, the market value of the firms outstanding debt is $2 billion. The 10-year Treasury bond rate is 6.25%. ABC has an outstanding credit record and has earned a AAA rating from the major credit-rating agencies. The current interest rate on AAA corporate bonds is 6.45%. The historical risk premium over the risk-free rate of return is 5.5%. The firms is estimated to be 1.1, and its marginal tax rate, including federal, state, and local taxes, is 40%.a. What is the cost of equity?b. What is the after-tax cost of debt?c. What is the WACC? Fill in the blank with the French word that best completes the sentence.La sur de mon pre est________.ma surma tantema fillema cousine Question:What is the importance of being educated? Cite and explain the things thhat Filipinos consider to be educated.Note:(I would really appreciate it if it was a simple answer. But if not, it's fine. :) ) What is illustrated by the following line from the second inaugural address: "seeking to destroy it without warseeking to dissolve the union"?a. Allusion b. Didacticismc. Dramaticd. Irony e. Parallelism